Cloning, characterization of TaGS3 gene and identification of allelic variation associated with kernel traits in wheat (Triticum aestivum L.)

doi:10.21203/rs.2.10635/v1

Download PDF

Research article

Cloning, characterization of TaGS3 gene and identification of allelic variation associated with kernel traits in wheat (Triticum aestivum L.)

https://doi.org/10.21203/rs.2.10635/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 18 Dec, 2019

Read the published version in BMC Genetics →

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Background

Grain weight is an important yield component. Selection of heavy grain wheat showed big grain sink-potentials and strong sink activity, which was becoming an important objective during the breeding program. Rice OsGS3 gene has been identified as a major QTL for both grain weight and grain size. However, allelic variation of GS3 gene has not been characterized in wheat.

Results

Here we isolated 2445bp, 2393bp and 2409bp genomic sequences of TaGS3-4A, TaGS3-7A and TaGS3-7D genes in Changzhi 6406 with high grain weight value by homologous cloning. All TaGS3 gene showed five exon and four intron and encoding putative 170, 169 and 169 amino acids. Phylogenetic analysis revealed that GS3 was a monocot-specific gene and all GS3 protein were split into three classes. The length of the atypical Gγ domain and the cysteine-rich region was conserved within class and nonconserved inter-class. An SNP at the fifth exon (position of 1907) of TaGS3-7A gene would lead to amino acid change (ALA/THR) and showed different frequency in two pools with different grain weight. Further association analysis indicated that TaGS3-7A-A allele was associated with higher grain weight in the natural population.

Conclusions

These results providing some useful variants and a functional marker for further marker assistant breeding.

Plant Molecular Biology and Genetics

TaGS3

kernel traits

phylogenetic tree

functional marker

Wheat provides over 20 % of the calories in the human diet and 25 % of the protein (FAOSTAT Faostat.fao.org/site/339/default.aspx and www.fao.org/worldfoodsituation/wfs-home/csdben). With the increase of population size, climate change and reduction of available land, gains yield with ~2% annually of crop must increase to meet food insecurity [1]. The grain yield of wheat and cereals is a polygenic trait that is influenced by environmental and genetic interactions at all stages of the plant’s growth [2].

In rice, genes controlling grain weight have been extensively studied [3, 4]. Grain Size 3 (GS3) encoding a transmembrane protein containing an atypical Gγ domain and a cysteine-rich region, was the first characterized QTL that negatively regulates grain length [5, 6]. A C-A mutation in the second exon of GS3 (A allele) was associated with enhanced grain length in Oryza sativa but was absent from other Oryza species [7]. Pyramiding GL3.3 (Grain Length 3.3) and GW7 (Grain Width 7) could enhance yield in indica hybrid rice background with simultaneously improved yield and grain quality [8]. Grain Size 5 (GS5) encodes a putative serine carboxypeptidase and functions as a positive regulator of grain size and yield [9]. Natural variation analysis indicated that mutation was associated with enhanced grain length [7]. Grain width 5 (GW5) encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus that affects grain width [10]. The 1212-bp deletion in Nipponbare was selected during japonica domestication, which functions most likely through influencing the expression levels of OsGW5. GW5 protein is localized to the plasma membrane and can physically interact with and repress the kinase activity of rice GSK2, resulting in accumulation of unphosphorylated OsBZR1 and DLT [11]. A recent reported gene GLW7 (GRAIN LENGTH AND WEIGHT ON CHROMOSOME 7) also showed differential expression level in regulating grain weight by allelic variation at 5’UTR [12]. Others, Grain Width 6 (GW6) encodes a GNAT-like protein that harbors intrinsic histone acetyltransferase activity, and an elevated expression enhances grain length and weight by enlarging spikelet hulls and accelerating grain filling [13]. Grain Width 2 (GW2) encodes a previously unknown RING-type protein with E3 ubiquitin ligase, which negatively regulates cell division by degrading its substrate(s) through the ubiquitin-proteasome pathway [14]. DA2 (orthologous to GW2) was an E3 ubiquitin ligase physically interacts with DA1 in vitro and in vivo in Arabidopsis [15]. Grain Length 3 (GL3) encodes a protein phosphatase kelch (PPKL) family- Ser/Thr phosphatase, which was epistatically interacts with GS3 and OsGSK3 to modulate brassinosteroid signaling to produce extra-long grains in rice. [16-18]. The The Kelch domains are essential for the OsPPKL1 (GL3) biological function [19]. DENSE AND ERECT PANICLE1 (DEP 1) encoded a encoding a highly cysteine-rich G protein gamma subunit protein. Gain-of-function mutation enhance meristematic activity, resulting in a reduced length of the inflorescence internode, an increased number of grains per panicle and a consequent increase in grain yield. [20, 21]

