DNA Hypermethylation of a panel of genes as an urinary biomarker for bladder cancer diagnosis

doi:10.21203/rs.3.rs-153535/v1

Download PDF

Research Article

DNA Hypermethylation of a panel of genes as an urinary biomarker for bladder cancer diagnosis

https://doi.org/10.21203/rs.3.rs-153535/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Purpose

The aim of this study was to explore the diagnostic potential of a panel of five hypermethylated gene promoters in bladder cancer. Individuals with primary BCa and control individuals matching the gender, age and smoking status of the cancer patients were recruited. DNA methylation was assessed for the gene promoters of RASSF1, RARβ, DAPK, hTERT and APC in urine samples collected by spontaneous urination. Fifty patients and 35 healthy controls were recruited, with average age of 70.26 years and average smoking status of 44.78 pack-years. In the BCa group, DNA methylation was detected in 27(61.4%) samples. RASSF1 was methylated in 52.2% of samples. Only 3(13.6%) samples from the control group were methylated, all in the RASSF1 gene promoter. The specificity and sensitivity of this panel of genes to diagnose BCa was 86% and 61% respectively. The RASSF1 gene could diagnose BCa with specificity 86.4% and sensitivity 52.3%. Promoter DNA methylation of this panel of five genes could be further investigated as urine biomarker for the diagnosis of BCa. The RASSF1 could be a single candidate biomarker for predicting BCa patients versus controls. Studies are required in order to develop a geographically adjusted diagnostic biomarker for BCa.

Trial registration: ACTRN12620000258954

Cancer Biology

hypermethylated gene promoters

DNA methylation

APC in urine samples

At present, the gold standard for bladder cancer (BCa) diagnosis is cystoscopy and urine cytology. Cystoscopy is invasive, cost-intensive, has an 85–90% sensitivity and involves a low risk of urine tract infection, hematuria and suboptimal compliance with management recommendations [1]. Urine cytology is non-invasive, has low sensitivity in low-grade tumors (16%) and a variable interpretation among pathologists [2, 3]. Several urinary-based BCa biomarker tests have been developed to improve the detection of BCa including the UroVysion (sensitivity 72%, specificity 72%), ImmonoCyt (sensitivity 67–86%, specificity 75–79%), BTAstat (sensitivity 58–71%, specificity 73%), BTAtrack (sensitivity 69–71%, specificity 66–90%), NMP22 (sensitivity 71–73%, specificity 73–78%), but are mostly lacking randomized controlled trials to establish their efficacy [4].

The application of epigenetics may allow for a risk-adapted approach and more cost-effective method of diagnosis of BCa. Numerous epigenetic changes such as DNA methylation, histone modifications, microRNA expression and nucleosome positioning are characteristic of the epigenome of BCa cells [5, 6]. In urine samples, DNA methylation in RAS-association domain family 1 (RASSF1), Dystrophin-Associated Protein Complex (DAPC), retinoid acid receptor-p (RARβ), telomerase reverse transcriptase (TERT) and adenomatous polyposis coli (APC) gene promoters has been strongly associated with BCa [7–9]. RASSF1 promoter methylation is significantly higher in both BCa tissue, compared to adjacent macroscopically non-cancerous bladder tissue, and in urine samples of BCa patients compared to healthy controls [10]. Similarly, hypermethylation of DAPC promoter is almost six times more frequent in BCa patients than in healthy individuals (OR:5.81; 95%CI: 3.83–8.82, P < 0.00001) [11]. Finally, the TERT leads to upregulated activity of the enzyme resulting in cancer cells’ immortalization [9]. To date, no single diagnostic biomarker could replace cystoscopy as the primary diagnostic tool for BCa [12]. As, additionally, geographical and ethnic differences in methylation patterns exist [13] a more potent panel of diagnostic biomarkers may be in demand.

