Atropine can induce autophagy independent of the M3 muscarinic acetylcholine receptor

doi:10.21203/rs.3.rs-1595102/v1

Download PDF

Research Article

Atropine can induce autophagy independent of the M3 muscarinic acetylcholine receptor

https://doi.org/10.21203/rs.3.rs-1595102/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Atropine is a well-known muscarinic acetylcholine receptor (mAchR) antagonist; it has been used widely in medicine in that role. Autophagy plays an important role in many physiological processes. In this study, human renal epithelium (293T) cells were treated with different physiological regulators. It was found that atropine could significantly induce the conversion of autophagy marker protein microtubule-associated protein light chain (LC3) I to LC3II. In addition, atropine induced autophagosome levels in a dose-dependent manner within a certain concentration range. In cells treated with atropine, GFP-LC3 proteins accumulated as green foci, while GFP-LC3 had a diffuse distribution in mock control cells, further demonstrating atropine-induced autophagy in 293T cells. In atropine-treated mouse skeletal muscle (C2C12) cells containing nicotinic acetylcholine receptors and rat cardiac muscle (H9c2) cells containing mAchR, it was found that atropine induced autophagy in C2C12 cells but not in H9c2 cells. Atropine did not induce autophagy in tissue cells containing mAchR in vivo but did in tissue cells not containing mAchR. Therefore, atropine can induce autophagy by binding to other unknown receptors.

autophagy

atropine

acetylcholine receptor

Autophagy is a catabolic process that captures and degrades damaged proteins and organelles in lysosomes. This mechanism may be caused by cell physiological stressors, including hypoxia, hunger, endoplasmic reticulum stress, metabolic stress, lack of nutrition or extremely low pH[1, 2]. It has been reported that ghrelin promotes autophagy in pancreatic β cells under high glucose and high lipid (HGHL) conditions, and further protects pancreatic β cells from HGHL damage[3]. Glucocorticoids can accelerate chondrocyte aging and promote autophagy, which may have a compensatory effect on the protection of cell aging[4]. Wang et al.[5] found that progesterone, acting on endometrial cancer (Ishikawa) cells, can induce cancer cell autophagy and inhibit cancer cell proliferation.

Atropine is as an anti-muscarinic drug, and its enhanced parasympathetic nerve suppression promotes sympathetic nerve stimulation by competitively inhibiting the vagus nerve and postganglionic acetylcholine receptors, leading to increased cardiac output and other related antimuscarinic side effects[6]. Due to its fast onset and short half-life, atropine can be used for parenteral emergency during anesthesia, including cardiac arrhythmia, to prevent vagal reflexes, reduce secretions, acute bronchospasm, and anticholinesterase overdose or poisoning[7]. Atropine has been used in medicine widely, and apart from its role as a muscarinic acetylcholine receptor (mAChR) antagonist, no other effects of this molecule have been found. It has been reported that atropine inhibits epilepsy-induced autophagy by antagonizing mAChR[8, 9],while we have previously found that atropine may induce autophagy in cells that do not express mAChR. In this study, we tried to investigate the effect of atropine on autophagy in the presence or absence of mAChR and provide a theoretical basis for the development and application of atropine.

2.1 Autophagy is triggered by atropine in 293T cells

Microtubule-associated protein light chain (LC3) is a marker protein of autophagy. When autophagosomes are formed, free LC3I is modified by PE into lipid LC3II; as such, LC3II expression can be assessed as a proxy for measuring the accumulation of autophagosomes. The 293T cell line does not contain active acetylcholine receptors (AChR). Equal concentrations of epinephrine, insulin, atropine, neostigmine, furosemide, or posterior pituitary hormones were used to treat 293T cells for 24 h; the results revealed that the conversion of LC3I to LC3II in the cells treated with atropine was significantly higher than that in the other drug-treated groups (Fig. 1A,B). This result indicated that atropine may induce autophagy in 293T cells. Next, 293T cells were treated with different concentrations of atropine to further confirm its effect on autophagy. The results showed that atropine induced autophagosome formation in a dose-dependent manner within a certain concentration range. At concentrations less than 0.005 mg/mL, atropine no longer affected autophagy (Fig. 1C,D).