In wheat, large genome size and sophisticated genome composition made it difficult for map-based cloning functional genes, especially for complex traits. However, wheat-rice close relationship provided a basic tool for researchers to homologous cloning functional genes with a common ancestor, for develop-related traits in particular [22-24]. Based on this theory, some grain weight-related genes have been cloned and characterized in natural populations and/or bi-parental populations [25-30].

In wheat, TaGS3-1D has been cloned and a 40-bp indel predicted to generate new isoform that was associated with grain weight [31]. However, wheat has three sub-genome and generally D genome has the lowest genetic diversity [32, 33]. Therefore, we were interested in isolating of another two TaGS3 genes in wheat A- and B- sub-genome and detection of the functional variations in wheat improvement. For this purpose, we conducted molecular cloning of TaGS3 gene, characterization of its evolution in plants, designed genetic marker for TaGS3 gene and validated its effects in a natural population and its distribution in Chinese wheat major production areas.

Plant materials

Changzhi 6406 with higher grain weight value was used for isolated genomic sequences of three GS3 homologous genes. Moreover, ten lines divided into two pools were used for TaGS3-4A and TaGS3-7A gene cloning: first pool with high grain weight value (P-HGW) that containing Changzhi 6406, Sankecun, Shannong 7859 and Kangdingxiaomai; second pool with low grain weight value (P-LGW) that included Youmangbaifu, Dongnong 101, Gansu 96, Fuzhuang 30, Bima 4 [43].

The following 224 mini-core collection (MCC) germplasms with high genetic diversity in China were used for validated the association of genetic marker and kernel-related traits (kernel length, kernel width, kernel thickness and 1000-kernel weight) [43].

Gene isolation and analysis

TaGS3 homologous gene sequences were isolated through comparative genomics method. The rice GS3 gene sequences in rice and wheat (DQ355996, KF687956) were used to search for wheat orthologous in wheat genome though EnsemblePlants website (http://plants.ensembl.org/Triticum_aestivum/Tools/Blast?db=core). Primer sets targeted in specific region for each sequence were developed by Oligo 7 software and synthesized by Tsingke Biological Technology Co., Ltd.

PCR was performed in volumes of 30 μl, including 15 μl 2 × GC buffer I, 10 μM of dNTP, 20 μmol of each primer, 1 U of LATaq and ~100 ng of template DNA. All reagents were from Takara Biotechnology Co., Ltd. (http://www.takara.com.cn). Reaction conditions were 94 °C for 5 min, followed by 35 cycles of 94 °C for 45s, annealing at 58 °C for 45s, 72 °C for 2 min 30 s, and a final extension of 72 °C for 10 min.

PCR products were separated by electrophoresis on 2% agarose gels and all bands were cleaned and cloned into the pEASY-T5 Zero vector (Beijing TransGen Biotech Co., Ltd. http://www.transgen.com.cn) and transformed to DH5α competent E. coli cells by the heat shock method. Single Clones were sequenced in Tsingke Biotech Co., Ltd and sequence analysis (alignment and assembly) was performed using the software DNAMAN (http://www.lynnon.com).

