Construction and functional analysis of a CeRNA network Data for miRNA-LncRNA SNHG1 and LncRNA SNHG1-mRNA interactions were obtained from ENCORI. Before analyzing the data downloaded from ENCORI, duplicates were filtered out. Then, differential miRNAs and mRNAs were filtered out by analyzing 156 GBM tissues and five normal brain tissues in The Cancer Genome Atlas (TCGA; https://portal.gdc.cancer.gov/) database. Next, correlations between differential miRNAs and mRNAs were obtained by ENCORI. Differential mRNAs with down-regulated expressions were then analyzed for Kyoto Encyclopedia of Genes and Genomes (KEGG; https://www.genome.jp/kegg/) pathway enrichments. The analysis revealed that some mRNAs were involved in up-regulated pathways. Next, miRNAs negatively correlated with these mRNAs were selected and multiple SNHG1-miRNA-mRNA interaction networks were constructed.
Cell culture The human GBM A172 and U251 cell lines, and glioma H4 and HS683 cells were purchased from the American Type Culture Collection (Manassas, VA, USA) and normal human astrocytes (HA) were obtained from ScienCell Research Laboratories (San Diego, CA, USA). A172 and U251 cells were grown in high glucose Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Gaithersburg, MD, USA) containing 10% fetal bovine serum (FBS, Gibco). H4 and HS63 cells were grown in high glucose Dulbecco’s Modified Eagle Medium (Gibco) containing 10% fetal bovine serum (Gibco). HA cells were grown in astrocyte medium (Sciencell Research Laboratories) supplemented with 10% fetal bovine serum (Sciencell Research Laboratories), and all cell lines were cultured at 37°C in an environment containing 5% CO2.
Reverse transcription and quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA of the cell lines was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA). The cDNA was reverse transcribed from the extracted RNA after removal of genomic DNA using a PrimeScriptTM RT kit (Takara Bio, Shiga, Japan). The qRT-PCR was performed using an Applied Biosystems 7500 Real Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) using a SYBR Green PCR Master Mix (Takara) under the following conditions. The initial activation step was performed for 30 s at 95°C for 40 cycles, denaturation at 94°C for 5 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s. GAPDH was used as an internal control. MiRNA was reverse transcribed using the miDETECT A TrackTM miRNA RT kit (Ribobio, Guangzhou, China) based on the polyA tailing method. Quantitative RT-PCR was performed using the Applied Biosystems 7500 Real Time PCR System (Thermo Fisher Scientific), using the miDETECT A TrackTM miRNA 2X SYBR Green PCR Master Mix (Ribobio) under the following conditions: an initial activation step of 95°C for 30 s, 40 cycles, denaturation at 94°C for 5 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s. U6 was used as an internal control. The qPCR was repeated three times. Data were analyzed using the 2-ΔΔCT method. The primers for amplification of each gene and its internal reference gene are shown in Table 2.
Table 2 Primer sequences used for quantitative RT-PCR
Primers
|
Sequence (5'-3')
|
SNHG1
RRAS2
GAPDH
miR-128-3p
U6
|
F*: CCCAGACTTTGCTGCCTTTCTTACA
R#: AGAGGAACAGACACGAAGTGGAGTT
F: TAAAGGATCGTGATGAGTTCCCA
R: AATTTCCTGATAACCCGGACAAG
F: GCACCGTCAAGGCTGAGAAC
R: TGGTGAAGACGCCAGTGGA
F: GTTGGATTCGGGGCCGTAG
R: AAGCAGCTGAAAAAGAGACCG
F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCG
|
Western blot analysis Cells were lysed on ice with RIPA buffer containing 1% protease inhibitor, followed by extraction of total protein. The concentration of total protein was determined using a BCA kit (Solarbio, Beijing, China) and adjusted to an acceptable concentration. Total proteins were then separated by 10% (SDS-PAGE) (Solarbio) and then transferred to polyvinylidene difluoride membranes. Membranes were incubated with 5% skim milk (Solarbio) for 2 h, and then N-cadherin (1:1,000), E-cadherin (1:1,000), vimentin (1:1,000), and β-Actin primary antibodies (1:1,000) were added and incubated at 4°C overnight. The membranes were then washed to remove the primary antibody, and then horseradish peroxidase-labeled goat anti-rabbit secondary antibody (1:2,000) was added and incubated for 1 h at 25°C. Antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). Chemiluminescence was detected using an electrochemiluminescence kit (Calan Biotechnology, Shanghai, China) and a Bio-Rad ChemiDoc MP imaging system (Yihui Biotechnology, Shanghai, China). Grayscale values were analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA).
Vector construction and cell transfection All transfections were performed in A172 and U251 cells. Three targeted inhibited SNHG1 RNAs, three targeted inhibited RRAS2 RNAs, and negative control RNA were purchased from GenePharma (Shanghai, China). MiR-128-3p mimics and miR-NC were synthesized by RiboBio. A172 and U251 cells were inoculated into 6-well plates the day before transfection, ensuring a cell density of 30%−50% for the next day of transfection. Transfections were performed according to the Lipofectamine 2000 (Invitrogen) manufacturer’s instructions. Then, glioblastoma cells were cultured in DMEM medium containing 10% FBS for 24−48 h. Finally, the cells were collected and transfection efficiency was determined by the quantitative real-time polymerase chain reaction (qRT PCR) or western blot analysis.
Transwell migration and invasion assays To assess the migration and invasion potential of cells, we used 8 μm pore size Transwell chambers (Corning, Corning, NY, USA). The Transwell chambers were covered or uncovered with 50 μL Matrigel (1:10 dilution; BD Biosciences, San Jose, CA, USA). The transfected cells were harvested and dissociated into single cell suspensions. Next, approximately 50,000 cells in 100 µL of serum-free medium were added to the upper chamber, and 500 μL of medium containing 20% FBS was added to the lower chamber. After 24 h of incubation, the cells above the membrane were removed, and the cells that penetrated the membrane were fixed with methanol plus acetone and stained with 1% Crystal Violet. Cells that underwent migration or invasion were counted using at least three randomly selected microscope fields.
Luciferase reporter assay The SNHG1 fragment containing the miR-128-3p binding site was cloned into the downstream site of the pmiR-RB-ReportTM dual luciferase miRNA target gene and the 3ʹ-UTR plasmid vector Renilla luciferase (hRlc) gene to construct the SNHG1 wild type reporter vector (SNHG1 Wt:UUGUGUGUGAUAGCACUGUGG). Similarly, the corresponding mutant with the miR-128-3p binding site was synthesized to construct the SNHG1 mutantreporter vector (SNHG1 Mut: UUGUGUGUGAUAGGUGACACG). The dual luciferase reporter plasmids of WT-SNHG1 or MUT-SNHG1 and miR-NC or miR-128-3p mimics were then co-transfected into A172 and U251 cells using Lipofectamine 2000 (Invitrogen). At a total of 24 h after transfection, the relative luciferase activity was measured using a dual luciferase reporter kit (Promega, Milwaukee, WI, USA). Relative luciferase activity was expressed as the ratio of Renilla luciferase activity to firefly luciferase activity.
Statistical analysis GraphPad Prism 8.0 (GraphPad Software, La Jolla, CA, USA) was used to analyze the data and for graphing. Data are shown as the mean ± standard deviation (SD) of at least three independent experiments, and were analyzed using a two-tailed, unpaired Student’s t-test. A value of p < 0.05 was considered a significant difference. The values of p < 0.05, p < 0.01, and p < 0.001 are indicated by *, **, and ***, respectively, in the figures.