LC3I is diffusely distributed in the cytoplasm, while LC3II aggregates on the autophagosome membrane and shows a punctate distribution in the cytoplasm. To confirm the above observations, 293T cells were transfected with a GFP-LC3 plasmid that expressed green fluorescent and LC3 proteins for 24 h, and then treated with atropine for 24 h. Rapamycin was used as a positive control. In atropine treatment cells, GFP-LC3 proteins accumulated as green foci, while GFP-LC3 had a diffuse distribution in mock control cells (Fig. 1E). These results further show that atropine induces autophagy in 293T cells.

C2C12 cells express nicotinic acetylcholine receptors (nAChR), and do not express mAChR. In order to further analyze the autophagy effect of atropine-induced cells, C2C12 cells were treated by atropine. The results showed that the conversion of LC3I to LC3II in the cells treated with atropine was significantly higher than that in mock control groups (Fig. 2A,B). To detect autophagosomes and confirm other observations, C2C12 cells were transfected with a GFP-LC3 plasmid that that expressed a GFP-LC3 fusion protein green fluorescent and LC3 proteins for 24 h, and then treated with atropine for 24 h, with rapamycin as a positive control. In atropine-treated cells, GFP-LC3 proteins accumulated as green foci, while GFP-LC3 had a diffuse distribution in mock control cells (Fig. 1C). These results further show that atropine induces autophagy in C2C12 cells.

2.3 Atropine does not induce autophagy in H9c2 cells

To explore whether the effect of atropine-induced autophagy depends on the antagonism of acetylcholine receptors, atropine treatment of rat cardiomyocyte (H9c2) cells resulted in expressed m3AChR, demonstrating that atropine did not cause the conversion of LC3Ⅰ to LC3Ⅱ in H9c2 cells (Fig. 3A,B).

In order to clarify further the relationship between the effect of atropine on autophagy and m3AChR, silencing of m3AChR gene was undertaken using siRNA targeting m3AChR in H9c2 cells. SiRNA-1 and siRNA-3 in the designed and synthesized three pairs of siRNAs significantly inhibited the expression of m3AChR. The results showed that atropine significantly induced autophagy in m3AChR-silenced cells. Therefore, the effect of atropine on autophagy in vitro is independent of the antagonism of m3AChR.

2.4 Effect of atropine on autophagy in vivo

In order to verify the effect of atropine in inducing autophagy in vivo, 7-week-old mice were intraperitoneally injected with atropine at a concentration of 0.01 mg/mL each day. After 14 days of treatment, the mice were euthanized and the hippocampus, heart, liver, spleen, tibialis anterior muscle and smooth muscle were obtained to analyze the conversion of LC3Ⅰ to LC3Ⅱ. The results showed that atropine did not change autophagy levels in the hippocampus, smooth muscle, and heart, which express mAChR; in contrast, it induced the conversion of LC3Ⅰ to LC3Ⅱ in the liver, spleen, and tibialis anterior, which do not express mAChR. This further revealed that atropine-induced autophagy acts on other pathways rather than antagonizing mAChR.

Autophagy is widely involved in various physiological activities such as metabolism and immune response, and plays a dual role in the occurrence and development of various neurodegenerative diseases (such as Alzheimer's, Huntington's and Parkinson's)[10]; furthermore, it may play a protective role in the body under certain conditions. It also accelerates the deterioration of these diseases to varying degrees[11]. Similarly, many different physiological processes also regulate the formation of autophagy[12–14]. In this study, 293T cells were treated with different physiological regulators; because it was found that atropine significantly induced the conversion of LC3I to LC3II, it can be speculated that atropine may induce autophagy.

Atropine has a rapid onset of action and short half-life, and can be used during anesthesia for parenteral rescue, including cardiac arrhythmias, and for prevention of vagal reflexes, reduction of secretions, acute bronchospasm, and anticholinesterase overdose or poisoning[6]. However, no other effects of atropine other than as an antagonist of mAChR have been found. Karla et al.[15] found that increasing the binding affinity of acetylcholine to mAChR enhanced autophagy in mouse myocardial tissue. Nair[16] reported that mAChRs were involved in acetylcholine-induced autophagy to provide protection for cardiomyocytes during cardiomyocyte hypoxia/reoxygenation injury, and that mAchRs promoted Ach-induced autophagy via AMPK-mTOR-dependent pathway. In this study, atropine induced autophagosome levels in a dose-dependent manner within a certain concentration range above 0.005 mg/mL, below which it no longer affected autophagy. In atropine-treated cells, GFP-LC3 proteins accumulated as green foci, whereas GFP-LC3 had a diffuse distribution in mock control cells. These results further show that atropine induces autophagy in 293T cells. Since 293T cells do not contain active acetylcholine receptors, the effect of atropine on autophagy in 293T cells may not be dependent on the action of mAchR.

