Clinical samples
A total of 282 patients, who were first diagnosed with colorectal adenocarcinoma at Fudan University Shanghai Cancer Center (FUSCC) during 2008–2009, and who did not undergo any preoperative therapy, were enrolled in this study. The median follow-up time was 81 months, and the longest follow-up time was 97 months. 8 paired primary CRC samples, including primary tumor tissues(T), normal adjacent tissues(N) and liver metastatic tissues(M), were also obtained from CRC patients who were first diagnosed with colorectal adenocarcinoma and liver metastasis at the same time and underwent the surgery of colorectal and liver at the same time at FUSCC during 2018. All patient material was obtained with informed consent, and this study was approved by the institutional review board of Shanghai Cancer Center.
RNA-seq of clinical samples
RNA-seq was performed using 8 paired primary CRC samples described above, which including adjacent normal adjacent tissues (N), tumor tissues (T), and liver metastatic tissues(M). Total RNA was extracted using the mirVana miRNA Isolation Kit (Ambion) following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). The samples with RNA Integrity Number (RIN) ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded Total RNA with Ribo-Zero Gold according to the manufacturer’s instructions. Then these libraries were sequenced on the Illumina sequencing platform (HiSeqTM 2500 or other platform) and 150 bp/125bp paired-end reads were generated. The differentially expressed mRNAs were defined as a greater than 1.5-fold change between T and N, M and T, with a p value < 0.05.
Cell lines and culture
The colorectal cancer cell lines used in this study, including RKO, HCT116, SW1116, SW480, SW620, HT29, CACO2, and LOVO, were purchased from the Cell Bank of Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China). The cell lines were cultured in DMEM (HyClone, USA) supplement with 10% FBS (Gibco, USA) and 1 % complex of penicillin and streptomycin in a 5% CO2 incubator at 37 ℃.
Western blot assays
Antibodies against IMP3, MEKK1, MEK1 were from Abcam, Antibodies against E-cadherin, N-cadherin, MMP2, MMP9, p-ERK1/2, p-MAPK, ERK1/2, p-JNK were from Cell Signaling Technology, all the primary antibodies were used at 1:1,000 dilutions. Antibody against GAPDH was from Epitomics, and was used at 1:10000 dilution. All the secondary antibodies were used at 1:5,000 dilutions. Western blot assays were performed as previously described [14].
Quantitative RT-PCR assays
Total RNA from different cells and fresh samples was extracted with Trizol (Invitrogen, USA). cDNA was synthesized using the PrimeScript RT Reagent Kit (Takara, China) following manufacturer’s instructions. Quantitative RT-PCR (qRT-PCR) was performed using SYBR Premix Ex Taq II (Takara, China) according to the manufacturer’s instructions. The relative expression of genes was normalized to GAPDH and calculated by the 2−ΔΔCT method. The specific primers used are listed in supplemental Table 1.
Plasmid construction and transfections
siRNAs of IMP3 and MEKK1 were purchased from GenePharma (China), the target sequence is IMP3-siRNA1: 5’ GCAGGAAUUGACGCUGUAUTT3’; IMP3-siRNA2: 5’ GCUUCUAUGAAUCUUCAAGTT 3’; MEKK1-siRNA: 5’ CCAUAUAGCCCUGAGGAAATT 3’; Scramble forward: 5’ UUCUCCGAACGUGUCACGUTT 3’.
The human full cDNA sequence of IMP3 and MEKK1 was purchased from GenePharma (China). lentiviruses of IMP3-shRNA and non-target control, lentiviruses of IMP3, MEKK1 and empty vector control were also purchased from GenePharma (China). Transfection and virus infection were performed as previously described [14]. The knockdown or overexpression efficiencies of IMP3 and MEKK1 were confirmed by qRT-PCR and western blot.
