Materials
Dulbecco’s Modified Eagle Medium (DMEM), fetal bovine serum (FBS) and 1×Insulin-Transferrin-Selenium (ITS) were obtained from Gibco (Grand Island, NY). LPS (Escherichia coli O55: B5) was purchased from Sigma (St. Louis, USA). Angelica polysaccharide (≥90% purity), cell counting kit-8 (CCK-8), RIPA cell lysis buffer, BCA protein assay kit, and NBT/BCIP chromogen kit were acquired from Solarbio (Beijing, China). ELISA kits of tumor necrosis factor-α (TNF-α), interleukin (IL)-1β and IL-6 for dairy cow were purchased from DG Biotech Co. Ltd. (Beijing, China). Nitric oxide (NO) kit was purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The primary antibodies against phosphor-JNK, phosphor-ERK, phosphor-p38, JNK, ERK, and p38 were obtained from Cell Signaling Technology (Danvers, MA, USA). Antibodies for phosphor-IκBα, phosphor-p65 NF-κB, IκBα, p65 NF-κB and β-actin were obtained from Bioss (Woburn, MA, USA). The HRP-conjugated secondary antibody was purchased from ZSGB-Bio (Beijing, China). Ultrapure RNA extraction kit and HiFiscript cDNA Synthesis Kit were purchased from CWBIO (Beijing, China). 2×Fast Super EvaGreen® qPCR Mastermix was acquired from US Everbright Inc.(CA, USA). All other chemicals were of reagent grade.
Cell culture and treatment
Claw dermal cells of dairy cow were isolated using the tissue adherent culture method as previously described [26]. Claw lamellar tissues were collected at a local abattoir from adult dairy cows without any visual disease. The tissues were aseptically cut off and put into sterile saline solution with antibiotics (200 units/mL of Penicillin, 200 μg/mL of Streptomycin), and then transported on ice to the laboratory within 2 h. The acquired tissues were washed with sterile phosphate buffered saline (PBS) for 3 times, trimmed into small pieces and soaked in 0.25% trypsin solution at 4℃ for 18-24 h. After rinsing with PBS, the epidermis and dermis were separated. The dermis pieces were seeded onto 6-well plates coated with rat tail collagen, cultured in DMEM, supplemented with 15% FBS, 1×ITS, 0.025 M HEPES, 200 units/mL of Penicillin, 200 μg/mL of Streptomycin, and maintained in 5% CO2 incubator at 37℃. Medium was replaced every 2-3 days. Tissue pieces were removed when cells were about 50% confluence. Upon 80-90% confluence, cells were detached with 0.25% trypsin-EDTA solution and seeded into 25 cm2 flasks.
The claw dermal cells were exposed to different concentrations of AP (1-100 µg/mL) with or without the stimulation of 10 µg/mL LPS for different times based on different experimental conditions.
Cell viability assay
Cell viability was measured using the Cell Counting Kit-8 (CCK-8). Claw dermal cells were seeded into 96-well plates at a density of 1×105 cells/ well and cultured until 80-90% confluency. The cells were treated with different concentrations of AP (1-100 µg/mL) for 24 h and 48 h. Then 10 µL CCK-8 was added into each well. The cells were incubated at 37℃ for 1 h. The absorbance at 450 nm was measured by a microplate reader (Bio-Rad, CA, USA).
Cytokine measurement
The levels of TNF-α, IL-1β and IL-6 in supernatants were detected using commercial ELISA kits, according to the manufacturer’s guidelines. The OD value at a wavelength of 450 nm was measured. The NO concentration in cell supernatant was measured using Griess colorimetric method, following the manufacturer’s protocol. Absorbance was measured at 550 nm. Draw a standard curve with the standard solution concentrations as the horizontal axis and the measured OD value as the vertical axis, then calculate the concentrations of cytokines on the basis of standard curve.
Quantitative real-time PCR analysis
Total RNA was extracted from dermal cells using Ultrapure RNA extraction kit following the manufacturer’s protocol. The concentration and purity (OD260/OD280 absorption ratio >1.8) of total RNA were evaluated by a NanoDrop 2000 spectrophotometer (Thermo Scientific, Ottawa, ON, Canada). Subsequently, the total RNA was reverse transcribed into cDNA with the use of HiFiscript cDNA Synthesis Kit according to the manufacturer’s instructions. Quantitative real-time PCR was performed using 2× Fast Super EvaGreen® qPCR Mastermix on a LightCycler96 Real-Time PCR system (Roche, Basel, Switzerland). Primer sequences are listed in Table 1. The following cycling conditions were performed: 95°C for 300 s, 40 cycles of 95°C for 5 s, 56°C for 30 s and 72°C for 15 s. The relative expression of target genes was normalized relative to the level of the control (GAPDH) and calculated using the 2-ΔΔCt method [48].
Table 1. Primer sequences used for amplification of qPCR.
Genes1
|
Sense
|
Antisense
|
TLR4
|
AGCTTCAACCGTATCATGGCCTCT
|
ACTAAGCACTGGCATGTCCTCCAT
|
MyD88
|
AAGTACAAGCCAATGAAGAAAGAG
|
GAGGCGAGTCCAGAACCAG
|
CCL2
|
CGCTCAGCCAGATGCAATTA
|
GACCCATTTCTGCTTGGGGT
|
CCL20
|
TTGATGTCAGTGCTATTGCT
|
ACCCACTTCTTCTTTGGATC
|
CXCL2
|
ACCGAAGTCATAGCCACTCTC
|
TCCAGATGGCCTTAGGAGGT
|
CXCL8
|
AAACACATTCCACACCTTTC
|
TCTTCACAAATACCTGCACA
|
CXCL10
|
CTCGAACACGGAAAGAGGCA
|
TCCACGGACAATTAGGGCTT
|
GAPDH
|
CACCCTCAAGATTGTCAGCA
|
GGTCATAAGTCCCTCCACGA
|
1TLR4, toll-like receptor 4, MyD88, myeloid differentiation factor 88, GAPDH= Glyceraldehyde 3-phosphate dehydrogenase.
Western blot analysis
Total proteins from claw dermal cells were extracted with RIPA cell lysis buffer and quantified by BCA protein assay kit. Total protein (20-50 μg/sample) was separated on 12% SDS-polyacrylamide gel and transferred to nitrocellulose membranes. Nonspecific binding sites of membranes were blocked with 5% non-fat milk for 1 h at room temperature. Membranes were incubated with antibodies specific for JNK, phosphor-JNK, ERK, phosphor-ERK, p38, phosphor-p38, IκBα, phosphor-IκBα, p65 NF-κB phosphor-p65 NF-κB, and β-actin at 4°C overnight, and then incubated with HRP-conjugated secondary antibodies at room temperature for 1 h. Immunoblot signals were visualized with NBT/BCIP chromogen kit. Densitometric values were obtained from 3 separate experiments using ImageJ software (NIH, Bethesda, MD).
Statistical analysis
Data were presented as mean ± standard deviations (SD) of at least three independent experiments. The statistical analyses were performed with GraphPad Prism 5 (GraphPad Software, La Jolla, USA). Significant differences were evaluated by one-way analysis of variance (ANOVA) with Duncan’s post hoc test using SPSS 21.0 software (SPSS Inc., Chicago, IL). P < 0.05 was considered as statistically significant.