The aim of this study was to explore the diagnostic potential of a panel of five hypermethylated gene promoters, whose sensitivity and specificity has been proven when studied in a separate fashion. Ideally, this would lead to the development of a DNA methylation-based diagnostic protocol in urine samples and optimization of its sensitivity and specificity.

Study design – participants

This was a prospective, case-control study conducted in the Urology Department of a public teaching Hospital. The Hospital’s Review Board and the Bioethics Committee of the School of Medicine of the Aristotle University of Thessaloniki approved the study protocol (decision No. 3/4.6.2014). The study is registered in the Australian New Zealand Clinical Trial registry (Registration number ACTRN12620000258954). All methods adhered to the tenets of the declaration of Helsinki as revised in 1989. All study participants were recruited following written informed consent.

Urine samples were collected from patients who were attending the cystoscopy clinics. Recruits were subjects with non-muscle invasive or muscle invasive BCa who were able to provide a urine sample and undergo a cystoscopy before any treatment for BCa. Control subjects matching the gender, age and smoking status of the BCa patients were recruited among healthy volunteers with no known urological disease or malignancy (Table 1). Individuals with metastasis in urinary bladder or other malignancies were excluded.

Table 1.

Table 1
Demographic characteristics of patients and controls.
Gender	Age (years old)	Smoking status (pack-years)	Percent	Number of patients	Number of controls
Male	< 71	< 45	18%	9	6
Male	< 71	>=45	26%	13	10
Male	>=71	< 45	24%	12	8
Male	>=71	>=45	24%	12	8
Female	< 71	< 45	6%	3	2
Female	>=71	< 45	2%	1	1
Total				50	35

Eighty-five subjects were recruited, 50 patients and 35 healthy controls, with an average age of 70.26 years and average smoking status 44.78 pack-years. All individuals were Caucasian. Eighty-four percent of patients were diagnosed with non-muscle invasive BCa (57% Ta and 27% T1 grade), 11% with muscle invasive cancer and 5% with carcinoma in situ (Table 2).

Table 2.

Table 2
Demographic characteristics of the patient where DNA was detected.
Patients where DNA was detected
N	44
Mean age (years) Range (years)	70.78 (SD ± 9.6) 46–88
Median smoking status (pack years) Range (pack years)	45 (IQR 64) 0–168
pTaLg	22 (50%)
pTaHg	3 (7%)
pT1Lg	2 (4%)
pT1Hg	10 (23%)
CIS	2 (5%)
pT2	5 (11%)

Sample collection

Urine samples (approximately 50 ml) were prospectively collected before scheduled cystoscopy in sterile container with urine preservative (NORGEN BIOTEK CORP., Thorold, Canada), in a blinded fashion and were stored according to manufactures’ instructions for maximum two years at room temperature until DNA extraction.

DNA extraction and treatment

DNA was extracted from urine sediments using the Cells and Tissue DNA Isolation Kit (NORGEN BIOTEK CORP., Thorold, Canada). Both integrity and purity were confirmed via spectrophotometry and agarose gel electrophoresis. Extracted DNA was stored at -40°C until the modification with sodium bisulfite using the EZ DNA Methylation-GoldKit (Zymo Research, Orange, CA). Modified DNA was then stored at -20°C until further analysis.

Gene promoter methylation assay

Quantification of the percentage of methylation of DNA in the gene promoter of DAPK [14], APC [15], RAR-β2 [15], RASSF1 [14] and TERT [14] was performed with Luna Universal Probe qPCR Master Mix (New England Biolabs, Massachusetts, USA), according to the manufacturer's instructions and performed on Applied Biosystems StepOnePlus Real Time PCR System (Thermo Fisher Scientific, Inc.). 30 ng of modified DNA were used in each reaction. The cycling conditions were as follows: 95˚C for 1 min, then 40 cycles of 95˚C for 30 sec, 60˚C for 30 sec. The primers and probe were designed to specifically amplify the bisulphite-converted promoter of the gene of interest and their sequences are listed in Table 3. All primers were synthesized by IDT (Integrated DNA Technologies, Iowa, United States). In order to quantify and compare the amplification products, Cq data corresponding to the target genes were normalized relative to those of the internal housekeeping gene, B-ACTIN (14). Furthermore, a standard 100% methylated control human DNA and a 100% non-methylated control human DNA were used (EpiTect PCR Control DNA set, Qiagen, Germany. Methylation specific quantitative PCR (MSP-qPCR) was run in duplicate.

