Hindlimb unloading induces time-dependent disruption of testicular histology in mice

doi:10.21203/rs.3.rs-1520489/v1

Download PDF

Research Article

Hindlimb unloading induces time-dependent disruption of testicular histology in mice

https://doi.org/10.21203/rs.3.rs-1520489/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Objectives: Mechanical unloading of the body in the hindlimb unloaded (HU) mice induces pathology in multiple organs, but the effects on testes are poorly characterized. We investigated the histology and Raman spectroscopy of the mouse testes following HU condition.

Methods: We divided male, c57BL/6j mice into ground-based controls or experimental groups for two and four weeks of HU. The testes tissues were dissected after euthanasia to investigate histological and Raman spectroscopic analysis.

Results: We found an HU-induced atrophy of testes irrespective of the time duration (p < 0.05). Histological analysis revealed that the HU induced epithelial thinning, luminal widening, and spermatozoa decline in the seminiferous tubules of the mouse testes. In addition, we found a thickening of the epididymal epithelia and tunica albuginea. These changes were accompanied by a generalized depression in the Raman spectra, indicating an altered concentration and/or orientation of several molecules. We also report reduced signal intensities of hydroxyproline and tryptophan, potentially contributing to testicular pathology during HU. Conclusion: Taken together, our findings indicate that the two or four weeks of HU induce disruption of testicular architecture and molecular phenotypes. Our results may have implications for understanding and/or treating male infertility associated with prolonged bed rest and spaceflight.

Hindlimb unloading

Testes

seminiferous tubules

Raman spectroscopy

necroptosis

The human body is evolutionarily designed to live in earth’s gravity. However, conditions of reduced gravity, such as spaceflight and prolonged bed rest, negatively affect various physiological functions of the body (Qaisar et al., 2020). Male reproductive organs are specifically vulnerable to damage due to reduced gravity (Moustafa, 2021). This is partly due to the cephalic redistribution of body fluids and the decline of other body systems, including cardiovascular and musculoskeletal systems. Reduced gravity induces several structural and functional alterations in testicular tissues. For example, reduced spermatogenesis is a common finding in reduced gravity conditions, as the early stages of spermatogenesis are susceptible to compromised testicular blood supply (Chen et al., 2006; Nichiporuk et al., 1998). Similarly, several histopathological alterations are observed in testicular tissues under reduced gravity conditions.

The ground-based mouse model of hindlimb unloading (HU mice) mimics several physiological and pathological alterations in body systems during reduced gravity (Globus and Morey-Holton, 2016). The HU-induced detriment of several body features has been thoroughly characterized over the past four decades. Among different body systems, the male reproductive system may be of primary relevance in dictating the generalized health and male phenotype. Specifically, testes secrete androgens, which have systemic effects on multiple organs due to their anabolic actions. Consequently, a thorough characterization of testicular morphology in the HU may help understand the detrimental effects of bed rest and simulated microgravity on male reproductive system. However, only a handful of studies have investigated the male reproductive system in HU conditions. For example, seven days of HU is shown to lower testosterone levels and impair spermatogenic function in mice (Wang et al., 2016). Further, a significant reduction in the expression of androgen receptors is also reported following seven days of HU, which is associated with irreversible pathological damage as the duration of HU further increases (Deaver et al., 1992; Ding et al., 2011). This decline in the male reproductive hormones may cause systemic effects on the health of several body systems, warranting the necessity of restoring testicular function (Aitken, 2013; Sengupta et al., 2018). However, despite the adequate evidence of male reproductive suppression during unloading, the histopathological changes in testes are poorly characterized. Specifically, the timing of the induction and exacerbation of testicular pathology during HU is not known.

In the present study, we investigated the histopathological changes in the mouse testes under HU conditions in a time-dependent manner. We chose the two and four weeks timepoints related to most hospitalized patients on bed rest. Further, we evaluated the global molecular phenotypes of HU mice testes using Raman Spectroscopy. We hypothesized that the testicular tissues would show a time-dependent detriment in histology and molecular phenotype during HU conditions.

Animals and HU conditions:

We randomly assigned 4-month-old, male c57BL/6j mice into ground-based controls and HU mice (n = 8–12 / group). The HU mice were further divided into two subgroups based on two- and four-weeks duration of HU. The mice were kept under controlled environmental conditions (20 ± 1°C, with light/dark periods of 12h each) with food (standard chow diet for mice) and water provided ad-libitum. The HU mice were suspended in specially designed cages, as described previously (Azeem et al., 2021; Maffei et al., 2014). At the end of the experiments, mice were euthanized via cervical dislocation, and the testes were immediately harvested and weighed. Tissue was either fixed in Bouin’s and processed for histopathological staining (Hematoxylin & Eosin and Masson’s trichrome) or snap-frozen for Raman Spectroscopy analysis. The experimental protocol was approved by the University Animal Care and Use Committee in agreement with accepted international standards.

