Drugs, chemicals and kits
NAC (600 mg/20 tablet) was purchased from Basel Drug Co. (Istanbul, Turkey). MK-801 (CAS Number 77086-22-7; molecular weight 221.30 g/mol; purity ≥ 99%, a selective NMDA receptor antagonist) and all other chemicals were obtained from Sigma Chemical Co. (St. Louis, MO, USA). Total oxidant capacity (TOS) and Total antioxidant capacity (TAS) kits were purchased from Rel Assay Diagnostics (Gaziantep, Turkey). All chemicals that were used in this study were of analytical grade.
Animals
Adult (8-10-week-old) BALB/c mice (n=24) weighing 30-35 g were acquired from the Experimental Animals Research Center of Afyon Kocatepe University. The animals were housed in a light-controlled room (12 hours of light/dark, light starting at 8:00 am) at 22±1°C and 45±15% humidity with standard commercial pellet feed and free access to tap water. The permission necessary for conducting experiments on the mice was received from the Animal Experiments Local Ethics Board of Afyon Kocatepe University (AKUHADYEK-189-17), and ethical directives were adhered to throughout the experiment.
Groups and Drug Applications
After a week of adaptation, the mice were divided into four equal groups (n=6 in each group): Control, NAC, MK-801 and NAC+MK-801. To the control group, a saline solution was administered at a volume of 10 ml/kg every day in the afternoon. MK-801 (a selective NMDA receptor antagonist) was administered at a dose of 1 mg/kg every day in the afternoon, while NAC was administered at a dose of 100 mg/kg every day in the morning (Because of the half life time of the NAC). The drug applications lasted for 14 consecutive days. The dose of NAC was determined according to the description of Fukami et al. (2004), and the dose of MK-801 was determined according to the method of Xiu et al. (2014; 2015). All drugs (Sigma, USA) were dissolved in saline, the solutions were freshly prepared every day, and they were applied intraperitoneally (i.p.). On the fifteenth day, the animals were subjected to the open field test (OFT) and elevated plus-maze test (EPM).
Open Field Test
Hyperactivity was calculated in a 60 x 60 x 24 cm stainless galvanized sheet metal o.f.t. area that was separated into 36 equal squares. The squares that were nearest to the wall were labeled "peripheral," while the rest were labeled "central." The mouse was positioned in the center of the arena for o.f.t., and a video camera manually monitored the number of squares crossed by the four paws (hyperactivity) for 5 minutes (Taksande et al., 2009). After each animal was subjected to the exam, the arena was washed with 70% alcohol to remove the odor.
The Elevated Plus-Maze Test
The e.p.m. test measured exploratory hyperactivity as well as anxiety-like behaviors. A platform made of stainless galvanized sheet metal with two open arms (30 cm x 5 cm) and two enclosed arms of the same size with 15-cm-high walls was used for the EPM test. Both of the armies converged in the middle of the arena (5 cm x 5 cm). Each animal was placed in the middle of the plus maze, facing the enclosed arm, and monitored by a video camera for 5 minutes. The maze apparatus was washed with 70% alcohol after each trial. It was recorded how much time the animals spent in enclosed arms. If the animal's four legs and body moved to that zone, it was determined whether it was in the open arm, enclosed arm, or center. Mice prefer safe enclosed arms to open arms that cause anxiety (Akillioglu et al. 2012).
Sacrifice and Examination of Brain Tissue
All animals were sacrificed on the 16th day by cervical dislocation. The skulls of the animals were opened, and their brains were removed. The brains were weighed and divided into two pieces from the middle. One half of the brains were allocated for stereological-pathological examination and measurements, while the other half were allocated for TAS-TOS measurements and real-time PCR analyses.
The brain hemispheres allocated for stereological examination were consecutively sliced in compliance with the systematic uniform random sampling method (Gundersen et al., 1988) at thicknesses of 40 microns with a microtome from the polus rostralis towards the caudal. While thick cross-sections were taken for pathological measurements, 5-micron samples were taken from the cross-sections in-between until reaching a thickness of 40 microns, and pathological assessments were made on these cross-sections. On the thick cross-sections stained by Hematoxylene-eosine, the diameters of the nuclei of cells in the hippocampus CA1 (cornu ammonis 1) region were measured with the help of the M-Shot software (x100). The measurements were made on the cells in the central zone on the thick cross-sections with a safe height interval. The safe height interval was determined as the 10-micron zone in the central zone of the cross-section after the cross-section thickness was measured with the help of a microcator. The pathological observations performed on the thin Hematoxylene-eosin stained sections for the glial cell infiltration and vacuolization were scored as follows: Observed changes were graded as normal (grade -), to severe (grade ++).in a blinded manner.
Preparation of brain tissue homogenate
The brain tissues were separately weighed after washing with a 0.9% NaCl solution and transferred into thick-walled glass tubes. Afterwards, to dilute the brain tissues, cold phosphate buffer (pH 7.4, 50 mM) was added onto them by ten times their weight, and they were homogenized in a flask full of ice for 10 s at the first speed setting (IKA Ultra Turrax-T18, Germany). The homogenization process was ended after observing that the tissues were homogenously disintegrated inside the tube at 10-s intervals. The obtained homogenates were then centrifuged at 2795 g for 10 min (Nuve NF 1000R, Ankara, Turkey). All procedures were carried out at 4°C. The brain samples were kept at -80°C before the oxidative stress parameters were assessed.