It was found that atropine induced autophagy in C2C12 cells but not in H9c2 cells, which contain nAChR and mAChR, respectively. Therefore, in this study, the effect of atropine treatment on autophagy in vitro was not dependent on the inhibition of mAChR. Similarly, in vivo experiments also showed that atropine did not induce autophagy in tissue cells which expressed mAChR.

In mAChR-expressing cells, atropine preferentially binds to mAChR but does not induce subsequent responses to autophagy, and its inability to bind to other related receptors also results in the inability to induce autophagy. Therefore, although, atropine can induce autophagy as an antagonist of mAChR by binding to other receptors, more research is needed to explore other receptors for atropine-induced autophagy.

4.1 Cells

Cells from the human kidney epithelial (293T) cell line, the mouse skeletal muscle (C2C12) cell line, and the rat cardiac muscle (H9c2) cell line were cultured at 37°C in 5% CO₂ in Dulbecco’s modified Eagle’s medium (Gibco, Grand Island, NY,USA) supplemented with 5% fetal bovine serum (Gibco), 100 U/mL penicillin, and 100 U/mL streptomycin.

4.2 RNA interference of m3AchR

In order to explore whether the effect of atropine on autophagy depends on the antagonism of atropine, the expression of mAchR in H9C2 cells was silenced using small interfering RNA (siRNA) targeting the rat m3AChR gene (GenePharma, Shanghai,China). The sequence of si-m3AChR-1 was AGACAGUUAACAACUACUACC(sense) andUAGUAGUUGUUAACUGUCUUG (antisense); the sequence of si-m3AchR-2 was AGCUCAAGACAGUUAACAACU (sense) and UUGUUAACUGUCUUGAGCUGA (antisense); the sequence of si-m3AchR-3 was AGCUCAAGACAGUUAACAACU (sense) and UUAACUGUCUUGAGCUGACUG (antisense). Six-well plates were transfected with siRNAs and negative control RNA (siNC) using transfection reagent for 24 hours and then treated with atropine. Cell samples were collected at 48 hours to test the silencing effect and autophagy levels.

4.3 Drug treatment

Epinephrine, insulin, atropine, neostigmine, furosemide, and posterior pituitary hormone (Hefeng Pharmaceutical Co., Ltd,Shang hai,China), all at concentrations of 0.5 mg/mL, were used to treat 293T cells in six-well culture plates for 24 h. Cells were then collected and lysed to obtain protein samples and analyze the conversion of LC3I to LC3II. Atropine, at concentrations of 0.0005 mg/mL, 0.005 mg/mL, 0.01 mg/mL, and 0.5 mg/mL, was used to treat 293T cells in six-well culture plates for 24 h to analyze the conversion of LC3I to LC3II. Furthermore, 200 nM of rapamycin was used to treat C2C12 cells and H9c2 cells in six-well culture plates for 2–4 h as a control.

4.4 In vivo experiments

Twenty 7-week-old Kunming mice (KM)mice were divided into an atropine group and a phosphate-buffered saline (PBS) group, raised under the same conditions of food and water supply in the same temperature environment. Sterile 1× PBS and atropine at a concentration of 0.5 mg/mL were injected intraperitoneally in their respective groups at a dose of 10 µL per 1 g body weight every day for 14 days. Mice were euthanized and their hippocampal tissue and smooth muscle tissue were lysed to obtain protein samples, and the levels of LC3 protein expressed in these two tissues were measured.