Testicular and Epidydimal Morphometry:

Following the dissection, the testis and the epididymis were fixed in Bouin’s solution and stored in 70% ethanol, and subjected to paraffin embedding. For light microscopic examination, the ethanol-fixed tissue was sectioned at 4 µm and further stained with hematoxylin and eosin (H&E) and Masson’s trichrome (Bancroft and Layton, 2012). Morphometric analysis was done as described previously by us (Ranade et al., 2011). The mean area percentage of collagen fibers content was analyzed using the Image-Pro Plus program, while the spermatogenetic activity evaluation was done using Johnson’s score (Hess, 1990).

Raman Spectroscopy:

The experimental Raman spectra were obtained by using Renishaw inVia confocal Raman microscope. Following the euthanasia, the testes tissues were snap-frozen for analysis. We collected ten spectra from randomly selected locations of each sample to obtain the average. Each recording involved exposure of a 50 µm tissue segment for 10 seconds to a 785 nm laser of 1% intensity (14 mW), as described previously (Azeem et al., 2021). The spectral range was kept between 100 cm^− 1 and 1200 cm^− 1, representing the peaks for biological molecules. All spectra were collected at 500 cm^− 1 intervals and then stitched together to obtain the full spectrum (Azeem et al., 2021).

Quantitative real-time PCR validation:

Selected necroptosis markers were used for RT-PCR analysis, as described in detail elsewhere (Bhaskaran et al., 2017). Briefly, total RNA was extracted using the RNase kit (Qiagen, Valencia, CA, USA) from 15mg of frozen testicular tissues. cDNA was synthesized using SuperScript II reverse-transcriptase (Life Technologies, Grand Island, NY, USA), and quantitative real-time PCR was performed using the SYBR Green PCR Master Mix with primers. The following primers and their sequences were used in this study, RIPK1 (forward: TTACATGGAAAAGGCGTGATACA, reverse: AGGTCTGCGATCTTAATGTGGA), RIPK3 (forward: CATAGGAAGTGGGGCTACGAT, reverse: AATTCGTTATCCAGACTTGCCAT), MLKL (forward: AGGAGGCTAATGGGGAGATAGA, reverse: TGGCTTGCTGTTAGAAACCTG), and 18s (forward: GGACCAGAGCGAAAGCATTTGCC, reverse: TCAATCTCGGGGTGGCTGAACGC). Calculations were performed using delta-delta-ct method, as described previously (Qaisar et al., 2021).

Statistical analysis:

All numerical values are presented as mean ± SEM, and the comparisons among the groups were performed by one-way analysis of variance (ANOVA) and Turkey’s multiple comparison tests, with a single pooled variance. Data were analyzed using GraphPad Prism 9 (GraphPad Software, La Jolla, CA), and p < 0.05 was considered statistically significant.

The HU resulted in reduced body weights of the mice suspended for two and four weeks when compared to ground-based controls (p < 0.05) (Fig. 1A). However, only the mice suspended for four weeks showed a significant reduction in testicular weight (p < 0.05) (Fig. 1B). However, since tissue weight is partly determined by body weight, we normalized the testicular weight to body weight in all three groups. The normalized testicular weight was significantly lower in both groups of HU mice than ground-based controls (p < 0.05) (Fig. 1C).

Testicular Morphometry:

We next investigated the microscopic analysis of the testes in the three groups of mice. A significant deterioration of the testicular histology was observed in the HU mice in a time-dependent manner. The ground-based control mice exhibited a homogenous testicular architecture with more than 90% of the seminiferous tubules showing normal morphology, well-developed spermatogenic cells, and dense spermatozoa (Fig. 2A). However, two weeks of HU resulted in a disrupted tubular architecture, characterized by epithelial thinning and the appearance of vacuolation (Fig. 2B).

The HU for four weeks also resulted in necrotic tissues in the seminiferous tubules (Fig. 3A). Image analysis revealed increased standard luminal diameter and reduced epithelial height in both groups of HU mice than controls (all p < 0.05) (Figs. 3D and E).

We next investigated the epididymal tissues of the three groups of mice. The spermatozoa density was significantly reduced in both groups of HU mice when compared to control mice (p < 0.05) (Figs. 3A-D). In addition, we also observed the retraction of the spermatozoa into the central portions of the tubular lumen. We also found an increase in the epididymal epithelial height with HU in the mice (p < 0.05) (Fig. 3E).