TAS-TOS measurement in brain tissue homogenate
The TOS of the tissues was measured based on the method described by Erel (2005) by using a total oxidant level kit (Rel Assay Diagnostics, Gaziantep, Turkey). The oxidants in the sample convert ferrous ion chelator complexes into ferric ions. Ferric ions form a colored complex with the chromogenic solution. The absorbance of this complex was measured at 530 nm with an ELISA reader set at 25°C to determine the TOS levels, and it was directly proportional to the oxidant amount in the sample. The results are presented as µmol H2O2 equiv/L.
The TAS of the tissues was measured based on the method described by Erel (2004) by using a TAS Rel Assay brand kit (Rel Assay Diagnostics, Gaziantep, Turkey). The measurement is made based on the discoloration of antioxidant molecules. According to the instructions of the kit, 500 µL of reagent 1 (measurement buffer) and 30 µL supernatant were combined, and the absorbance was measured at 660 nm by an ELISA kit set at 25°C to determine the TAS levels. After this, 75 µL of reagent 2 (colored ABTS solution) was added to the mixture, and the product was incubated for 10 min. The TAS levels were determined by reading the absorbance at 660 nm after incubation. Trolox was used as a calibrator, and the results are presented as mmol Trolox equiv/L.
Real-Time PCR
Total RNA was extracted from the brain tissue according to the instructions of the manufacturing firm using a kit with an RNA isolation capacity (GeneAll Hybrid R, RiboEx-Seoul/Korea). For this aim, a 100 mg of tissue was homogenized by dividing into small pieces with a lancet, and it was vortexed by adding 1 mL RiboEx onto it. The kit that was used for the cDNA synthesis was a HyperScript™ First strand Synthesis, GeneAll Hybrid R (Seoul/Korea). For preparing a master mix, the RNA sample, primer, dNTP mix and RNase-free distilled water were used. After the cDNA master mix was prepared, it was incubated for 5 min at 65°C. After incubation, the mixture was put onto ice. After this, onto the cDNA master mix, the 10X RTase Reaction Buffer, 0.1 M DTT, Reverse Transcriptase and RNase Inhibitor components were added, and a homogenous mixture was ensured. After preparing the master mix for cDNA synthesis, the next step was the reverse transcription reaction. The reverse transcription reaction was carried out in two steps. By leaving for 60 min at 55°C in the first step and for 5 min at 85°C in the second step, the cDNA synthesis was completed. The cDNA samples were frozen at -80°C. In the real-time PCR, for MBP amplification, the forward primer TGGAGAGATTCACCGAGGAGAGGC and reverse primer TGAAGCTCGTCGGACTCTGAGGGC primer sequences and a kit (RealAmpTM SYBR qPCR Master mix) were used. As the master mix components used for the real-time qPCR, 2X MasterMix (with SYBR-Green), ROX Dye, Forward Primer (10 μM), Reverse Primer (10 μM), cDNA Template and RNase-free distilled water were used. The real-time qPCR reaction was carried out in an Applied Biosystems™ 7500 Fast Real-Time PCR device. The PCR program was started with 1 cycle for 300 s at 95°C as the initial denaturation. This was followed by 40 cycles at 95°C for 15 s and 55-68°C for 60 s, and the program was ended with a melting curve analysis.
Kluver-barrera staining
The Kluver-barrera stain is fundamentally used to show the nervous system's myelinated parts. Thus, the myelin sheath is stained blue, and the observer easily examines demyelination. The thin sections crossed to the corpus callosum were collected and passed through the xylene and graded ethanol series (100 and 95%), then soaked in Luxol fast blue solution at 60℃ for 1 hour, and the dye was removed (except corpus callosum) by lithium carbonate solution, distilled water, and 70% ethanol. The sections was soaked in Eosin Y solution for 40 seconds, distilled water, 0.1% Cresyl violet (Sigma) solution for 1 minute, and then in 95% ethanol followed by 100% ethanol and xylene for dehydration and transparency. After mounting, corpus callosum was observed using an optical microscope. The staining density of the corpus callosum was scored as normal (grade 0), to disappearance (grade 3).
Immunuhistochemistry
The terminal deoxynucleotidyl transferase biotindUTP nick end labelling staining (TUNEL) method
TUNEL assay was performed according to manufacturer’s instructions (Abcam ab206386). The 5-μm-thick brain sections were collected and evaluated using TUNEL-positive cells. The tissues were deparaffinised at 60℃ overnight and soaked in xylene, graded ethanol (100, 96 ve 80) and PBS solution. The sections were treated with deoxyribonuclease-free proteinase K at room temperature for 20 min and then washed with PBS three times (5 min for each). After being fixed at room temperature for 15 min, the samples were washed with PBS for another three times (5 min each time). Next, each sample was added with %70 Reaction Buffer + %30 TdT Enzyme and incubated for 1.5 h at 37°C, followed by processing with Anti-Digoxigenin-Peroxidase solution for 30 min. and PBS washing three times. The samples treated DAB dilution buffer+DAB substrate solution for 10 min. After three times PBS washing the methylene green stain was performed and samples were passed through graded ethanol and xylene. Then, the samples were sealed and the apoptotic cells were observed using a light microscope. The dark brown stained cells were evaluated as Tunel-positive cells.
Statistical Analysis
The data obtained in the study were analyzed by using the SPSS 21.0 for Windows package software. In the statistical analysis, firstly a normality test was applied to see whether or not there was a normal distribution among the groups. The parametric test of analysis of variance (ANOVA) was used in the comparison of the data confirmed to be normally distributed based on the groups. Duncan’s test was applied in the pairwise comparisons of the groups. The level of statistical significance for the difference between groups was taken as 0.05.