4.5 Western blotting

Proteins from drug- or siRNA-treated cells in six-well cultures was extracted using radioimmunoprecipitation assay lysis buffer (Beyotime, Jiangsu, China) with protease inhibitor PMSF (Beyotime). Lysed cells were centrifuged for 10 min at 12,000 gand 4°C and the supernatant was collected for analysis. For the western blot analysis, lysate proteins (30–50 µg) were resolved using 15% SDS-PAGE and transferred onto nitrocellulose transfer membranes. Membranes were blocked with 1% BSA (Sigma) for 2 h at 37°C and incubated with primary antibody for 2 h at room temperature with rabbit anti-LC3B (Sigma-Aldrich Corporation, St. Louis, MO, USA) and mouse anti-b-actin (Sigma). Membranes were treated with IRDye 800 CW goat anti-mouse IgG (LI-COR Biosciences) or goat anti-rabbit IgG (LI-COR Biosciences) as secondary antibodies for 1 h at room temperature. For detection, an Odyssey Infrared Fluorescence Scanning Imaging System (LI-COR Biosciences) was used.

4.6 Laser confocal microscopy

For detection of autophagosomes, 293T or C2C12 cells were transfected with 2.5 µg GFP-LC3 plasmid. When cells were 70–80% confluent in 20 mm-diameter culture dishes, and 24 h after treatment with 0.5 mg/mL of atropine, they were washed with PBS, fixed with absolute ethanol for 30 min, and the cell nuclei were stained with DAPI (Beyotime). Green fluorescence dots of GFP-LC3 were observed by confocal laser with a Leica SP2 confocal system (Leica Microsystems).

4.7 Statistical analysis

All experiments were performed at least three times and the data are presented as the mean ± SD. The statistical data analysis was performed using one-way ANOVA. P < 0.05 was considered to represent a statistically significant difference.

Funding:This research was funded by the Heilongjiang Province Education Department Fundamental Scientific Research Funds, grant number 135409504.

Conflicts of Interest: The authors declare no conflict of interest.

Author Contributions: Conceptualization, Hai-chang Yin and Tian-fei Yu ; methodology, Xin Liu; software, Xin-jie Jiang; validation, Xin-jie Jiang and Na-na Yi; formal analysis, X.X.; writing—original draft preparation, Xin Liu.; writing—review and editing, Xin-jie Jiang and Tian-fei Yu ;funding acquisition, Hai-chang Yin.All authors have read and agreed to the published version of the manuscript.”

Data Availability Statement: Not applicable.

Ethics approval: The study was approved by Qiqihar University and was conducted according to animal ethics guidelines and approved protocols.

Consent to participate: Not applicable.