We next used Masson’s trichrome staining to measure the thickness of tunica albuginea in the three groups of mice. Compared to control mice, the HU resulted in a significant thickening of tunica albuginea in both groups of HU mice (p < 0.05) (Fig. 4).

Raman Spectroscopy analysis:

Raman spectra were obtained from snap-frozen testicular tissues of the three groups of mice (Fig. 5A). We first calculated the spectra for the molecules of tryptophan [C₁₁H₁₂N₂O₂] and hydroxyproline [C₅H₉NO₃], which are among the most abundant amino acids in the biological tissues (Liu et al., 2020). The molecular structures were obtained from the PubChem database (Karna et al., 2019). The theoretically calculated spectra for both molecules are shown in Fig. 5B. Our model showed that the band at 351 cm^− 1 was a cumulative effect of the rocking vibrational modes of H-N-H, H-C-H, and C-O-H bonds of tryptophan and O-H bonds of hydroxyproline. The band at 459 cm^− 1 in the experimental agreed with the model, which showed a peak at a slightly higher frequency, 468 cm^− 1. It emerged due to C-C ring vibrations of hydroxyproline. The stretching vibrations of N-H and H-N-H bonds of tryptophan gave rise to a Raman band at 526 cm^− 1 in the experimental spectrum. However, it appeared to be more robust when compared to the corresponding calculated bands at 516 cm^− 1 and 552 cm^− 1.

We next investigated the global Raman spectra of seminiferous tubules and tunica albuginea from the three groups of mice (Figs. 6A and B). We found that two weeks of HU resulted in generalized depression of the signal intensity across the whole frequency range. The four weeks of HU further reduced the signal intensity from the mice tissues. These findings indicate deterioration of the global molecular phenotypes of the mouse seminiferous tubules and tunica albuginea due to HU.

Expressions of the markers of necroptosis:

We next investigated the expression of the necroptosis pathway as a potential contributor to the testicular disruption during HU. RIPK3, RIPK1, and MLKL have emerged as important markers of necroptosis in pathological tissues. We found a trend towards an increase in the expressions of RIPK3 and MLKL with HU (Fig. 7). However, these differences failed to reach statistical significance due to high data variability.

To our knowledge, this is the first study investigating testicular histopathology in HU mice. We investigated the pathological effects of HU on mouse testes in a time-dependent manner. Our findings indicate that the HU results in a significant disruption of testicular architecture, including the expansion of luminal diameter, epithelial thinning, and reduced spermatozoa density. A depression of global molecular phenotype accompanies these changes. We also report a time-dependent effect as the four weeks of HU induced a more severe testicular disruption than two weeks of HU.

The data about testicular histopathology in HU rodents are scarce. A previous study elaborated on loosening on seminiferous tubules along with presence of necrosis (Ding et al., 2011). Additionally, they reported interstitial edema and the disappearance of germ cells in the testes. However, this study was conducted on rats. Due to limitations in creating transgenic rat models, the relative scarcity of mechanistic data from rats may reduce the translational potential of such findings in humans. Consequently, our data from mice may be more relevant to clinical studies than data from rats. Our findings of epithelial thinning, reduced spermatozoa density, and areas of necrosis are consistent with previous findings. While we did not find relevant data from clinical studies due to constraints of obtaining testes biopsy, several lines of evidence are consistent with our findings. For example, spaceflight and prolonged bed rest in humans result in reduced circulating testosterone, indicating potential damage to testicular tissues (Smith et al., 2012). Similarly, sedentary lifestyles and physical inactivity are associated with infertility in men (Foucaut et al., 2019). This indirect data indicates the potential involvement of testicular disruption in humans during unloading conditions. Thus, the HU mice at least partly mimic the features of reproductive suppression reported in physically inactive humans.

Our findings recapitulate the age-related degeneration of mouse testes. Specifically, the aged mice show a widening of the seminiferous tubular diameter, epithelial thinning, and reduced spermatozoa density (Mehraein and Negahdar, 2011). Thus, the HU may induce an accelerated aging phenotype in the mouse testes. This consequence of physical inactivity is evident in multiple body organs, which mimic age-related degeneration during HU (Globus and Morey-Holton, 2016; Qaisar et al., 2020).

We also observed a time-dependent disruption of mouse testes during HU. This sequential detriment of testicular histology indicates that the suppression of the male reproductive system is a continuous process during inactivity. These findings may help optimize timely interventions of infertility during bed rest in humans.