All sequenced clones were aligned in the wheat reference genome (IWGSC v1.0) to confirm their chromosome locations.

Phylogenetic tree analysis

The rice GS3 (Os03g0407400) orthologous were searched in common higher plant (rice, maize, Arabidopsis, soybean, Sorghum and Medicago, etc). In addition, another gene OsDep1 encoded G protein was used for an out-group paralog. Alignments of the deduced amino acids sequences were done using the MEGA7.0 Built-in alignment program MUSCLE [44] and subsequently constructing of a phylogenetic tree using the neighbor-joining method, Poisson model, uniform rate and partial deletion (site coverage off 50%) analysis in MEGA, version 7.0 [45]. Robustness of the constructed phylogenetic tree was tested with 1,000 bootstrap repetitions.

SNP mining and development of a gene-specific KASP marker

SNPs cause putative amino acid change and showed different frequency in grain weight pools were used for marker development.

For KASP genotyping procedure, a 10-ul PCR mixture contained 100 ng template DNA, 5ul KASP master mix, 4mM MgCl₂ and 1.4ul primer mixture which was comprised 46 µl ddH₂O, 30 µl common primer (10 µM), and 12 µl of each tailed primer (10 µM). PCR cycling was performed using the following protocol: hot start at 95 °C for 15 min, followed by ten touchdown cycles (95 °C for 20 s; touchdown at 65 °C initially and decreasing by −1 °C per cycle for 60 s), followed by 30 additional cycles of annealing (95 °C for 10 s; 57 °C for 60 s). Then extension step (each 3 cycles of annealing: 95 °C for 10 s; 57 °C for 60 s) was used three times in order to obtain best genotyping cluster result [30, 46]. The primers were synthesized in Tsingke (Beijing) and markers were used to screen 224 mini-core collection (MCC) germplasm. The Final signal detection was applied under Bio-Rad CFX connntected PCR and allele discrimination illustrated on Bio-Rad CFXManager maestro program.

Statistical analysis

One-Way ANOVA analyses were performed on the SPSS System for Windows version 22.0 to determine grain traits differences between the two alleles at the significance level. Phenotypic data in three independent environments (E1: Luoyang at 2002; E2: Luoyang at 2005; E3: Beijing at 2010) were derived from previously study were recorded [26].

Isolation of TaGS3 gene in wheat

In wheat, three TaGS3 copies on 4AL (TraesCS4A02G474000), 7AS (TraesCS7A02G017700) and 7DS (TraesCS7D02G015000) were searched in genome database. Primers were designed based on specific regions for each sequence and hence 2445bp, 2393bp and 2409bp length PCR product for TaGS3-4A (GenBank accession: KY888174), TaGS3-7A (GenBank accession: KY888186) and TaGS3-7D (GenBank accession: KY888197) in Changzhi6406 (in P-HGW). The lengths of the predicted coding sequences of three genes were 513bp, 510bp and 510bp, encoding putative 170, 169 and 169 amino acid, respectively. TaGS3-4A, TaGS3-7A and TaGS3-7D showed similarity exon-intron structure to OsGS3, which consist of five exons and four introns (Figure 1). The similarity between the coding region of OsGS3 gene and TaGS3-4A, TaGS3-7A and TaGS3-7D was 45.92%, 43.94% and 44.87%, respectively. In parallel, the similarity of deduce amino acid were 45.26%, 44.83% and 42.24%, respectively.

Phylogenetic analysis of GS3 gene in plant

The phylogenetic tree included 14 deduced amino sequence of GS3 homologous deduced protein that obtained from Aegilops tauschii, Hordeum vulgare, Panicum hallii, Setaria italic, Triticum aestivum, Zea mays, Triticum urartu, Sorghum bicolor, Glycine max and Arabidopsis thaliana. In addition, another reported atypical Gγ domain gene DEP1 was used as peripheral group control. Total tree separated these sequences into two main groups, which were GS3 orthologous and DEP1 orthologous (Figure 2a). The GS3 orthologous group containing ten sequences which were all derived from monocotyledons, where another DEP1 group comprised of sequences in both monocotyledons and dicotyledons.