Cell viability assays and colony formation assays
Cells transfected with vectors or siRNAs were re-suspended and seeded into 96-well plates in a density of 5000 cells/well in triplicate. CCK-8 reagent (10 µl, Dojindo, Japan) was added to each well at 0, 24, 48, 72 and 96 h. The absorbance at 450 nm was measured after 2 h incubation at 37 ℃. For the colony formation assay, 500 to 1000 cells were seeded into a 6-well plate and cultured in a media containing 10% FBS for 14 days. The colonies were then fixed and stained, and the number of colonies counted.
Cell migration and invasion assays
The cell migration ability was accessed by wound-healing assay. Linear wound was generated with a 200 µl pipette tip until cell confluence. Wound closure was examined and photographed at pre-determined time points (0, 24 h) in multiple microscopic regions.
And the cell invasion ability was accessed by the Transwell assay using 24-Well Cell Invasion Assay (Corning, NY, USA) with Matrigel (BD Biosciences, NJ, USA). 24 h after transfection, 3×104 cells with FBS-free medium were seeded into the upper chamber, and medium containing 20% FBS was applied to the lower chamber as chemoattractant. After 48 h incubation, cells attached to the lower surface of the chamber were fixed with ethanol, stained with 0.5% crystal violet, and then photographed.
Animal studies
Animal experiments were approved by the Ethics Committee at FUSCC. Briefly, male BALB/c nude (Shanghai Slac Laboratory Animal Co. Ltd, 4–6 weeks) were subcutaneously injected with IMP3 stable knockdown HCT116 cells (2×106 suspended in 0.1ml PBS for each mouse) and IMP3-overexpressing LOVO cells (2×106 suspended in 0.1ml PBS for each mouse). For the subcutaneous xenograft model, tumor growth with a digital caliper was measured every 3 days. Approximately one month after implantation, the mice were killed and the tumors were removed. Tumor volume was calculated as (width)2 × length/2.Once reaching an average tumor volume of 100 mm3,
They were intraperitoneally treated with u0126 (20 mg/kg). Administration of vehicle or agents and measurement of tumor volume were done every 3 days. Finally, mice were weighed and sacrificed, and tumors were weighed and dissected. IHC of xenograft
tumors were done according to the protocol above. For in vivo metastasis assays, 5×106 cells were injected into the tail vein; 6 weeks later, all mice were killed and the lungs removed for pathological examination and hematoxylin and eosin (H&E) staining.
Luciferase reporter assays
Luciferase reporter assay was performed as previously described[14].The MEKK1-3’-UTR sequence was cloned into a luciferase reporter gene vector pGL3 basic vector as pGL3-MEKK1 3’-UTR. Site-specific mutagenesis of the MEKK1-3’-UTR was carried out using a QuikChange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA, USA), according to the manufacturer’s instructions. The indicated promoters were transfected into HEK-293T and CRC cells. Twenty-four hours after transfection, the cells were harvested and then assayed for luciferase activity with the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA). The promoter activity was normalized by co transfection with Renilla luciferase reporter.
RNA immunoprecipitation (RIP) assays
The Magna RIP Kit (17–701; EMD Millipore, Billerica, MA, USA) was used for the RIP assay in RKO cells with high IMP3 expression, according to the manufacturer’s protocol. Briefly, RKO cells were grown in four 15-cm dishes for three days and then washed three times with ice-cold PBS and centrifugation to collect the cells. The cells were collected and resuspended in 200
µL of RIP buffer and then incubated with magnetic protein A/G beads conjugated with the indicated antibodies at 4°C for 3 h. A 100-µL aliquot of the supernatant was diluted with 900 µL of RIP buffer and then treated with proteinase K solution to isolate IMP3 protein-associated RNA from the eluted immunocomplexes. RNA was then isolated and extracted by using the phenol/chloroform method for RIP-sequencing (RIP-seq), and the level of MEKK1 mRNA in the RIP complex was assayed by using qRT-PCR.
