2.1 Animals
A total of 40 male ApoE knockout (ApoE‑/‑) mice (age: 6 weeks; weight: 19 ± 1.7 g) were purchased from the Beijing Vital River Laboratory Animal Technology Co.Ltd. (Beijing, China) and were allowed to adjust to their new environment for 2 weeks. The mice were housed at the animal facility of Shanghai East Hospital with free access to food and water and in a pathogen-free environment with a 12-h light/dark cycle. After the adjustment period, the animals were fed with a high-fat diet consisting of 42% fat, 19% crude protein and 39% carbohydrate (Slaccas, Shanghai, China) at a controlled temperature of 22 ± 2 °C for 10 weeks. Those mice were randomly divided into four groups: Control (n = 10), AGEs (30 mg/kg/day) (n = 10), AGEs (30 mg/kg/day) + ALT711 (AGEs inhibitors, alagebrium 1 mg/kg/day) (n = 10) and AGEs (30 mg/kg/day) + ATV (atorvastatin 10 mg/kg/day) (n = 10). All animal experimental procedures were in strict accordance with protocols approved by the Ethics Committee of Shanghai East Hospital, Tongji University, and the experiments were performed in accordance with the National Institutes of Health Guidelines for the Use of Laboratory Animals.
2.2 Preparation Of Ages
AGEs were prepared as described previously [18]. Briefly, D-glucose, bovine serum albumin (BSA) and penicillin-streptomycin were dissolved in 0.2 mmol/L PBS (pH 7.4) to the final concentrations of 0.5 mol/L, 50 g/L and U/Lrespectively. The reaction mixture was incubated by protecting from light for 24 hours. They were filtered through 0.22 µm filter and then incubated at 37 °C for 8 weeks. Removing the unconjugated glucose and to dialyze against sterilized PBS for 48 hours. Fluorospectrophotometer with an excitation wave of 370 nm (the maximum absorption peak was measured at 440 nm), and SDS-PAGE (the molecular weight of the material was larger than BSA) that the mixture was glycated-BSA. The glycated-BSA was freeze-dried and stored at 4 °C.
2.3 Immunohistochemistry Of Ages
Immunostaining for AGEs was performed as described previously [19]. Briefly, paraffin embedded slide samples prepared as mentioned above were routinely de-waxed, rehydrated and rinsed in 3% H2O2 to block endogenous peroxidase. Then the slides were incubated successively with primary antibody against AGEs (1:500, Abcam) and with ABC kit (Beijing Zhongshan Jinqiao Biotechnology, Beijing China). Images were obtained by light microscope. Five sections of cerebral cortex were selected and mean number of positive cells was recorded.
2.4 Nissl's Staining And Cell Counting
Nissl's body is used as a marker of the functional state of neurons. Nissl's staining was performed as described previously [20]. Briefly, the tissue sections (45 µm) were deparaffinized and subsequently rehydrated using different gradients of ethanol. Then the sections were stained in a 1% toluidine blue solution for 5–10 minutes, and differentiated in 75% ethanol for seconds, then rinsed quickly in distilled water. In addition, sections were counterstained with TO-PRO-3 Iodide (1:1,000; Life Technologies) for the nonspecific nuclear staining of all cells. At last, sections were sealed with neutral gum. Five sections of cerebral cortex were selected and mean number of positive cells was recorded.
2.5 Congo Red Staining
Congo Red histochemical stain may serve as a simple screening tool for investigating if the aggregates in mutant cells have misfolded β-pleated sheet secondary structures. Congo red staining was performed as described previously [21]. Briefly, brains were perfusion-fixed with 4% paraformaldehyde and paraffin-embedded. For Congo red staining, coronal brain sections were incubated for 5 min at room temperature in a solution containing 0.2% Congo red (Biopack, Argentina), 3% NaCl and 0.01% sodium hydroxide in 80% ethanol. After rinsing, sections were put on gelatin-coated slides, air-dried overnight, dehydrated using ethanol and cleared in xylene. At last, sections were sealed with neutral gum. Sections were visualized using optical microscopy for detection of any orange amyloid plaques.
2.6 Quantitative Real-time Polymerase Chain Reaction (qRT-PCR)
RNA was extracted from cerebral cortex tissue, including RAGE, NF-κB p65 and NADPH oxidase p47phox, using TRIzol reagent (Sigma-Aldrich) according to the standard protocols [22]. Oligonucleotide primers were designed based on Genbank entries for rat RAGE, NF-κB p65, NADPH oxidase p47phox and β-actin. Primers sequence was presented in Table 1. The following conditions were used for reverse transcription: 25 °C for 5 min, 42 °C for 60 min, and 70 °C for 5 min. Each 10 µl PCR contained 2.5 µl cDNA, 5 µl of 2 × SYBR Green PCR Master Mix (Applied Biosystems, Foster city, CA), and 1 pmol of each primer. Quantitative PCR was performed in 96-well optical reaction plates on the AB1 7000 Real-Time PCR System (Applied Biosystems). Relative gene expression was determined by the ΔΔCt method, where Ct meant threshold cycle. All experiments were performed in triplicate.
Table 1
Primers for quantitative PCR.
Gene | Primer | Sequence |
RAGE | Forward | 5′- GGGAGGCCTGGGAGTAGTAG − 3′ |
Reverse | 5′- ATTCAGCTCTGCACGTTCCT − 3′ |
NADPH | Forward | 5′-TCCCAAGTGGTTTGACGG-3′ |
Reverse | 5′-CCTCCTCTTTCTGGCTGTG-3′ |
NF-κB | Forward | 5′-TCTGCTTCCAGGTGACAGTG − 3′ |
Reverse | 5′- ATCTTGAGCTCGGCAGTGTT − 3′ |
β-Actin | Forward | 5′- GCCCTGAGGCTCTTTTCCAG − 3′ |
Reverse | 5′-TGCCACAGGATTCCATACC − 3′ |
2.7 Western Blotting Analysis
Western blotting for RAGE, NF-κB p65 and NADPH oxidase p47phox in cerebral cortex was performed as standard protocols [22]. The brain tissue was got out wholly and a part of the cortex was soon separated. Then we homogenized the tissue in RIPA (Beyotime Biotechnology, China) followed with protease inhibitor cocktail (Roche, Basel, Switzerland). The next we utilized the bicinchoninic acid protein assay kit (Beyotime Biotechnology, China) to quantify protein concentration. After that, we separated protein aliquots (30 µg) on a 10% sodium dodecyl sulfate polyacrylamide gel and transferred them onto a polyvinylidene difluoride membrane. The membrane was blocked with 5% skim milk in TBST and incubated overnight at 4 °C with one of the following primary antibodies: Rabbit monoclonal RAGE (1:1000, Abcam), NF-κB p65 (1:1000, CST), NADPH oxidase p47phox (1:200, Santa), and β-actin (1:2000, Weiao). Then we washed membranes with TBST for 10min × 3 and incubated with horseradish peroxidase-conjugated Goat anti-rabbit secondary antibodies at normal temperature for 1 hour. Using the enhanced chemiluminescence reagent (Millipore, Bedford, MA, USA) and a gel imaging system (Bio-Rad, Hercules, CA, USA) to detect protein bands. The expression of target proteins was semi-qualified as the following formula: Relative coefficient = target protein concentration/β-actin concentration.
2.8 Statistical Analysis
SPSS 20.0 (IBM, Chicago, IL, USA) was used. Data were expressed as mean ± standard deviation (SD). One-way analysis of variance was used to compare between four groups. P < 0.05 was considered as a statistically significant difference.