In GS3 orothologe group, each of them is congruent with the species phylogeny, excepted that the relationship between GS3 translated by GS3-7A in Triticum aestivum and wheat A sub-genome progenies Triticum urartu is further than that with GS3 in Hordeum vulgare. The similarity of the conserved domain was 85.14% overall and they showed a similar length (60-66 amino acids) excepted for that in Triticum urartu (46), whereas the length of the cysteine-rich region was various, splitting into three classes. Class I consist of triticeae plant with a conserved length of 92 to 94 (85 in Triticum urartu under exceptional); Class II included Oryza plant showed the longest of 150; Class III consists of panicoideae plant also with the conserved length of 111-116. Comparison of atypical Gγ subunit conserved domain for GS3 orthologous sequences, we found that they all possessed completely same amino acids fragment “PRP--RLQLAVDALHR--FLEGEI” (-- represented the non-conserved region and the number of “-” not match the number of amino acid).

Polymorphic of TaGS3-4A and TaGS3-7A among wheat accessions

Ten sequences for TaGS3-4A and TaGS3-7A in each accessions were obtained， respectively. In order to avoid possible false variations generated by sequence error, advanced analysis for detecting real variants was followed by minor allele frequency >0.1 (at least twice in ten sequences) and 17 and 18 variations for TaGS3-4A and TaGS3-7A, respectively. There were 3, 1, 6, 0, 3, 0, 0, 0, 0, 2 and 2 variants in 5’ upstream region, 1st exon, 1st intron, 2nd exon, 2nd intron, 3th exon, 3th intron, 4th exon, 4th intron, 5th exon and 3’ downstream region for TaGS3-4A, respectively. In parallel, 4, 0, 2, 0, 4, 0, 0, 1, 3, 3, 1 variants were found in corresponding region for TaGS3-7A, respectively (Table 2 and Table 3). Among them, both three variants causing amino acids change were determined for TaGS3-4A and TaGS3-7A, which were located at 1st exon (1), 5th exon (2) and 4th exon (1) and 5th exon (2), respectively. The variant (GC/AT) at the position of 70 for TaGS3-4A was located at atypical Gγ subunit, but GC allele was occupied for 80% and 60% in the heavy pool and light pool, indicated this allele was not associated with grain weight. Additionally, the frequency of allele A at position 1907 (amino change: ALA/THR) was 0.6 in heavy grain weight pool, competing with none in the light pool. Therefore, this allele was far more likely to be associated with grain weight in wheat.

Molecular marker design and validation

Based on SNP mining result, a KASP marker was designed for SNP at position 1907 (A/G). The calls of TaGS3-7A-A allele with potential light grain weight group were clustered at X-axis, where the calls of TaGS3-7A-G allele with potential heavy grain weight group were clustered at Y-axis (Figure 3). These cluster results clearly distinguished two alleles, which was used to validate its effects on grain weight in the natural population.

The association between genotypes and grain traits was based on 224 mini-core collection (MCC) germplasms for this marker (Table S1). Based on SNP calling result of KASP marker, a significance for kernel width, kernel weight and kernel thickness was observed for TaGS3-7A-G and TaGS3-7A-A alleles, whereas no significance for kernel length was observed (Table 3). In addition, the allele TaGS3-7A-A with superior traits with a rare frequency of 13.107%, which was significantly less than TaGS3-7A-G. However, the frequency of TaGS3-7A-A in cultivars (18.085%) was significantly more than that in landrace (0.980%).