RNA-seq and data analyses
Stable IMP3 knockdown and overexpressed CRC cells were subjected to RNA-seq to detect the differentially expressed mRNAs regulated by IMP3. Briefly, total RNA was isolated from these cells using the phenol/chloroform method and then subjected to RNA-sEq. The sequencing protocol is the same as the clinical samples. The differential genes were selected using a fold change > 1.5, and Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were used for pathway enrichment using DAVID (https://david.ncifcrf.gov/) with a significance threshold of p < 0.01.
Immunohistochemistry (IHC)
The protein expression levels of IMP3, MEKK1, MEK1 and p-ERK were determined by IHC analysis using CRC tissue arrays constructed previously [18]. Briefly, the slides were incubated with primary antibodies: IMP3 (EPR12021, 1:100, Abcam, USA); MEKK1 (2F6, 1:100, Abcam, USA); MEK1 (Y77, 1:100, Abcam, USA); p-ERK (ab79483, 1:100, Cell Signaling Technology, USA), at 4°C overnight. The subsequent steps were performed using the EnVision Detection System (Dako, USA).
Generation of conditional IMP3 knockout C57BL/6 mice
We constructed a double-LoxP IMP3-targeting vector to generate a ‘fl’ mouse IMP3-targeted locus consisting of a LoxP site inserted into the IMP3 exon and the other LoxP site inserted in the 3’-UTR of IMP3. The colon-specific Villin promoter–driven Cre Recombinase (Villin-Cre) TG C57BL/6 mice were purchased from Jackson Laboratories, Bar Harbor, ME. The Villin-Cre TG C57BL/6 mice were bred with IMP3 fl/fl C57BL/6 mice and the offspring were screened by polymerase chain reaction (PCR) for Villin-Cre IMP3 fl/+ mice. These mice then were back-crossed with IMP3 fl/fl C57BL/6(IMP3 fl/fl) mice to generate Villin-Cre IMP3 fl/fl C57BL/6 (IMP3−/−) mice. IMP3−/− mice were bred with IMP3 fl/fl C57BL/6 mice to generate a sufficient number of mice for the colorectal tumor experiments. IMP3 floxed allele or recombined null allele mice were detected by PCR amplification using Primer1(IMP3) forward: 5’ gaccacaacctccacgaact 3’, reverse: 5’ agtccacccaggtgacaaag 3’; Primer2(Cre) forward:5’ gtgtgggacagagaacaaacc3’, reverse:5’ acatcttcaggttctgcggg 3’. These sets of primers amplify a 666–base pair band in the floxed allele and a 415-base pair band in the null allele, and 1100-base pair band in the Villin-cre allele.
AOM/DSS-induced colitis-associated cancer model
IMP3fl/fl and IMP3−/− mice were injected intraperitoneally with azoxymethane (AOM, Sigma-Aldrich, USA) at a dose of 7 mg/kg body weight. After 7 days, mice were given 3 cycles of 3% dextran sodium sulfate (DSS) for 7 days in sterile drinking water, followed by 14 days of regular sterile drinking water. Loss of body weight in these mice was monitored daily, and mice with > 20% body weight loss were considered to have reached a humane end-point and killed. After completion of the entire AOM/DSS regimen, these mice were sacrificed (at day 86), and their colons removed and cut longitudinally. The number and sizes of tumors in the colon of each mouse were analyzed and measured. Then pathological examination and hematoxylin and eosin (H&E) staining was performed on the colons.
Statistical analysis
Experiments were independently repeated at least 3 times, and results are presented as mean ± SD, and for the figures, the representative images were showed. Differences between groups were calculated by the Student’s t test and the χ2 test. Kaplan-Meier analysis and log-rank tests were applied to determine differences in survival. Cox univariate and multivariate proportional hazards regression models were used to determine the independent factors influencing survival. All statistical analyses were carried out using SPSS 20.0 (IBM, New York). pvalues < 0.05 were considered as statistically significant.