Table 3.

Table 3
The sequences of primers and probes for the quantitative methylation specific real-time PCR.
Gene	Primer/ Probe	Sequence
APC[13]	Forward	5’-GAACCAAAACGCTCCCCAT-3’
	Reverse	5’-TTATATGTCGGTTACGTGCGTTTATAT-3’
	Probe	5’-/56-FAM/CCCGTCGAA/ZEN/AACCCGCCGATTA/31ABkFQ/3’
DAPK[12]	Forward	5’-TCGTCGTCGTTTCGGTTAGTT-3’
	Reverse	5’-TCCCTCCGAAACGCTATCG-3’
	Probe	5’-/56-FAM/CGACCATAA/ZEN/ACGCCAACGCCG/31ABkFQ/3’
RAR-β2[13]	Forward	5’-GGGATTAGAATTTTTTATGCGAGTTGT-3’
	Reverse	5’-TACCCCGACGATACCCAAAC-3’
	Probe	5’-/56-FAM/TGTCGAGAA/ZEN/CGCGAGCGATTCG/31ABkFQ/3’
RASSF1[12]	Forward	5’-ATTGAGTTGCGGGAGTTGGT-3’
	Reverse	5’-ACACGCTCCAACCGAATACG-3’
	Probe	5’-/56-FAM/CCCTTCCA/ZEN/ACGCGCCA/31ABkFQ/3’
TERT[12]	Forward	5’-GGATTCGCGGGTATAGACGTT-3’
	Reverse	5’-CGAAATCCGCGCGAAA-3’
	Probe	5’-/56-FAM/CCCAATCCC/ZEN/TCCGCCACGTAAAA/31ABkFQ/3’
Β-ACTIN [12]	Forward	5’-TGGTGATGGAGGAGGTTTAGTAAGT-3’
	Reverse	5’-AACCAATAAAACCTACTCCTCCCTTAA-3’
	Probe	5’-/56-FAM/ACCACCACC/ZEN/CAACACACAATAACAAACACA/31ABkFQ/3’

Statistical Analysis

Sample size calculation. Assuming that the percentage of DNA methylation among controls is 20% [10], and the desired OR will be 4, then the total sample size needed would be 78 subjects (39 patients and 39 controls) in order to achieve 80% power with alpha set at 5% (for each of the 5 biomarkers). Since this was a pilot study, no correction for multiple testing was made.

Statistical tests. Descriptive statistics, univariate analysis, Shapiro Wilk normality test, Mann-Whitney for comparison of two independent non-parametric samples as well as multivariate and exact logistic regression were used for all variables with meaningful number of data points between patients and controls. ROC analysis was performed.

DNA was successfully extracted from 66 urine samples; 44 patients and 22 healthy controls. DNA was found to be methylated in 27 (61.4%) patient samples as opposed to only 3 of 22 (13.6%) control-samples (p < 0.001). RASSF1 was hypermethylated in 52.2% of patients followed by APC (34%), RARβ (22.7%), DAPK (2.2%) and hTERT (2.2%). The only gene promoter that was methylated in controls was RASSF1.