Structure and evolution of GS3

Several genes encoded G proteins in rice have been cloned and showed various function in regulating organ development in rice [7, 21]. GS3 encoded heterotrimeric G proteins with an atypical Gγ domain, is a major QTL for grain size [5, 7]. However, the evolutionary history of GS3 in plant species has been unknown. Here, we performed a phylogenetic analysis based on protein sequence by using rice GS3 as a query and found that GS3 homologous was a monocot-specific gene family. We also found that wheat has three GS3 orthologous genes on 7AS, 7DS and 4AL based on released Chinese Spring reference genome sequence [22]. However, the relationship between TaGS3-7A and TuGS3-7A was far than that between TaGS3-7A and other Triticeae Crops, indicated that large sequence variation occurred before TaGS3-7A delivered from diploid species to polyploid species.

All GS3 orthologous gene showed a conserved atypical Gγ domain with high similarity, while the length of the cysteine-rich region was various. In particular, the length of the cysteine-rich region in triticeae species was ~60% and ~80% long of that in rice and panicoideae plant, respectively. In spite of that conserved domain usually determined the function of genes universally, the length that the C-terminal tail of could affect the degradation of GS3 protein [34]. Therefore, the evolution of GS3 leading to different length of GS3 in monocotyledons and probably fine-tune its function.

Polymorphism of GS3 gene and its association with grain weight

In this study, the isolated wheat TaGS3-4A, TaGS3-7A and TaGS3-7D gene were predicted to have five exons and four introns, which was the same with GS3 genes in rice. A large number of variations for TaGS3-7A and TaGS3-4A were detected. Only one variant located on GS3 Gγ-subunit was found in TaGS3-4A and this variant seemed to be not associated with grain weight in phenotype pool. Nevertheless, the non-conserved domain of GS3 is also positive regulate grain length in rice [35]. Some other polymorphic loci motifs of (AT)n at last intron and (TCC)n at final exon of GS3 were mainly associated with medium to short grain in Chinese rice since 13 accessions with the TGC mutation did also show long grains, which suggested that C-A mutation could not totally explain the accessions with long or short grains in Chinese rice germplasm[36]. In maize, two polymorphism in the fifth exon (not located in conserved region) and promoter region that are significantly associated with kernel length and thousand kernel weigh [37].

Therefore, another SNP located on the cysteine-rich region showed different frequency in different grain weight accessions pools was applied for marker development. This variation probably releases the Gβγ dimers from this autoinhibition thought alternation of structure of cysteine-rich region [34, 38] .

Besides, the cysteine-rich region showed various role in regulate gene function. GAST1-like proteins are involved in redox reactions via their cysteine-rich domain and mutated GASA4 in cysteines site would lost its redox activity and the ability to promote GA responses [39]. Additionally, C-terminal cysteine-rich region is sufficient for rice OsDep1 gene to confer Cd tolerance to yeast cells [20]. Combination of these studies, it was suggested that variations in the non-conserved domain of GS3 could also affect phenotype.

In previous, there was one QTL for grain weight seem to be associated with TaGS3-7D in wheat and all the variation between parental lines were found in the second intron [31]. However, sub-genome A and sub-genome B showed a wide genetic diversity compared to sub-genome D in hexaploid wheat, leading to a necessary that assessment of sequence diversity of TaGS3 and development of functional marker for further breeding [32, 40]. However, we have been found that none of QTLs for grain weight/ size was located on the terminal region of 7AS, which was probably because that varieties often carry a weak allelic variation of functional genes which could keep balance for maintaining the enhancement of grain weight and plant fitness [34, 41, 42]. However, weak variation underlying QTLs usually covered under high threshold.

Therefore, cloning of grain weight related gene and development of functional marker in wheat are necessary for us to further breeding application. No matter how the functional marker developed in this study could be potentially apply in wheat yield improvement.

