Materials
6-hydroxydopamine (6-OHDA) was purchased from Selleck. Human bone marrow mesenchymal stem cells (hBMSCs) was purchased from Cyagen Biosciences. LXR agonist-TO901317 (N-(2, 2,2-trifluoro-ethyl)-N-[4-(2,2,2-tri-fluoro1-hydroxy-1-trifluoromethyl-ethyl)-phenyl]-benzenesulfonamide) was purchased from Sigma-Aldrich. Apomorphine hydrochloride was purchased from Pharmaceutical Factory of Qinghai, China. Goat serum was purchased from Beijing Dingguo Changsheng Biotechnology, China.
Animals
Sprague-Dawley (SD) rats were accommodated in the barrier housing facility, in keeping with the national standard of “Laboratory Animal-Requirements of Environment and Housing Facilities.” The care of the laboratory animal and the animal experimental operation conform to the “Chongqing Administration Rule of Laboratory Animal.” The experimental procedures were approved by the animal laboratory administrative center and the institutional ethics committee of Chongqing Medical University (License number: SYXK YU 2018-0003).
Parkinson's disease rats
All male SD rats were weighted 220g-250g. To establish the rat model of PD, All SD rats received intraperitonal injection of apomorphine (0.5mg/kg). Rats were selected without rotation behavior to receive a 6-OHDA lesion of the medial forebrain bundle on the right side (MFB, AP: 1.8mm, ML: 2.0 mm, DV: 8.0/7.8mm). 30 male rats received a 6-OHDA lesion of the MFB on the right side and 10 rats were as control group only injected with solvent which was used to dissolve 6-OHDA 40, 41. Briefly, rats were anesthetized with chloral hydrate (4% chloral hydrate and 96% saline solution, 1ml/100g) by intraperitoneal injection. The MFB was targeted with an injection of 4μl 0.02% L-ascorbic acid saline solution containing a total amount of 16μg of 6-OHDA. The lesion to stereotaxic coordinates were adjusted to the age and weight of the animals with the help of brain stereotaxic instrument (RWD, Shenzhen, China). After two weeks to one month, to determine whether the models were successful, we used apomorphine to induced rotation and behaviour was recorded over a period of 30 min. Judging that the model is successful is that the number of rotations to the healthy side is more than 7 rotations per minute.
Differentiation of hBMSCs
Human BMSCs were divided into 3 groups and plated onto 24 well plates where each plate contained 2.0×104 cells and cells were cultured at 37°C with 5% CO2.
Control group: hBMSCs were cultured in Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12, Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS, BI) with 24 hours. After that, the medium was replaced with neurobasal medium (Invitrogen/Gibco, USA) and 0.5% B27 supplement (Invitrogen/Gibco, USA).
Growth factors treated group (GF): hBMSCs were cultured in DMEM/F-12 containing 10% FBS with 24 hours. After that, the medium was replaced with neurobasal medium and 0.5% B27 supplement. The cells were induced only once with a cocktail of 250 ng/ml Recombinant Human SHH (PeproTech, Rocky Hill, NJ, USA), 100 ng/ml Recombinant Human FGF8 (PeproTech, Rocky Hill, NJ, USA), and 50 ng/ml Recombinant Human basic-FGF (bFGF; PeproTech, Rocky Hill, NJ, USA). The medium was not replaced in 12 days.
TO901317 and growth factors treated group (LXR+GF): On the basis induction of GF, effects of TO901317 on the differentiation of hBMSCs into DA neurons in the time-dependent and concentration-dependent manner were investigated. According to the results of (a) (b) and (c), the cells were induced only once with the cocktail and the medium was not replaced during the induction period.
Explore the best concentration of TO901317 added: Different concentrations of TO901317 (0.125, 0.25, 0.5, 1 and 2 μM) were added with GF (250ng/ml SHH, 100ng/ml FGF8, 50ng/ml bFGF).
Explore the best time to add TO901317 during growth factor induction period: On the basis of GF, TO901317 were added on the first day, the third day, the sixth day, and the ninth day, respectively, to induce differentiation for 12 days.
Explore the induction time of the TO901317 in combination with GF: According to the result of (a) (b), 0.5 μM TO901317 was added to the culture medium, and the cell morphology was observed every 3 days.
Cell Counting kit-8 assay
A Cell Counting Kit-8 (CCK-8; Dojindo, Japan) assay was used to test the growth rate by following the manufacturer’s instructions. 3000 cells/well of hBMSCs were cultured into a 96-well plate in every group. At 3-day intervals, the growth rates of cells in each group were measured by application of CCK-8 kit and optical density (OD) was determined at 450 nm using a microplate reader (Thermo Scientific, USA).