The gene promoters were hypermethylated in 57% of individuals with non-muscle invasive BCa; in particular, 24% of them had one, 16% two, 14% three, 3% four and none five hypermethylated gene promoters. By comparison, 80% of subjects with muscle invasive tumor had hypermethylated gene promoters: 20% one, 40% two and 20% three genes respectively (Fig. 1). According to the grade classification of tumors, the gene promoters were hypermethylated only in 50% of the patients with low-grade urothelial cancer (one in 29%, two in 17% and three in 4%) while up to 72% of patients with high grade or CIS had hypermethylated gene promoters (one in 17%, two in 22%, three in 28% and four in 5%) (Fig. 2). The hypermethylation was not significantly different between patients with muscle and non-muscle invasive BCa as well as between patients with high-grade and low-grade (p = 0.369 and p = 0.148, respectively). The gene promoters of DAPK and TERT were hypermethylated in one patient each.

According to our statistical analysis the specificity and sensitivity of this diagnostic panel of biomarkers were 86.4% and 61.4%, respectively, while the positive and negative predictive values were estimated at 90% and 53%, respectively. The area under the curve (AUC = 0.7634) derived from a multivariate logistic regression model (Fig. 3). The diagnostic panel was considered positive when it had at least one methylated promoter.

Due to the high correlation observed, only RASSF1, APC and RAR-β2 promoters remained in the model; however, APC and RAR-β2 had very unstable estimates (Quasi-complete separation of data points was detected). Thus, further analysis using exact logistic regression was performed in order to explore the multicollinearity effects. As a result, RASSF1 gene promoter could be a single candidate for predicting patients versus controls with specificity 86.4% and sensitivity 52.3%. The odds ratio (OR) estimate for the diagnostic biomarker RASSF1 only is 6.9 (95%CI: 1.792–26.857) (P = 0.005) and the AUC was 0.6932.

Further analysis was performed for the diagnostic accuracy of the current panel for MIBC or high-grade tumors. Based on the 5-year recorded prevalence of BCa in the Greek population [16] and the known prevalence of 20–30% for MIBC or high-grade tumors among firstly diagnosed BCa patients, we calculated that the current panel had a positive predictive value of 0.21 and a negative predictive value of 0.86, with 0.86 specificity and 0.72 sensitivity.

In this pilot, controlled study the gene promoters of individuals with BCa were more commonly hypermethylated compared to healthy controls. The panel of genes tested was found to have 86.4% specificity and 61.4% sensitivity in the diagnosis of BCa, quite similar to the specificity and sensitivity of the RASSF1 promoter gene alone (86.4% and 52.3% respectively with OR 6.9).

Despite the relatively small sample size, the study sample reflects the disease’s demographics. In general, non-muscle invasive cancer (NMIBC) can be found in 70–80% of all BCa and only 10–30% constitute muscle invasive BCa (MIBC) [17]. In our sample 84% of the patients had NMIBC and 11% MIBC.

Regarding the diagnostic potential of the hypermethylated gene promoters’ panel of our study, the sensitivity (61%) is lower compared to the cystoscopy’s sensitivity for all kinds of BCa (68–83%) but higher compared to cytology, particularly for low-grade tumors (50%) [18]. Furthermore, the specificity is considerably higher than the cytology’s specificity for patients with low-grade cancer and comparable to the specificity of the invasive cystoscopy [4]. However, the diagnostic accuracy of the methylation of the panel of Twist Family BHLH Transcription Factor 1 (TWIST1) and NID2 genes as urine biomarker was higher than the diagnostic accuracy of our panel of genes, with 90% sensitivity and 93% specificity [19]. Similarly, a meta-analysis and systematic review of 24 articles revealed that the overall sensitivity and specificity of DNA methylation urine biomarkers was 84% and 92% respectively, higher than our results [20]. Studies by Zhang et al. and van der Heijden et al. achieved higher AUC (0.894 and 0.874 respectively) compared to our study’s AUC (0.7634) [21, 22]. However, Zhang et al. investigated the diagnostic potential of a panel of seven gene promoters in a non-Caucasian (Chinese) population, while van der Heijden et al. were focused on monitoring BCa and not on diagnosis.