Consent to publish: Not applicable

Kroemer G, Piacentini M (2015) Dying to survive - apoptosis, necroptosis, autophagy as supreme experiments of nature. Int J Dev Biol 59 (1–3):5–9. doi:10.1387/ijdb.150167mp
Levine B, Klionsky DJ (2017) Autophagy wins the 2016 Nobel Prize in Physiology or Medicine: Breakthroughs in baker's yeast fuel advances in biomedical research. Proc Natl Acad Sci U S A 114 (2):201–205. doi:10.1073/pnas.1619876114
He C, Zheng X, Lin X, Chen X, Shen C (2020) Yunvjian-Medicated Serum Protects INS-1 Cells against Glucolipotoxicity-Induced Apoptosis through Autophagic Flux Modulation. Evid Based Complement Alternat Med 2020:8878259. doi:10.1155/2020/8878259
Chen W, Zheng H, Zhang X, Xu Y, Fu Z, Ji X, Wei C, An G, Tan M, Zhou M (2022) Columbianetin alleviates lipopolysaccharides (LPS)-induced inflammation and apoptosis in chondrocyte through activation of autophagy by inhibiting serum and glucocorticoid-induced protein kinase 1 (SGK1) expression. Bioengineered 13 (2):4051–4062. doi:10.1080/21655979.2022.2032970
Fukuda T, Wada-Hiraike O (2022) The Two-Faced Role of Autophagy in Endometrial Cancer. Front Cell Dev Biol 10:839416. doi:10.3389/fcell.2022.839416
Sander BP (2021) Prevention of Choroidal Thinning by 0.01% Atropine Administered 24 h Before Exposure to Hyperopic Blur in Young Myopes. J Ocul Pharmacol Ther 37 (9):510–517. doi:10.1089/jop.2021.0006
Wang W, Chen QF, Ruan HL, Chen K, Chen B, Wen JM (2014) Can anisodamine be a potential substitute for high-dose atropine in cases of organophosphate poisoning? Hum Exp Toxicol 33 (11):1186–1190. doi:10.1177/0960327114532382
Prathumsap N, Ongnok B, Khuanjing T, Arinno A, Maneechote C, Apaijai N, Chunchai T, Arunsak B, Shinlapawittayatorn K, Chattipakorn SC, Chattipakorn N (2022) Acetylcholine receptor agonists provide cardioprotection in doxorubicin-induced cardiotoxicity via modulating muscarinic M2 and alpha7 nicotinic receptor expression. Transl Res 243:33–51. doi:10.1016/j.trsl.2021.12.005
Li Z, Li X, Zhu Y, Chen Q, Li B, Zhang F (2020) Protective effects of acetylcholine on hypoxia-induced endothelial-to-mesenchymal transition in human cardiac microvascular endothelial cells. Mol Cell Biochem 473 (1–2):101–110. doi:10.1007/s11010-020-03811-w
Deng Z, Purtell K, Lachance V, Wold MS, Chen S, Yue Z (2017) Autophagy Receptors and Neurodegenerative Diseases. Trends Cell Biol 27 (7):491–504. doi:10.1016/j.tcb.2017.01.001
Klionsky DJ, Petroni G, Amaravadi RK, Baehrecke EH, Ballabio A, Boya P, Bravo-San Pedro JM, Cadwell K, Cecconi F, Choi AMK, Choi ME, Chu CT, Codogno P, Colombo MI, Cuervo AM, Deretic V, Dikic I, Elazar Z, Eskelinen EL, Fimia GM, Gewirtz DA, Green DR, Hansen M, Jaattela M, Johansen T, Juhasz G, Karantza V, Kraft C, Kroemer G, Ktistakis NT, Kumar S, Lopez-Otin C, Macleod KF, Madeo F, Martinez J, Melendez A, Mizushima N, Munz C, Penninger JM, Perera RM, Piacentini M, Reggiori F, Rubinsztein DC, Ryan KM, Sadoshima J, Santambrogio L, Scorrano L, Simon HU, Simon AK, Simonsen A, Stolz A, Tavernarakis N, Tooze SA, Yoshimori T, Yuan J, Yue Z, Zhong Q, Galluzzi L, Pietrocola F (2021) Autophagy in major human diseases. EMBO J 40 (19):e108863. doi:10.15252/embj.2021108863
Sarkar S (2013) Regulation of autophagy by mTOR-dependent and mTOR-independent pathways: autophagy dysfunction in neurodegenerative diseases and therapeutic application of autophagy enhancers. Biochem Soc Trans 41 (5):1103–1130. doi:10.1042/BST20130134
Luo L, Qin ZH (2019) Autophagy, Aging, and Longevity. Adv Exp Med Biol 1206:509–525. doi:10.1007/978-981-15-0602-4_24
Zhao S, Wang H (2021) EVA1A Plays an Important Role by Regulating Autophagy in Physiological and Pathological Processes. Int J Mol Sci 22 (12). doi:10.3390/ijms22126181
Ribeiro KC, Campelo RP, Rodrigues D, Mattos EC, Brandao IT, da Silva CL, Bouskela E, Martinez CG, Kurtenbach E (2018) Immunization with plasmids encoding M2 acetylcholine muscarinic receptor epitopes impairs cardiac function in mice and induces autophagy in the myocardium. Autoimmunity 51 (5):245–257. doi:10.1080/08916934.2018.1514389
Zhao M, Sun L, Yu XJ, Miao Y, Liu JJ, Wang H, Ren J, Zang WJ (2013) Acetylcholine mediates AMPK-dependent autophagic cytoprotection in H9c2 cells during hypoxia/reoxygenation injury. Cell Physiol Biochem 32 (3):601–613. doi:10.1159/000354464

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Atropine can induce autophagy independent of the M3 muscarinic acetylcholine receptor

Status:

Version 1

Abstract

Figures

1. Introduction

2. Results

2.1 Autophagy is triggered by atropine in 293T cells

2.3 Atropine does not induce autophagy in H9c2 cells

2.4 Effect of atropine on autophagy in vivo

3. Discussion

4. Materials And Methods

4.1 Cells

4.2 RNA interference of m3AchR

4.3 Drug treatment

4.4 In vivo experiments

4.5 Western blotting

4.6 Laser confocal microscopy

4.7 Statistical analysis

Declarations

References

Additional Declarations

Status:

Version 1