Animals
Twenty-four male C57BL/6J mice, aged 6 weeks, were purchased from Animal Center of West China Medical College, Sichuan University (Chengdu, China). All animals were housed in individual cages under 12-hour light/dark cycles environment, provided free water and food, and approved by ethics committee of Affiliated Hospital of North Sichuan Medical College. All efforts were aimed to alleviate animal suffering.
Model preparation and animal grouping
This research was divided into two parts. In the first part of experiments, mice were randomly assigned to 4 groups (n=6) as follows: chow, chow.Rev, HFD, HFD. Rev. Three mice from each group were randomly selected to collect feces for 16s rRNA sequencing of gut microbiota. Mice were adaptively fed with normal chow or HFD for 2 weeks, and then chow.Rev and HFD.Rev groups were intragastric administration with resveratrol (45 mg/kg/d) for 4 weeks. Resveratrol (Sigma) was dissolved in 0.5% sodium carboxymethyl cellulose. The second parts of experiments were designed to determine the effect of treatment with resveratrol in cerulein-induced and HFD acute pancreatitis mice models. Mice were randomly assigned to 4 groups (n=6) as follows: chow + cerulein, chow.Rev + cerulein, HFD + cerulein, HFD.Rev + cerulein. The procedures were the same as before. But 24 h after the last intragastric administration with resveratrol, all the groups were intraperitoneal injections of cerulein (Sigma) by two hourly, each time at a dose of 40 μg/kg body weight. All mice were killed 12 h after cerulein injections.
Measurement of TC and TG
Blood biochemical indicators of the lipid profile were assessed. The concentrations of total cholesterol (TC) was measured by Micro total cholesterol (TC) content assay kit (Solarbio, Beijing, China) and triglyceride (TG) was assessed by triglyceride content assay kit (Solarbio, Beijing, China) according to manufacturer's instructions.
Enzyme-linked immunosorbent assay (ELISA)
Blood was collected from mice in each group, and centrifuged at 1500 rpm for 10 min to obtain the serum. In the first part of experiments, the levels of proinflammatory cytokines including LPS (cusabio, Wuhan, China), MCP-1 (Abcam), TNF-α (Beyotime, China), and IL-6 (Abcam) were determined by ELISA according to the manufacturer’s instructions. In the second part of experiments, the levels of malondialdehyde (MDA) (Solarbio, Beijing, China), superoxide dismutase (SOD) (Solarbio, Beijing, China), and total antioxidant capacity (T-AOC) (Solarbio, Beijing, China) were measured by ELISA according to the manufacturer’s instructions. The OD value of each well was immediately read at 450 nm.
Histopathological assessment
Pancreatic tissues from each group were fixed in 4% paraformaldehyde at room temperature, embedded in paraffin, and sectioned at a thickness of 5 μm. In the immumohistochemical staining, TNF-α and MCP-1 antibody (1:400) and related conjugated secondary antibody were used. In the H&E staining, the tissues were stained with hematoxylin and eosin (H&E). The histopathological change was observed under the light microscope (Olympus, Tokyo, Japan) at 400× magnification.
Western blot assay
After the pancreatic tissues were obtained, proteins were extracted using RIPA lysis buffer (Beyotime, Beijing, China), and protein concentrations were measured using a BCA protein assay kit (Vazyme, Nanjing, China) following the manufacturer’s protocols. The protein samples were then separated by 10% SDS-PAGE and transferred onto polyvinylidene fluoride (PVDF) membranes. Next, the PVDF membranes were blocked by 5% skim milk. After being cultured for 2 h at room temperature, they were then incubated overnight at 4°C with specific primary antibodies including p65, p-p65, TNF-α and IL-6. After washing for three times, the blots were subsequently incubated with a goat horseradish peroxidase‑conjugated secondary antibody for 2 h at room temperature. After four times washing for 10 min in Tris-buffered saline with Tween-20 (TBST), the membranes were detected using a chemiluminescence detection system. The intensity of the bands was quantified by ImageJ software. β-actin served as a loading control.
DNA extraction
The fecal DNA of mice in each group was extracted with ZR Fecal DNA Extraction Kit (Zymo Research, CA, USA). Buffer solution was added to 200 mg feces from each group to prepare fecal homogenate, and the sediments were centrifuged using vortex mixer after incubation at 70°C. Then the supernatant was extracted, and inhibitors were added. The sediments were centrifuged, aspirated the supernatant again. Buffer solution was added and incubated at 70°C for 10 min, and 200 μl absolute ethanol was added ultimately. After the sample was purified, the DNA sample is obtained, which is quantified by an ultraviolet spectrophotometer and tested for purity. After this, the DNA quality is analyzed by agarose gel electrophoresis.
16sRNA sequencing of gut microbiota
Bacterial RNA was amplified by RT-PCR targeting the V3-V4 hypervariable regions of the 16s RNA gene and using specific primers (319F: 5′ ACTCCTACGGGAGGCAGCAG 3′; 806R: 3′ ACTCCTACGGGAGGCAGCAG 5′). Amplicons were pooled and paired-end sequenced on an Illumina MiSeq (Illumina) in the Shanghai Personal Biotechnology Co., Ltd (Shanghai, China). The Quantitative Insights Into Microbial Ecology (QIIME, v1.8.0) pipeline was employed to process the sequencing data, as previously described. Sequence processing and microbial composition analysis were performed with the Quantitative Insights into Microbial Ecology (QIIME) software package, version 1.9.1. After quality filters, the remaining high-quality sequences were clustered into operational taxonomic units (OTUs) at 97% sequence using the reference-based USEARCH (version 5.2) pipeline in QIIME, using the May 2013 release of the GreenGenes 99% OTU database as a closed reference. The raw data and sequencing sample information have been submitted to the SILVA database to classify.
Statistical analysis
All data are expressed as mean ± SD. Statistical analysis was performed using GraphPad Prism 7 (GraphPad software, USA). Statistical differences among the groups were determined using one‑way ANOVA or two-way ANOVA to compare differences between experimental and control group. Results with p<0.05 were considered statistically significant. All experiments were performed at least in triplicate.