Animals
A total of 313 Sprague-Dawley (SD) rats (250-300 g) were purchased from the Experimental Animal Center of Chongqing Medical University. All rats were housed under a 12/12 h light and dark cycle condition and allowed free access to food and water.
Establishment of the transient middle cerebral artery occlusion (tMCAO) model
The model was performed according to a method described previously(Longa, Weinstein et al., 1989; Qin, Luo et al., 2013). Briefly, rats were initially anaesthetized with 3.5% chloral hydrate (1 ml/100 g) intraperitoneally. After a midline neck incision, the bifurcation of the right common carotid artery (CCA) was exposed, and a heparin-dampened nylon monofilament with a rounded tip was advanced to block the origin of the right middle cerebral artery (MCA). Two hours after MCA occlusion, rats were re-anaesthetized, and the monofilament was gently withdrawn to restore blood flow. All the same surgical procedures except the insertion of a monofilament to the origin of the MCA were performed in the Sham group. Successful tMCAO and reperfusion was determined by a decrease in the regional cerebral blood flow to 20% and recovery to > 80% of the baseline monitored by a laser-Doppler flowmeter (PeriFlux 5000, Perimed AB, Sweden). Throughout the operation, the body temperature was continuously maintained at 38±0.5°C by a thermostatically controlled infrared lamp (FHC, Bowdoinham, ME, USA). After rats recovered from anaesthesia, the Longa score(Longa, Weinstein et al., 1989) was used to assess neurological deficits. Rats scoring 2 and 3 were included as previously described(Xu, Mu et al., 2018).
Electroacupuncture (EA) treatment
EA treatment was performed as before(Qin, Luo et al., 2013; Xie, Gao et al., 2016). The acupoints “Baihui (GV 20)”, “Hegu (LI 4)”, and “Taichong (LR 3)” on the left side of the rats were chosen (as shown in Fig. 1A). “Baihui (GV 20)” is located at the intersection of the sagittal midline and the line connecting the two ears, “Hegu (LI 4)” is at the second metacarpal midpoint of the radial side, and “Taichong (LR 3)” is at the second toe tibial collateral at the rear of the phalanx. The needle was inserted into each acupoint at an angle of 15°-45° with a 0.5 inch depth and then connected with the EA instrument (Model no. 227033; Beijing Jinggong Ltd., China). The acupoints were stimulated with an intensity of 1 mA and a frequency of 2/20 Hz for 30 min as the stimulation parameters can induce visible muscle contraction. The initial EA treatment was conducted once the reperfusion was completed and performed once daily thereafter.
Lentivirus construction and intracerebroventricular administration
The lentivirus for silencing OTULIN (LV-shOTULIN, 1×109 transduction units [TU]/ml) and control lentivirus (LV-Scramble, 1×109 transduction units [TU]/ml) were constructed by GenePharma Corporation (Shanghai, China).
Seven days before tMCAO, SD rats received intracerebroventricular (i.c.v) injection of LV-shOTULIN or LV-Scramble as before (Xu, Qin et al., 2018). Briefly, rats were anaesthetized and fixed in a stereotaxic apparatus (Stoelting, USA). LV-shOTULIN or LV-Scramble was injected into the right i.c.v. (bregma coordinates: 1.3 mm lateral, 1.5 mm posterior, and 3.8 mm under the dural surface) by a 10-µl Hamilton syringe (Hamilton Co., Reno, NV, USA) at a rate of 0.5 µl/min, and the needle was left in place for 5 min to prevent backflow. The animals were carefully monitored until recovery from anaesthesia. To verify the effect of gene silencing on OTULIN expression, OTULIN mRNA and protein were detected by RT-qPCR and Western blotting.
Neurobehavioural assessment
Assessments of neurobehavioural deficits were performed at 72 h with the modified Neurological Severity Score (mNSS)(Chen, Li et al., 2001), rotarod test(Linden, Fassotte et al., 2014) and inclined board test(Zhang, Wei et al., 2006) with some modifications by an independent investigator blinded to the experiment.
mNSS is a composite test including motor (muscle status and abnormal movement), sensory (visual, tactile and proprioceptive), reflex (pinna, corneal and startle), and balance assessments. It is graded on a scale of 0-18, and the higher the score is, the more severe the injury.
The rotarod test was used to evaluate motor coordination by an accelerating rotarod apparatus (YLS-4C, Shanghai Jinggong Industry Co., Ltd, China). Briefly, each rat was placed on the rotating rod, which accelerates from 4 to 40 rpm per min and went through three trials with 10 min breaks. A trial ended if the rat fell from the rotating rod or clung to the rod without walking for two consecutive rotations, and the latency to end was recorded. Before tMCAO, all rats were trained to stay on the rotating rod at a speed of 4 rpm three times per day for three days. The pre-tMCAO data were recorded as the internal control. The rotarod test results are presented as the percentage of the mean latency time post-tMCAO compared with that pre-tMCAO. The lower the score was, the more severe the injury.