Immunofluorescence
In brief, cells of each group were fixed in 4% paraformaldehyde and permeabilized with 0.3% Triton-X100 and blocked in phosphate buffer solution (PBS) containing 5% normal goat serum (Beijing Dingguo Changsheng Biotechnology, China). Cells were incubated with monoclonal antibodies overnight with 4℃. Antibodies’ dilutions were as follows: β III tubulin, 1:200 (Tuj1; Abcam, Cambridge, UK); Tyrosine hydroxylase, 1:200 (TH, Abcam, Cambridge, UK); Nestin, 1:200 (Abcam, Cambridge, UK); Neun, 1:200 (Abcam, Cambridge, UK); LXR α receptor, 1:200 (Abcam, Cambridge, UK); LXR β receptor, 1:200 (Gene Tex, USA). After extensive washing for 3 times in PBS, suitable secondary antibodies anti-mouse IgG-Alexa Fluor 488, anti-rabbit IgG-Alexa Fluor 488, anti-mouse IgG-Cy3, anti-rabbit IgG-Alexa Fluor 594 were diluted at 1:200 in PBS, and then suitable secondary antibodies were added and incubated in darkness for 1h at room temperature. Then nuclear stain 4, 6-diamidino-2-phenylindole (DAPI; Beyotime Biotechnology, Shanghai, China) was used for nuclear staining.
Enzyme-Linked Immunosorbent Assay (ELISA)
To investigate whether cells in each group release dopamine. Culture supernatant and cells of control group, GF group and LXR+GF group were collected. Cells were added with PBS, then grinded on ice. The mixture was centrifuged at 3000g for 20min at 4°C and collected the supernatants. Dopamine was detected by ELISA kits (n=6) (Mei biao, Jiangsu, China). The samples and standards were tested according to the instructions.
Western Blotting Test
Cells were plated on six-well plate for 24 hours with 10% FBS, then grown in induction medium for six days to be used for preparation of whole cell extract. After removing the media, cells were washed three times with PBS. Then cells in each well were added 150ml lysis buffer containing 1% phenylmethanesulfonyl fluoride (PMSF) and cracked on ice for 30 minutes. The mixture was centrifuged at 12,000 g for 20 min at 4°C and collected the supernatants. The protein concentration was determined by BCA Protein Assay Kit (Beyotime, China). The protein was separated by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to PVDF membranes (Millipore, United States). The membranes were blocked with 5% bovine serum albumin (BSA) for 2 h at room temperature and then incubated with specific primar antibodies, TH, 1:500 (Abcam, Cambridge, UK); LXR α receptor, 1:500 (Abcam, Cambridge, UK); LXR β receptor, 1:500 (GeneTex, United States) were included and overnight at 4℃. The membranes were rinsed three times in TBST and incubated with HRP conjugated secondary antibodies at room temperature for 1h. Then after washed three times in TBST, protein signals were visualized by ECL (Bio-Rad, United States).
Real-Time Polymerase Chain Reaction (qPCR)
Total RNA was isolated from the cells in control group, GF group and LXR+GF group by Trizol reagent (Vazyme, Nanjing, China) according to the manufacturer’s protocol. Then mRNA was subjected to reverse transcription using HiScript Q Select RT SuperMix (Vazyme, Nanjing, China). SYBR Green II (Biomake, USA) incorporation method was used to detect the amount of mRNA. Negative controls were used as no template cDNA reactions and melting curves were used to confirm the results. The results were normalized using GAPDH concentration of each sample. The primer sequences are reported in Table 1.
Table 1. List of primers used in qPCR analysis.
|
GENE
|
FORWARD Sequence (5′->3′)
|
REVERSE Sequence (5′->3′)
|
ABCA1
|
GAGGCAATGGCACTGAGGAAGATG
|
CAACGAGCAGCGGCTTCAGAG
|
GAPDH
|
CTGGGCTACACTGAGCACC
|
AAGTGGTCGTTGAGGGCAATG
|
Cell transplantation
Four weeks after 6-OHDA infusion, PD rats were divided randomly into two groups as follows: the saline group (6-OHDA group, n=10) and cells transplantation group (6-OHDA+Cells group, n=20). The differentiated DA cells were dislodged by accutase cell dissociation reagent (Invitrogen/Gibco, USA). Cell suspensions of 5μl (100,000 cells/μl) were transplanted in right SN (AP: 4.6mm, ML: 2.2mm, DV: 7mm).
Histopathological Examination
Hematoxylin and eosin (HE) staining was performed to show pathological histological damage in the substantia nigra pars compacta (SNc) and striatum. The rats of control group, 6-OHDA group and 6-OHDA+Cells group were anesthetized with sodium chloral hydrate (4%, 1ml/100g) and perfused with PBS, and then perfusion with 4% paraformaldehyde. After that, the brains were dehydrated in a graded series of alcohols and embedded in paraffin. A series of 5-μm-thick sections were cut from the brain. Finally, the sections were stained with HE reagents for histopathological examination.
Statistical analysis
All results were expressed as the means ± standard deviation (SD) and the statistical significance of differences was analyzed by GraphPad Prism (GraphPad Software, La Jolla, CA, USA). For the comparison of multiple groups, statistical analysis was performed using one-way analysis of variance (ANOVA) with Bonferroni’s posthoc test. Probability values less than 0.05 (p < 0.05) were considered to be statistically significant.