But since DNA methylation varies among different human groups regarding macro- and micro-geographical scales, numerous studies from different areas are required in order to investigate the methylation profile of the patients with BCa across human populations [13, 23]. This may lead to a common panel of gene promoters that could be used worldwide to differentiate the BCa from healthy subjects but, in addition, a more individual approach may be necessary depending on subjects’ residency.

Our results also indicate that the hypermethylation of suppressor gene promoter of RASSF1 might be a potential single urine biomarker in BCa with specificity 86.4%, sensitivity 52.3% and OR 6.9. By contrast, a previous study which investigated the diagnostic accuracy of RASSF1 in BCa, showed lower specificity and sensitivity of RASSF1 than in our study (17% and 58% respectively), whereas a recent meta-analysis revealed that the risk for BCa in those individuals who have hypermethylated RASSF1 promoter in urine samples was OR = 19.82; 95% CI= [9.25; 42.45] [10, 24]. This risk was found to be higher among Mixed-race individuals (OR = 23.36; 95% CI= [8.39; 65.05]) and Asians (OR = 24.10; 95% CI= [15.01; 38.69]) and lower for Caucasians (OR = 13.99; 95% CI=[6.47; 30.25]) (all P < 0.0001). RASSF1 can constitute a fairly unique diagnostic biomarker for BCa since methylation of RASSF1 is rarely detected in normal bladder tissue [25]. Functional analysis of RASSF1 shows a potential involvement in inhibition of cell proliferation, promoting cell apoptosis and aging and the maintenance of microtubule stability. It is also known that the expression of RASSF1 is absent in many tumor cells as a consequence of the methylation of the gene promoter [25]. However, Chen et al. found that the use of a panel of genes had higher diagnostic accuracy compared to the use of a single gene promoter [19].

In our study population, the gene promoter of DAPK was hypermethylated only in one patient contrary to a meta-analysis concluding that DAPK promoter methylation was associated with BCa risk (OR:5.81; 95% CI = 3.83–8.82, P < 0.00001) [11]. Similarly, the gene promoter of TERT was methylated in only one subject with BCa; a recent study by a research group suggests that THOR (TERT Hypermethylated Oncological Region) hypermethylation is associated with disease progression and increased TERT expression, which leads to carcinogenesis [9]. To date, there are no published studies to confirm whether our results reflect a low prevalence of TERT and DAPK promoter in the Greek population.

An attempt was made to explore the diagnostic accuracy of our panel of genes for MIBC or high-grade tumors. We found a high negative predictive value of 0.86, with 0.86 specificity and 0.72 sensitivity Previous literature has sparsely investigated the value of methylation biomarkers in the diagnosis of MIBC or high-grade tumors. In a recent study, molecular analysis of the methylation profile of the promoters of p14ARF, p16INK4A, RASSF1A, DAPK and APC from urine sediments demonstrated correlations with BCa grade and stage [7], while other researchers found that the progression to MIBC in patients with primary pTaG1/2 BCa could be predicted with the methylation analysis of the gene promoters TBX2 and TBX3 [26].

Finally, 13.6% of our study controls had methylated the RASSF1 gene promoter, in accordance with a previous survey, which showed that 12% of the loci in apparently normal urothelium from cancerous bladder tissues were hypermethylated, indicating an epigenetic field defect [27].

In the control group, we detected DNA in 63% of the urine samples, which can be explained by the decreased cell exfoliation of normal urothelium [28]. Furthermore a recent study shows that the procedure for collection of urine sediments can be influenced by the co-sedimentation of normal cells and the presence of crystals and substances that may inhibit downstream PCR analyses [29].

Finally, our study was adequately powered and achieved an OR (6.9) higher than the initially desired OR = 4. The attained sample size of the control group was almost half of the initially planned. This might have had an effect on the genes with nonsignificant results especially for APC where methylation was 34% as opposed to 13.6% of the control samples.

