Samples resource
The normal flora changes in the birth canal with cow growth. There are relatively few LABs during the juvenile period, but LAB populations significantly increase in adults. The first 10–45 months of dairy cow life are the most fertile period. Therefore, 50 healthy dairy cows aged 10–15 months without any disease were selected as experimental samples from different dairy farms in Hohhot, Inner Mongolia.
Isolation and diversity identification of the LAB strains
Isolation of the LAB strains
The LAB strains were isolated from the experimental treatments. First, mucus of the samples was prepared in PBS (phosphate buffer solution) and plated in LAPTg [10] (containing 0.2% bromocresol purple) agar pH 6.6 medium for 12–24 h at 37°C under anaerobic conditions. Then, isolated strains were picked from each plate and transferred to the same medium. The growth observed in pure cultures was recorded. Strains were freeze-dried and stored in milk yeast extract (10% (w/v) skim milk powder, 0.5% (w/v) yeast extract) at -80°C. (Strain activity degrades 40% after 1 year at room temperature.)
Identification of the LAB strains
The dominant LAB strains in this study were first screened according to Chinese Pharmacopoeia [11]. Strain morphology was selected using Gram staining. Acid-producing properties were measured using acidity testing [12]. The probiotic strains that were previously freeze-dried were tested for stability after passage by subjecting to culture characteristics, bacterial morphology, water activity and purity testing, in accordance with the requirements of the third part of the Chinese Pharmacopoeia (2010) [11].
The dominant LAB was taxonomically identified by phenotype tests. Biochemical and sugar fermentation tests were performed by an API50 CHL test strip (BioMérieux, France) according to the Bergey’s Manual of Determinative Bacteriology.
The dominant LAB strains were transferred into LAPTg agar, and then incubated at 37°C under the anaerobic condition for 24 h before DNA extraction. The DNA extraction of the isolated LAB strains was done using a Bacterial Genomic DNA extraction kit (Sigma, Germany). Amplification of 16S rRNA was carried out using the forward primer 27F (5′AGAGTTTGATCCTGGCTCAG3′) and the reverse primer 1492R (5′GGCTACCTTGTTACGACTT3′). The obtained single positive clones were sequenced, and then identified through the Genbank database using the BLAST algorithm. The phylogenetic status of the isolated LAB strains was established through analysis with software MEGA 5.0 version.
Acid production analysis of candidate strain
Acid production was measured using the acidity method [12]. The dominant strains identified were inoculated from stage 1 to 4 in LAPTg broth medium under anaerobic conditions. The pH of samples was taken at 0, 3, 5, 8, 10, 12, 16, and 18 h at stage 4.
Hydrogen peroxide production analysis of candidate strains
Hydrogen peroxide production was determined using the catalase test [13]. TMB (3,3', 5,5'-Tetramethyl-Benzidine) (Gibco, France) was added to 100% ethanol, heated and dissolved in a water bath, and then added to LAPTg agar medium, sterilized at 121°C for 15 min. Later, when the temperature was ~50°C, peroxidase (Gibco, France) was dissolved and added to the plate by filtering with a bacterial filter. After solidification, the plate was cultured at 37°C for 12 h. Single colonies of the dominant strains were picked to draw a line in the prepared plates and placed at 37°C for 36 h in an anaerobic environment. The plates were then taken out and left for 30 min to observe the color change of the colonies under aerobic conditions. Based on the color intensity, the strains were classified as strong (blue), medium (brown), weak (light brown) or negative (white colonies) producers of hydrogen peroxide [13].