An inclined board test was used to assess balance and coordination. Animals were placed on a board (50 ×30 cm) covered by copper wire mesh (0.2 mm) and stabilized. The board was gradually inclined from the horizontal to the vertical plane. The holding angle at which the animal fell from the board was recorded. The test was repeated and measured three times with two min intervals. The scores were recorded according to the holding angle as follows: 0, >70°; 1, 65–69°; 2, 60–64.9°; 3, 55–59.9°; 4, <55°. The higher the score was, the more severe the injury.
TTC staining
The cerebral infarct volume was detected by 2,3,5-triphenyltetrazolium chloride (TTC, Sigma-Aldrich, USA) staining as described previously(Xu, Mu et al., 2018). Rats were euthanized, and brains were quickly removed and frozen for 20 min at -20°C. Then, the brains were coronally sliced into five 2-mm thick sections, stained with 2% TTC at 37°C for 10 min, and then fixed with 10% formaldehyde. The stained sections were photographed by camera (Canon IXUS, Canon Co., Japan) and analysed by Image-Pro Plus (version 6.0, Media Cybernetics Co., USA). The infarct volume was calculated using the following formula: percentage hemisphere lesion volume=[total infarct volume-(right hemisphere volume-left hemisphere volume)]/left hemisphere volume×100%.
Cresyl violet staining
Frozen coronal brain sections were used for cresyl violet staining to label the ischaemic penumbra of the cerebral cortex in rats as previously described(Marchese, Occhieppo et al., 2020). The brain sections were dehydrated through descending grades of ethanol (95%, 90%, 80%, 70%, and 50% for 5 min) and rinsed with water. The sections were then immersed in 0.1% cresyl violet solution for 10 min, rinsed quickly in water, dehydrated though ascending grades of ethanol, immersed 3 times for 2 min each in xylene, and then cover-slipped.
Nissl staining
The frozen coronal brain sections were dehydrated through descending grades of ethanol (95%, 90%, 80%, 70%, and 50% for 5 min), immersed in 0.1% cresyl violet solution for 10 min, rinsed quickly in water, rehydrated though ascending grades of ethanol, immersed 3 times for 2 min each in xylene, and then cover-slipped. The sections were photographed by a digital camera.
Western blot
Rats were sacrificed, and the brain tissues in the ischaemic penumbra were rapidly dissected. The tissues were homogenized in RIPA lysis buffer (no. P0013B, Beyotime, Shanghai, China) supplemented with PMSF (Beyotime, Shanghai, China) and phosphatase inhibitors for the detection of phosphorylated proteins. After centrifugation, total protein was extracted from the supernatant. The nuclear and cytoplasmic proteins were extracted by a Nuclear and Cytoplasmic Protein Extraction Kit (no. AR0106, Boster, Beijing, China), and the protein concentrations were detected by a BAC kit (Beyotime, Shanghai, China). SDS-PAGE was used to separate proteins, and PVDF membranes (Millipore Co., USA) were used to transfer proteins. After blocking in 5% non-fat milk for 2 h, the PVDF membranes were incubated with the following primary antibodies at 4°C: anti-OTULIN polyclonal rabbit antibody (no. 14127, Cell Signaling Technology, USA, 1:1000), anti-NF-κB p65 rabbit antibody (no. 8242, Cell Signaling Technology, USA, 1:1000), anti-IκBα rabbit antibody (no. 4812, Cell Signaling Technology, USA, 1:1000), anti-phospho-IκBα (Ser32) rabbit antibody (no. 2859, Cell Signaling Technology, USA, 1:500), and anti-β-actin rabbit antibody (no. 4970, Cell Signaling Technology, USA, 1:1000). The next day, the membranes were incubated with a specific horseradish peroxidase-conjugated secondary antibody for 1 h at 37°C. A gel imaging instrument (Vilber Lourmat fusion FX 7 Spectra, France) and analysis software (FUSION-CAPT, France) were applied to scan and analyse the immunoblots.
Real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) analysis
Total tissue RNA in the ischaemic penumbra of the cerebral cortex was isolated by TRIzol (Takara Biotechnology, Japan). The mRNA was used as a template to synthesize cDNA by using the PrimeScript™ RT reagent kit with gDNA Eraser (TaKaRa) at 42°C for 2 min. The synthesized cDNA was used for RT-qPCR on an iQ5 Gradient Real-Time PCR detection system (Bio-Rad Co., USA) with SYBR Green (SYBR Premix Ex Taq™ II, TaKaRa). The cycling conditions were as follows: 10 min at 95°C followed by 40 cycles of 5 s at 95°C and 30 s at 60°C. The melting curve was used to analyse the gene specificity of OTULIN and housekeeping gene β-Actin. Relative quantification was carried out with the 2−∆∆Ct method. The expression of each targeted gene was normalized to the expression of β-actin in the same sample. All primer sequences used in the study were as follows: for OTULIN, forward primer: TGTGGCTCCTGAAATGGATATTATG, reverse primer: CTCTGACAGGGATGTTATAGTGCCG; for β-Actin, forward primer: TGTCACCAACTGGGACGATA, reverse primer: GGGGTGTTGAAGGTCTCAAA.