Cost-effectiveness is always an issue with novel technologies. The detection of hypermethylation of specific genes from urine samples has been previously shown to be cost-effective in the diagnosis of BCa [20][30]. When using our panel of genes, the real costs were significantly lower than cystoscopy costs in the Greek National Healthcare System (89 Euro vs. 230 Euro). However, the cost-effectiveness needs to be examined in light of the diagnostic accuracy of our panel of genes which remains to be proven in larger longitudinal case-control studies.

Results of this pilot study suggest that methylation of the proposed panel of genes could be a promising urine biomarker for the diagnosis of BCa, but this needs to be confirmed with validation studies within different human populations in order to develop a “universal” or “generic” test that can detect, in principle, any BCa. The methylation of RASSF1 gene promoter itself could be a potential single urine biomarker.

AUTHOR CONTRIBUTIONS STATEMENT

All authors read and approved the final manuscript.

Authors’ Contribution

P. Georgopoulos: Protocol/Project development, Data Collection, Data analysis, Manuscript writing

M. Papaioannou: Protocol/Project development, Data Collection, Data analysis, Manuscript writing

Soultana Markopoulou: Protocol/project development

Aikaterini Fragou: Data analysis

George Kouvatseas: Data analysis

A. Apostolidis: Protocol/project development, manuscript writing/editing

ADDITIONAL INFORMATION

This study was funded via the project ‘Centre for the Study of Continence and Pelvic Floor Disorders’ of the Aristotle University of Thessaloniki (project No 83244, Research Committee, Aristotle University of Thessaloniki, Greece) and ASTELLAS (statistical analysis of results only).