Bacteriocins detection in candidate strains
The DNA of the strain was extracted (Sigma Bacterial Genomic DNA extraction kit (Sigma, Germany)). The primers were designed on the basis of the Lactobacillus johnsonii NCC 533 (NC_005362.1) sequence published on GenBank with 99% similarity to the strain. Forward Primer: 5′-GGGAATGTGACGATAATGAC-3′; Reverse Primer: 5′-AAATCCTACTTTCTTATCTTGC-3′. The DNA was amplified and transformed. The positive clones were sequenced and ligated with the pMD19-T vector (Takara, Japan) to form a recombinant plasmid. The primers were designed again according to the BamHI and XhoI (ThermoFisher, USA) restriction sites. Forward Primer: 5′-CGCGGATCCATGAAACAATTTAATTATTTATCACA-3′, Reverse Primer: 5′-CCGCTCGAGCTACTTTCTTATCTTGCCAAAA-3′. The recombinant plasmid and pET-28a (ThermoFisher, USA) were PCR amplified with primers to splice and transform. The constructed expression product was cultured in LB medium containing kanamycin at 37°C for 12 h, and the growth curve was monitored. At the pre-middle stage, the logarithmic growth of the bacterial solution was induced and cultured at 37°C for 3 h at 1 mM IPTG (Isopropyl β-D-Thiogalactoside) (Thermo, USA) [14]. Then, they were centrifuged at 6000 r/min for 10 min at 4°C. The bacteria were collected and added to a lysis buffer equivalent to 1/10 volume of the bacterial solution to resuspend. Cells of the re-suspended bacteria in the solution were broken by ultrasound. At this time, the strain of the bacterial solution was clarified. Bacteriocins gene expression was detected using SDS-PAGE. The SDS-PAGE experiment was performed in accordance with Genetic Engineering Pharmaceuticals [15]. The main reagent manufacturer: SDS-PAGE Gel Preparation Kit (Thermo, USA).
Cell adhesion testing of the candidate strain
BVECs (Primary bovine vagina epithelial cells) were cultured up to 3 passages and washed twice with DPBS before use. The LAB cultures were centrifuged at 5000 r/min for 5 mins and washed with DMEM/F12 (Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (Gibco, France)) without any additions. Cell concentration was adjusted to n × 108 CFU / mL, and then we added bovine vaginal epithelial cells. They were cultivated together at 37°C for 4 h in a CO2 incubator [16]. The cell culture solution was then discarded, and Wright-Giemsa staining was performed. The cells were observed under a microscope.
The cells with the bacteria were stained with Swiss-Giemsa. Twenty fields of view were randomly selected under the microscope. The number of bacteria on 50 cells was counted, and the average number of bacteria adhering to each cell was calculated. Lactobacillus delbrueckii (ATCC 11842) was used as a positive control. This experiment was repeated three times.
Antibacterial susceptibility and bacteriocins detected in the candidate strain
This experiment was performed using the Oxford Cup method [17]. The methods used for evaluating the antibacterial activity of LAB against pathogenic microbial strains were described by Shokryazdan et al. [18, 19]. The bacterial liquids of LAB, E. coli and S. aureus were centrifuged, washed and adjusted to a concentration to n × 108 CFU/mL with PBS. One milliliter of E. coli or S. aureus was, respectively, added onto sterile plates. Then Mueller-Hinton Agar (containing 1% glucose) was poured and shaken well in sterile plates. After solidifying and drying, sterile Oxford cups were placed evenly at equal distances. A 0.2 mL amount of the LAB suspension was added into the cup and allowed to stand for 2 h, then incubated at 37°C for 36 h. The PBS phosphate buffer was used as a negative control, and streptomycin (10 µg/mL) (Batch number: 130307-201009) (Biological Product Testing Institute, China) or Penicillin G (0.12 μg/mL) (Batch number: 130437-201005) (Biological Product Testing Institute, China) [20] was used as a positive control. Vernier calipers were used to measure the diameter of the bacteriostatic zone. The judgment criteria were inhibition range <6 mm negative (-), 6–10 mm mild inhibition (+), 10–14 mm strong inhibition (++) and >14 mm very strong inhibition (+++) [18]. This experiment was repeated three times. The bacteriostatic performance of bacteriocins gene expression was tested. The LAB suspension was used ss a proxy for bacteriocin expression. Other experimental steps were the same as above. All experiments were repeated three times.