Immunofluorescence and TUNEL staining
Anaesthetized rats were perfused transcardially with 0.9% saline and 4% formaldehyde, and the brains were removed, fixed in 4% paraformaldehyde for 24 h, and dehydrated with 30% sucrose, 20% sucrose and 15% sucrose. The brains were cut into 10 μm thick coronal sections, incubated with 1% Triton X-100 for 30 min, and blocked with 5% bovine serum albumin (BOSTER Co., USA) for 1 h at 37°C. Then, the sections were incubated overnight at 4°C with the following primary antibodies: anti-OTULIN rabbit antibody (bs-14689R, Bioss Co., Beijing, China, 1:50), anti-NeuN mouse antibody (MAB377, Millipore Co., Germany, 1:200), anti-Iba-1 goat antibody (NB100-1028, Novus Co., USA, 1:200), anti-GFAP mouse antibody (A00213, BOSTER Co.), and anti-NF-κB p65 rabbit antibody p65 (#8242, Cell Signaling Technology, USA). The next day, the slices were incubated with the following secondary antibodies at 37°C for 1 h: Alexa Fluor 594-conjugated goat anti-rabbit IgG (H+L; SA00006-4, Proteintech, 1:200), Alexa Fluor 594-conjugated goat anti-mouse IgG (H+L) (SA00006-3, Proteintech, 1:100), Alexa Fluor 488-conjugated goat anti-mouse IgG (H+L; SA00006-1, Proteintech, 1:200), FITC-conjugated AffiniPure donkey anti-goat IgG (H+L; SA00003-3, Proteintech, 1:200), or 594-conjugated AffiniPure donkey anti-rabbit IgG (H+L; SA00006-8, Proteintech, 1:200). The nuclei were stained with Dapi (Sigma, USA, 1:200). All images were captured using an A1+R laser confocal microscope (Nikon, Tokyo, Japan). Apoptotic cells were detected by TUNEL assay according to the manufacturer’s instructions (Roche, Basel, Switzerland). The sections were photographed using an A1+R laser confocal microscope (Nikon, Tokyo, Japan).
Iba-1 is a commonly used microglial marker. In this study, the morphology of reactive microglia in the ischaemic penumbra of the cerebral cortex was determined by a classic method(Ito, Tanaka et al., 2001; Sawano, Watanabe et al., 2015). Briefly, according to the length of branches, thickness of branches and cell body size, Iba-1+ cells were categorized into the following three forms: 1) ramified microglia, with a small soma, and very fine, long processes; 2) internal microglia, with a larger cell body and thicker processes than ramified microglia; and 3) ameboid microglia, characterized by a large cell body without processes.
The morphological analysis of GFAP+ astrocytes was mainly completed through a method described previously (Ramirez-Sanchez, Pires et al., 2018). Briefly, GFAP+ cells with clearly visible nuclei and soma were selected, and the length of the longest cellular processes (the distance of the nucleus to the tip of the extension process) was measured as an indicator to assess the degree of hypertrophy of astrocytes according to a method described previously.
Immunohistochemistry
Paraffin-embedded brain sections were deparaffinized in xylene and immersed in citrate buffer for antigen retrieval by microwave for 20 min. Then, the endogenous peroxides were blocked by 3% H2O2 for 30 min, and nonspecific antigens were blocked by 5% goat serum for 30 min at 37°C. The sections were incubated at 4°C overnight with primary antibodies IκBα rabbit monoclonal antibody (ab32518, Abcam, USA, 1:100) and anti-NF-κB p65 rabbit monoclonal antibody (#8242, CST, USA, 1:400). The next day, the sections were incubated with secondary horseradish peroxidase-conjugated goat anti-rabbit (Proteintech™, 1:2000) and stained with 3,3ʹ-diaminobenzidine (DAB) substrate. Images were acquired using an automatic microscope (Olympus, Tokyo, Japan)(Qin, Luo et al., 2013).
Enzyme-linked immunosorbent assay (ELISA)
The levels of tumor necrosis factor alpha (TNF-α), interleukin-1 beta (IL-1β) and interleukin-6 (IL-6) in brain tissues from the ischaemic penumbra of the cerebral cortex were detected using ELISA kits (no. EK0526 96T, EK0393 and EK0412 96T, BOSTER Co.) according to the manufacturer’s instructions. The whole experimental flowchart is shown in
Statistical analysis
The neurological scores were analysed using Kruskal-Wallis tests followed by post hoc Dunn’s multiple comparison tests, and all other data were expressed as the mean±SEM. The expression of OTULIN mRNA and protein among the Sham, tMCAO and EA groups was compared using two-way ANOVA with Bonferroni post hoc tests. All other quantitative data were analysed using one-way ANOVA followed by Tukey’s post hoc test for multiple comparisons. Statistical analysis was performed using SPSS 19.0. P<0.05 was considered statistically significant.