Karaoglu, I., van der Heijden, A. G. & Witjes, J. A. The role of urine markers, white light cystoscopy and fluorescence cystoscopy in recurrence, progression and follow-up of non-muscle invasive bladder cancer.World journal of urologyvol. 32,3 (2014).
Yafi, F. A. et al. Prospective analysis of sensitivity and specificity of urinary cytology and other urinary biomarkers for bladder cancer.Urologic oncology vol.33,2 (2015)
Barkan, G. A. et al. The Paris System for Reporting Urinary Cytology: The Quest to Develop a Standardized Terminology.Acta cytologicavol. 60,3 (2016)
Chung, W. et al. Detection of bladder cancer using novel DNA methylation biomarkers in urine sediments. Cancer epidemiology, biomarkers & prevention: a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology vol. 20,7(2011)
Das, P. M. & Rakesh, S. DNA methylation and cancer. Journal of clinical oncology: official journal of the American Society of Clinical Oncology vol. 22, 22 (2004).
Li, H. T., Duymich, C. H., Weisenberger, D. J. & Lian, G. Genetic and Epigenetic Alterations in Bladder Cancer.International neurourology journalvol. 20,Suppl 2 (2016).
Pietrusiński, M. Æ. et al. Detection of bladder cancer in urine sediments by a hypermethylation panel of selected tumor suppressor genes.Cancer biomarkers: section A of Disease markersvol. 18,1 (2017).
Phé, V., Cussenot, O. & Rouprêt, M. Interest of methylated genes as biomarkers in urothelial cell carcinomas of the urinary tract. BJU international vol. 104, 7 (2009).
Leão, R. et al. Combined genetic and epigenetic alterations of the TERT promoter affect clinical and biological behavior of bladder cancer. International journal of cancer vol. 144, 7 (2019).
Zhan, L. et al. Quantitative assessment of the relationship between RASSF1A gene promoter methylation and bladder cancer (PRISMA). Medicine vol. 96, 7 (2017).
Dai, L. et al. DAPK Promoter Methylation and Bladder Cancer Risk: A Systematic Review and Meta-Analysis. PloS one vol. 11 (12), e0167228 (2016).
Andrés, G., Ashour, N., Sánchez-Chapado, M., Ropero, S. & Angulo, J. C. The study of DNA methylation in urological cancer: present and future. Actas urologicas espanolas vol. 37, 6 (2013).
Kader, F. & Meenu, G. DNA methylation-based variation between human populations. Molecular genetics and genomics: MGG vol. 292, 1 (2017).
Friedrich, M. G. et al. Detection of methylated apoptosis-associated genes in urine sediments of bladder cancer patients.Clin Cancer Res.15 (2004)
Hoque, M. O. et al. Detection of aberrant methylation of four genes in plasma DNA for the detection of breast cancer. J Clin Oncol. 24, 26 (2006).
Bray, F. et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: a cancer journal for clinicians vol. 68, 6 (2018).
Herr, H. W. Tumor progression and survival of patients with high grade, noninvasive papillary (TaG3) bladder tumors: 15-year outcome.The Journal of urologyvol. 163,1 (2000).
Beukers, W. et al. The use of molecular analyses in voided urine for the assessment of patients with hematuria. PLoS One. 8, 10 (2013).
Renard, I. et al. Identification and validation of the methylated TWIST1 and NID2 genes through real-time methylation-specific polymerase chain reaction assays for the noninvasive detection of primary bladder cancer in urine samples.Eur Urol.58 (2010)
Chen, H., Yu, Y., Rong, S. & Wang, H. Evaluation of diagnostic accuracy of DNA methylation biomarkers for bladder cancer: a systematic review and meta-analysis. Biomarkers: biochemical indicators of exposure, response, and susceptibility to chemicals vol. 19,3(2014).
Zhang, N. et al. Identification of Cancer-Specific Methylation of Gene Combination for the Diagnosis of Bladder Cancer. Journal of Cancer vol. 10, 266761–266766 (2019).
van der Heijden, A. G. et al. Urine cell-based DNA methylation classifier for monitoring bladder cancer. Clin Epigenet. 10, 71 (2018).
Giuliani, C. et al. Epigenetic Variability across Human Populations: A Focus on DNA Methylation Profiles of the KRTCAP3, MAD1L1 and BRSK2 Genes. Genome biology and evolution vol. 8 (9), 2760–2773 (2016).
Negraes, P. D. et al. DNA methylation patterns in bladder cancer and washing cell sediments: a perspective for tumor recurrence detection. BMC cancer. 8, 238 (2008).
Pfeifer, G. P. and Dammann. R. Methylation of the tumor suppressor gene RASSF1A in human tumors. Biochemistry. Biokhimiia vol. 70, 5 (2005).
Beukers, W. et al. Stratification based on methylation of TBX2 and TBX3 into three molecular grades predicts progression in patients with pTa-bladder cancer. Modern pathology: an official journal of the United States and Canadian Academy of Pathology, Inc vol. 28,4(2015).
Wolff, E. M. et al. Unique DNA methylation patterns distinguish noninvasive and invasive urothelial cancers and establish an epigenetic field defect in premalignant tissue. Cancer research vol. 70, 20 (2010).
Zuiverloon, T. C. et al. Optimization of nonmuscle invasive bladder cancer recurrence detection using a urine based FGFR3 mutation assay. The Journal of urology vol. 186, 2 (2011).
Larsen, L. K., Lind, G. E., Guldberg, P., Dahl, C. & DNA-Methylation-Based Detection of Urological Cancer in Urine: Overview of Biomarkers and Considerations on Biomarker Design, Source of DNA, and Detection Technologies. International journal of molecular sciences vol. 20,11 2657(2019).
Beltrán-García, J., Osca-Verdegal, R., Mena-Mollá, S. & García-Giménez, J. L. Epigenetic IVD Tests for Personalized Precision Medicine in Cancer. Frontiers in genetics. 10, 621 (2019).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

DNA Hypermethylation of a panel of genes as an urinary biomarker for bladder cancer diagnosis

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Study design – participants

Sample collection

DNA extraction and treatment

Gene promoter methylation assay

Statistical Analysis

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1