Raman spectra indicated a robust decline in the concentration of tryptophan and hydroxyproline in a time-dependent manner. Tryptophan is implicated in testosterone production and spermatogenesis in testes (Jimenez-Trejo et al., 2020). Thus, a reduced expression of tryptophan is consistent with histopathological disruption, including the reduced density of spermatozoa in the HU testes. Hydroxyproline is an essential component of collagen proteins in biological tissues. Among its multiple functions, it is involved in stabilizing collagens (Xu et al., 2019). Thus, the reduced hydroxyproline in HU testes may indicate instability of collagens, which may contribute to testicular pathology. The analysis of HU testes also revealed a generalized depression in the spectral peaks of all intensities. This finding indicates a reduced concentration and/or altered orientation of global molecular phenotype, which agrees with the histopathological findings. Additionally, the spectral peaks above 1000 cm^-1, which indicate the C-H vibration, were suppressed in the HU testes, showing the breakdown of several amino acid molecules.

We did not investigate the molecular mechanisms driving testicular pathology in HU conditions. However, our preliminary data indicate a role for elevated necroptosis in the HU testes. Necroptosis has emerged as an underlying mechanism of multiple organs pathology. Additionally, necroptosis appears to promote age-related degeneration of mouse testes (Li et al., 2020). Thus, the degeneration of HU testes may have a potential contribution from elevated necroptosis. However, the preliminary nature of our data prevents us from establishing robust conclusions.

Taken together, our findings indicate that two and four weeks of HU result in the degeneration of mouse testes. Several characteristics alterations were observed in the histological architecture of testicular tissues, involving seminiferous tubules, epithelial thickness, and spermatozoa density. These changes were accompanied by global suppression of Raman spectra, indicating an altered concentration and/or orientation of several molecules. Lastly, our preliminary data indicate a role for necroptosis as a potential contributor to testicular disruption during HU. Further studies are required to investigate the mechanistic link between HU and testicular pathology.

Acknowledgment: This work was supported by a collaborative grant # 1901090169 to Anu Ranade and the target grant # 1901090168 to Rizwan Qaisar by the University of Sharjah.

Conflict of Interest: The authors declare that they have no conflict of interest.

Data Availability: The data is available from the corresponding author upon reasonable request.

Authors’ contribution: Conceptualization; A.R & R.Q, Data curation; A.R, A.K, M.Z, F.A, & W.H, Formal analysis; A.R & A.K, Funding acquisition; A.R & R.Q, Investigation; A.K, M.Z, J.J, G.R, Z.I, A.E, & F.A. Methodology; A.R & A.K, Project administration; A.R & R.Q, Resources; A.R & R.Q, Supervision; A.R, A.K, M.Z, A.E, F.A, & R.Q, Validation; A.R & R.Q, Writing – original draft; A.R & R.Q, Writing – review & editing, A.R, A.K & R.Q.

