Diabetic Rat Model
Twenty-one Young Adult Sprague–Dawley rats (180-260 g) were used for this interventional study. Before the start of the experiments in order to adaptation, the animals were housed under suitable conditions of temperature, and light for two days and feed with standard rat chow diet in a 12:12-h light-dark cycle. This study was performed according to the animal care protocol, approved by the animal care and research committee of Tehran University of Medical Sciences. The experimental model of type 1 DM (insulin-dependent DM) was induced by a single intraperitoneal injection of 60mg STZ/kg (Sigma, St. Louis, MO) in 1 mM phosphate buffer. After 48 h of STZ injection, the development of DM was confirmed with the animal’s fasting blood sugar measurement (using a glucometer set). Fasting serum glucose was considered as an index of DM development (glucose level > 200 mg/dL). Rats became hyperglycemic at two days after STZ injection and maintained hyperglycemic before being killed.
Intervention
Experimental procedure
The rats were divided into four groups, 6 animals in each group as follow.
Group I Healthy control rats was administered normal saline 0.5 mL
Group II STZ-induced diabetic control rats was given vehicle flaxen oil 0.5 mL
Group III Diabetic rats were given α-L-guluronic acid (25 mg/kg) (manufactured by Sigma Corporation of America SIGMA R2625) in 0.5 ml Flaxen oil solution using an intraperitoneal injection for 30 days. At the first three days, injections were performed one time per day. Other injections were administered every-other-days.
Group IV Diabetic rats were given β-D-mannuronic (manufactured by Sigma Corporation of America SIGMA R2625) (25 mg/kg) in 0.5 ml Flaxen oil solution using an intraperitoneal injection for 30 days. At the first three days, injections were performed one time per day. Other injections were administered every-other-days.
Blood samples:
At the end of the study, after weighing and measuring blood glucose, rats were anesthetized with Ketamine and Xylazine and then sacrificed with chloroform. A peripheral blood specimen was drawn from each rat (6 mL/rat). EDTA was used as an anticoagulant. Plasma was separated by centrifugation (1200 × g for 10 min at 4°C) and stored in RNase-free tubes (1.5 mL) at –80°C.
miRNA extraction
MiRNAs were extracted from 400ml of plasma using Hybrid-R miRNA isolation Kit (GeneAll, South Korea) according to manufacturer's protocol. Concentration and purity of extracted miRNA were assessed by Thermo Scientific™ NanoDrop™ 2000/2000c Spectrophotometer.
Primers
Revers Transcription (RT) primer: First strand of cDNA was synthesized from miRNA templates using a stem loop cDNA synthesis primer, as described by Kramer (21).
Reverse primer: Universal reverse primer was obtained from Kramer article (21).
Forward Primers: Forward primers for each miRNA were designed according to the Kramer (21) and Busk (22) articles. Sequences of all forward primer (miR-34a, miR-126, miR-125a-5p, miR-29b, and miR-16 as normalizing factor) were shown in Table 1. All the primers were ordered for synthesis in Bioneer company, Daejeon, Republic of Korea.
CDNA synthesis and Real-time quantitative RT-PCR
CDNAs were synthesized from 5ul of total miRNA using PrimeScript® 1st Strand cDNA Synthesis Kit (Takara Bio, Siga, Japan, cat number: #6110A) according to the manufacturer’s protocol. The expression of miRNAs in treated and control groups was detected by using SYBRGreen PCR master mix (Takara Bio, Siga, Japan, cat number: #RR820L). The reaction was performed in a real-time quantitative PCR machine (Applied Biosystem step one plus). Real time PCR reactions were carried out using the first chain of cDNA as the pattern. Each reaction contained 2 µL of cDNA, 10 µL of SYBR Green I Master mix, 1 µL of miRNA-specific primers, 1 µL of upstream universal primer, 5.5 µl H2o, and 0.5 µL Rox. A mean of triplicate findings was used as the result for every sample. MiR-16 was used as an endogenous reference for normalization. Relative changes in gene expression were calculated by 2-ΔΔ Ct, the definition of is △△Ct= (Ct miRNAs - Ct miR-16) of the treatment group - (Ct miRNAs - Ct miR-16) mean of the control group.
Insulin, and Glucose assay
The glucose level was measured by glucose oxidase protocol and using glucose kit of the (biochemistry, Tehran, cat number: 117500). Insulin levels were measured using (DiaMetra, Perugia Italy, cat number: DKO076) ELISA kit.
Statistical analysis
Data were analyzed using Kolmogorov-Smirnov test. Due to non-normal distribution of data on gene expression and final food intake, non-parametric methods were used to analyze these variables. Kruskal-Wallis test and one-way ANOVA were used for between group analysis of these variables. Since data on fasting blood glucose, fasting insulin levels and weight were normal distribution one-way ANOVA test with LSD post Hoc was used to compare groups. (P <0.05) was considered as the level of significance. Kruskal-Wallis test was used to compare the mean concentration of different microRNAs in the control and intervention groups. SPSS 22.0 statistical software was used for statistical analysis and Graph Pad Prism V 6.3 was used for graph drawing. We used the Kruskal-Wallis test for comparison between multiple groups. P< 0.05 represent a statistical significance.
Table 1. Sequences of primers
Primer name
|
Accession number of miRs a
|
Sequences
|
Stem loop RT primer
|
-
|
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACNNNNNN
|
Revers primer
|
-
|
CCAGTGCAGGGTCCGAGGTA
|
F-miR-34a
|
MI0000584
|
GGGGTGGCAGTGTCTTAGCT
|
F- miR-29b
|
MI0000143
|
GGGGGGTAGCACCATTTGAAATC
|
F- miR-125a-5p
|
MIMAT0000135
|
GGGGTCCCTGAGACCCTTTAAC
|
F- miR-126a
|
MI0000153
|
GGGGGTCGTACCGTGAGTAAT
|
F- miR-16
|
MI0000565
|
GGGGGGTAGCAGCACGTAAATA
|
RT; Reverse Transcription, F; forward primer,
aAccession numbers are from miRBase sequence database (http://microrna.sanger.ac.uk)