Subjects and clinical samples
The subjects of this study include four members of a family with Amsterdam II criteria [17]. These criteria are usually used to screen at-risk families for LS including: Three or more affected members with histologically confirmed CRC or other LS-associated cancers such as endometrium, small intestine, stomach, urinary tract, skin, brain, and breast, one of whom being a first-degree relative of the other two; familial adenomatous polyposis should be excluded; two or more successive generations are affected, and at least one affected members was diagnosed before 50 years old. In our study, there were at least five cancer-affected members in three successive generations of the family of whom three patients were affected by CRC. (Fig. 1)
The index case was a 40-year-old woman (38 years at diagnosis) whose tumor was located in sigmoid.
We used genomic DNA extracted from formalin-fixed paraffin-embedded (FFPE) tissue for MSI testing and IHC staining. The genomic DNA extracted from peripheral blood was also used for the targeted Next Generation Sequencing (NGS).
Molecular Studies
MSI testing and IHC staining of MMR proteins were simultaneously used to screen the proband at risk for Lynch syndrome.
Microsatellite Instability testing
A commercial kit from Promega (MSI Analysis System, Version 1.2) was used for MSI testing including five standard quasimonomorphic markers to detect MSI and two pentanucleotide markers to identify tissue mix up. The amplified DNA products of a multiplex fluorescent PCR on extracted DNA of both tumor and healthy tissue were analyzed in a fragment analysis process using Applied Biosystems 3130 Genetic Analyzer. Comparison of obtained signals for each marker in a tumor tissue with its adjacent normal tissue was applied to explore MSI. Therefore, observing instability in at least two of the five mononucleotide microsatellite markers, MSI-H (high) confirmed MMR deficient status.
Immunohistochemistry
MMR proteins (MLH1, MSH2, PMS2, and MSH6) were used as mouse monoclonal primary antibodiesin IHC staining (Leica Biosystems: Novocastra, UK).
A FFPE tissue block was used from resected bowel specimen included tumoral and adjacent healthy mucosa. At-least four slides were provided to evaluate four MMR proteins. The incubation with Protein Block reagent, primary antibodies, and post-primary block reagent was done, respectively, according to IHC guideline specific for each immunologic product. The slides should be washed for a short moment in each step using TBS with gentle rocking. Then the induction of peroxidase activity was done with DAB working solution for some minutes. Counterstaining of the slides with Hematoxylin and finally dehydrating, clearing and mounting of them were the last step before microscopic observation. Since MMR genes are located in the nucleus, nuclear staining would be absent in the MMR deficiency. Due to the association of PMS2 and MSH6 proteins (accessory MMR proteins) to MLH1 and MSH2 proteins (main MMR proteins), IHC absence of MLH1 could indicate deficiency in each of MLH1 and PMS2 proteins. While IHC absence of PMS2, MSH2, and MSH6 would only indicate deficiency in the related proteins.
Next Generation DNA Sequencing
After initial sample quality control (QC) according to Illumina's library guideline [18], Otogenetics (Norcross, GA, USA) CRC targeted panel (Oto-ColoCa) that approximately captures 30kbp DNA involving 11 genes (APC, MLH1, MSH2, MSH6, TP53, CDKN2A, PTEN, MUTYH, BMPR1A, SMAD4 and STK11) was performed followed NGS using the HiSeq2000 (Illumina, USA) platform. Enriched DNA was sequenced using a 2*100 bp, paired-end read strategy and average on-target coverage was 100x.
Bioinformatics analysis
The raw sequencing reads obtained from NGS were filtered to remove the low-quality reads with more than 10% of uncalled bases, appending the N bases at the end of reads, and removing every chimera with more than 15 bases matched to the primer sequences. Then the qualified reads were mapped to human genome (hg19) by BWA v0.7.12 [19]. Moreover, the single nucleotide variants (SNVs) and short insertions/deletions (indels) were called using Genome Analysis Toolkit (GATK v 3.4–46)[20]. The filtration of SNVs and indels was performed according to the GATK best practice pipeline. For confirmation of that all of the intended genes have been captured by NGS, the Integrative Genomics Viewer (IGV 2.6x) was used for analysis of BAM files. Variant annotation regarding to the functional effects was fulfilled by ANNOVAR and snpEff software [21, 22]. All of the variant filtered against the Minor Allele Frequency (MAF) of 1% to rule out the potential polymorphisms according to the annotation that were based on the 1000 Genome [23], The Genome Aggregation Database (gnomAD) [24], and The Exome Aggregation Consortium (ExAC) population databases [25]. Homozygous variants were also excluded because the inheritance pattern of the lynch syndrome is dominant. Since the loss of function (LOF) of the genes is the main reason of the hereditary cancer like LS [26], our investigation in the variants started from those variants (frameshifts, stop codon, initiation codon, and critical splice site regions) resulting in the null proteins. The prediction of splice site variants was made with Human Splicing Finder [27]. Further investigations, if needed, are preceded with missense variants using computational tools including mutation taster [28], mutation assessor [29], SIFT [30], and polyphen-2 [31] for determining the damaging probability of them. Finally, the identified variants pathogenicity can be interpreted according to ACMG 2015 standards and guidelines for the interpretation of sequence variants [32].
Co-segregation Analysis by PCR-Sanger Sequencing
Rather than the proband, her three first degree members were also investigated for the existence of the identified pathogenic variant. They include her father, as an affected member with CRC, and two her healthy sisters. Co-segregation analysis was carried out by PCR-Sanger sequencing of genomic DNA extracted from peripheral blood of the cases. The forward (GCATGAAGTCCAGCTAATACAG) and reverse (GCTATTAAAGTGTCTCAAACCA) primers were designed to amplify the DNA fragment that included the identified variant. The PCR program was set up as 95°C for 5 min (1 cycle), 94°C for 30 s, 58°C for 30 s, and 72°C for 20 s (30 cycles), and the final extension at 72°C for 1 min. The PCR products were analyzed in 2% gel agarose electrophoresis. After PCR reaction, the amplicon was run on 2 % agarose gel to confirm the size 357 bp. Sanger sequencing was done by Applied Biosystems 3130xl Genetic Analyzer, 16-capillary electrophoresis.