In the present study, we performed homologous cloning of TaGS3 genes in hexaploid wheat, systematically studied the evolutionary of GS3 in plant species and designed a functional maker for TaGS3-7A. As the result, wheat have three TaGS3 homologous genes, and its amino acids containing a similarity atypical Gγ domain and a cysteine-rich region region showed different length with that in rice. Based on sequence comparison in two extremely phenotypic pools, a KASP marker was designed and shown to have significant genetic effects on grain weight, kernel width and kernel thickness. These results provided novel molecular information about GS3 gene and designed functional marker could be applied for genetic improvement program of wheat.

GS3: Grain shape 3

bp: Base pair

SNP: Single Nucleotide Polymorphism

QTL: Quantitative trait locus

PCR: Polymerase Chain Reaction

KASP: Kompetitive Allele Specific PCR

MEGA: Molecular Evolutionary Genetic Analysis

ALA: Alanine

THR: Threonine

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Availability of data and material

All data generated or analyzed during this study are included in this published article (and additional files). The kernel traits of mini-core collection (MCC) germplasms derived from the following public publication: Ma L, Li T, Hao C, Wang Y, Chen X, Zhang X: TaGS5-3A, a grain size gene selected during wheat improvement for larger kernel and yield. Plant Biotechnol J 2016, 14(5):1269-1280. https://doi.org/10.1111/pbi.12492.

Competing interests

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding

This research was supported by the Special Fund for Henan Agricultural Research System (S2010-01-G03).

Authors' contributions

ZL, TC, JY and QW conceived the study. JY designed the experiments. JY, YZ, WH and YC performed gene cloning, SNP mining and KASP marker design. YZ, HZ and XW conducted the phylogenetic analysis. JY and ZL wrote the manuscript. All authors read and approved the manuscript.

Acknowledgment

We gratefully acknowledge Prof Xueyong Zhang kindly providing mini-core collection (MCC) germplasms.