Aitken RJ (2013) Falling sperm counts twenty years on: where are we now? Asian J Androl 15, 204. doi: 10.1038/aja.2012.167
Azeem M, Qaisar R, Karim, A., Ranade A, and Elmoselhi A (2021) Signature molecular changes in the skeletal muscle of hindlimb unloaded mice. Biochem Biophys Rep 25, 100930. doi: 10.1016/j.bbrep.2021.100930.
Bancroft J D, Layton C (2012). Connective and mesenchymal tissues with their stains. Bancroft’s Theory and Practice of Histological Techniques, 187–214.
Bhaskaran S, Unnikrishnan A, Ranjit R, et al (2017). A fish oil diet induces mitochondrial uncoupling and mitochondrial unfolded protein response in epididymal white adipose tissue of mice. Free Radic Biol Med 108, 704–714. doi: 10.1016/j.freeradbiomed.2017.04.028.
Chen Q, Zhu W, Li J (2006). Effects of aging on spermatogenesis, sperm maturation and fertility in mice. J Reprod Contracept 17, 9–14. doi: 10.1007/s10815-016-0663-y
Deaver D, Amann R, Hammerstedt R, Ball R, Veeramachaneni D, Musacchia X (1992). Effects of Caudal Elevation on Testicular Function in Rats Separation of Effects on Spermatogenesis and Steroidogenesis. Journal of andrology 13, 224–231.
Ding Y, Tang J, Zou J, et al (2011). The effect of microgravity on tissue structure and function of rat testis. Braz J Med Biol Res 44, 1243–1250. doi: 10.1590/s0100-879x2011007500147.
Foucaut AM, Faure C, Julia C et al (2019). Sedentary behavior, physical inactivity and body composition in relation to idiopathic infertility among men and women. PLoS One 14, e0210770. doi: 10.1371/journal.pone.0210770. eCollection 2019
Globus RK, Morey-Holton E (2016). Hindlimb unloading: rodent analog for microgravity. J Appl Physiol (1985) 120, 1196–1206. https://doi.org/10.1152/japplphysiol.00997.2015
Hess RA (1990). Quantitative and qualitative characteristics of the stages and transitions in the cycle of the rat seminiferous epithelium: light microscopic observations of perfusion-fixed and plastic-embedded testes. Biol Reprod 43, 525–542. doi: 10.1095/biolreprod43.3.525.
Jimenez-Trejo F, Coronado-Mares I, Arriaga-Canon C et al (2020). Indolaminergic System in Adult Rat Testes: Evidence for a Local Serotonin System. Front Neuroanat 14, 570058. https://doi.org/10.3389/fnana.2020.570058
Karna KK, Choi BR, Kim MJ et al (2019). The Effect of Schisandra chinensis Baillon on Cross-Talk between Oxidative Stress, Endoplasmic Reticulum Stress, and Mitochondrial Signaling Pathway in Testes of Varicocele-Induced SD Rat. Int J Mol Sci 20, 5785. doi: 10.3390/ijms20225785.
Li D, Ai Y, Guo J, et al (2020). Casein kinase 1G2 suppresses necroptosis-promoted testis aging by inhibiting receptor-interacting kinase 3. Elife 9. doi: 10.7554/eLife.61564.
Liu D, Wan J, Liu Z, et al (2020). Determination of cadmium induced acute and chronic reproductive toxicity with Raman spectroscopy. Lasers Med Sci 35, 1919–1926. doi: 10.1007/s10103-020-02976-6.
Maffei M, Longa E, Qaisar R et al (2014). Actin sliding velocity on pure myosin isoforms from hindlimb unloaded mice. Acta Physiol (Oxf) 212, 316–329. doi: 10.1111/apha.12320.
Mehraein F, Negahdar F (2011). Morphometric evaluation of seminiferous tubules in aged mice testes after melatonin administration. Cell J 13, 1–4.
Moustafa A. (2021). Hindlimb unloading-induced reproductive suppression via Downregulation of hypothalamic Kiss-1 expression in adult male rats. Reprod Biol Endocrinol 19, 37. doi: 10.1186/s12958-021-00694-4.
Nichiporuk IA, Evdokimov VV, Erasova V Eet al (1998). Male reproductive system in conditions of bed-rest in a head-down tilt. J Gravit Physiol 5, 101.
Qaisar R, Karim A, Elmoselhi A B (2020). Muscle unloading: A comparison between spaceflight and ground-based models. Acta Physiol (Oxf) 228, e13431. DOI:10.1111/APHA.13431
Qaisar R, Ustrana S, Muhammad T, Shah I (2021). Sarcopenia in pulmonary diseases is associated with elevated sarcoplasmic reticulum stress and myonuclear disorganization. Histochem Cell Biol. doi: 10.1007/s00418-021-02043-3.
Ranade AV, Tripathi Y, Rajalakshmi R et al (2011). Effect of vitamin E administration on histopathological changes in rat testes following torsion and detorsion. SMJ 52, 742–746.
Sengupta P, Borges Jr E, Dutta S, Krajewska-Kulak E (2018). Decline in sperm count in European men during the past 50 years. Hum Exp Toxicol. 37, 247–255. doi: 10.1177/0960327117703690.
Smith SM, Heer M, Wang Z, Huntoon CL, Zwart SR (2012). Long-duration space flight and bed rest effects on testosterone and other steroids. J Clin Endocrinol Metab 97, 270–278. doi: 10.1210/jc.2011-2233.
Wang C, Wu J, Cui Y, Song S et al (2016). Simulated weightlessness by tail-suspension affects follicle development and reproductive capacity in rats. Int J Clin Exp Pathol 9, 12208–12218.
Xu S, Gu M, Wu K, Li G (2019). Unraveling the Role of Hydroxyproline in Maintaining the Thermal Stability of the Collagen Triple Helix Structure Using Simulation. J Phys Chem B 123, 7754–7763. https://doi.org/10.1021/acs.jpcb.9b05006

No competing interests reported.

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Hindlimb unloading induces time-dependent disruption of testicular histology in mice

Archived Versions:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Animals and HU conditions:

Testicular and Epidydimal Morphometry:

Raman Spectroscopy:

Quantitative real-time PCR validation:

Statistical analysis:

Results

Testicular Morphometry:

Raman Spectroscopy analysis:

Expressions of the markers of necroptosis:

Discussion

Declarations

References

Additional Declarations

Archived Versions:

Version 1