Lopes MS, Reynolds MP, Manes Y, Singh RP, Crossa J, Braun HJ: Genetic Yield Gains and Changes in Associated Traits of CIMMYT Spring Bread Wheat in a “Historic” Set Representing 30 Years of Breeding. Crop Sci 2012, 52(3):1123-1131.
Slafer GA: Genetic basis of yield as viewed from a crop physiologist's perspective. Ann Appl Biol 2003, 142(2):117-128.
Zuo J, Li J: Molecular genetic dissection of quantitative trait loci regulating rice grain size. Annu Rev Genet 2014, 48:99-118.
Li N, Xu R, Li Y: Molecular Networks of Seed Size Control in Plants. Annu Rev Plant Biol 2019, 70:435-463.
Fan C, Xing Y, Mao H, Lu T, Han B, Xu C, Li X, Zhang Q: GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein. Theor Appl Genet 2006, 112(6):1164-1171.
Fan C, Yu S, Wang C, Xing Y: A causal C–A mutation in the second exon of GS3 highly associated with rice grain length and validated as a functional marker. Theor Appl Genet 2009, 118(3):465-472.
Takano-Kai N, Jiang H, Kubo T, Sweeney M, Matsumoto T, Kanamori H, Padhukasahasram B, Bustamante C, Yoshimura A, Doi K et al: Evolutionary history of GS3, a gene conferring grain length in rice. Genetics 2009, 182(4):1323-1334.
Xia D, Zhou H, Liu R, Dan W, Li P, Wu B, Chen J, Wang L, Gao G, Zhang Q et al: GL3.3, a Novel QTL Encoding a GSK3/SHAGGY-like Kinase, Epistatically Interacts with GS3 to Produce Extra-long Grains in Rice. Mol Plant 2018, 11(5):754-756.
Li Y, Fan C, Xing Y, Jiang Y, Luo L, Sun L, Shao D, Xu C, Li X, Xiao J et al: Natural variation in GS5 plays an important role in regulating grain size and yield in rice. Nat Genet 2011, 43(12):1266-1269.
Weng J, Gu S, Wan X, Gao H, Guo T, Su N, Lei C, Zhang X, Cheng Z, Guo X et al: Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Res 2008, 18(12):1199-1209.
Liu J, Chen J, Zheng X, Wu F, Lin Q, Heng Y, Tian P, Cheng Z, Yu X, Zhou K et al: GW5 acts in the brassinosteroid signalling pathway to regulate grain width and weight in rice. Nature Plants 2017, 3:17043.
Si L, Chen J, Huang X, Gong H, Luo J, Hou Q, Zhou T, Lu T, Zhu J, Shangguan Y et al: OsSPL13 controls grain size in cultivated rice. Nat Genet 2016, 48:447.
Song XJ, Kuroha T, Ayano M, Furuta T, Nagai K, Komeda N, Segami S, Miura K, Ogawa D, Kamura T et al: Rare allele of a previously unidentified histone H4 acetyltransferase enhances grain weight, yield, and plant biomass in rice. Proceedings of the National Academy of Sciences 2015, 112(1):76-81.
Song XJ, Huang W, Shi M, Zhu MZ, Lin HX: A QTL for rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase. Nat Genet 2007, 39(5):623-630.
Xia T, Li N, Dumenil J, Li J, Kamenski A, Bevan MW, Gao F, Li Y: The Ubiquitin Receptor DA1 Interacts with the E3 Ubiquitin Ligase DA2 to Regulate Seed and Organ Size in <em>Arabidopsis</em>. The Plant Cell Online 2013.
Xia D, Zhou H, Liu R, Dan W, Li P, Wu B, Chen J, Wang L, Gao G, Zhang Q et al: GL3.3, a Novel QTL Encoding a GSK3/SHAGGY-like Kinase, Epistatically Interacts with GS3 to Form Extra-long Grains in Rice. Mol Plant 2018.
Qi P, Lin YS, Song XJ, Shen JB, Huang W, Shan JX, Zhu MZ, Jiang L, Gao JP, Lin HX: The novel quantitative trait locus GL3.1 controls rice grain size and yield by regulating Cyclin-T1;3. Cell Res 2012, 22(12):1666-1680.
Gao X, Zhang J-Q, Zhang X, Zhou J, Jiang Z, Huang P, Tang Z, Bao Y, Cheng J, Tang H et al: Rice qGL3/OsPPKL1 Functions with the GSK3/SHAGGY-Like Kinase OsGSK3 to Modulate Brassinosteroid Signaling. The Plant Cell 2019, 31(5):1077-1093.
Zhang X, Wang J, Huang J, Lan H, Wang C, Yin C, Wu Y, Tang H, Qian Q, Li J et al: Rare allele of OsPPKL1 associated with grain length causes extra-large grain and a significant yield increase in rice. Proc Natl Acad Sci U S A 2012, 109(52):21534-21539.
Kunihiro S, Saito T, Matsuda T, Inoue M, Kuramata M, Taguchi-Shiobara F, Youssefian S, Berberich T, Kusano T: Rice DEP1, encoding a highly cysteine-rich G protein gamma subunit, confers cadmium tolerance on yeast cells and plants. J Exp Bot 2013, 64(14):4517-4527.
Huang X, Qian Q, Liu Z, Sun H, He S, Luo D, Xia G, Chu C, Li J, Fu X: Natural variation at the DEP1 locus enhances grain yield in rice. Nat Genet 2009, 41(4):494-497.
Appels R EK, Feuillet C: Shifting the limits in wheat research and breeding using a fully annotated reference genome. Sci 2018, 361(6403):eaar7191.
Brenchley R, Spannagl M, Pfeifer M, Barker GLA, D’Amore R, Allen AM, McKenzie N, Kramer M, Kerhornou A, Bolser D et al: Analysis of the bread wheat genome using whole-genome shotgun sequencing. Nature 2012, 491:705.
Kurata N, Moore G, Nagamura Y, Foote T, Yano M, Minobe Y, Gale M: Conservation of Genome Structure Between Rice and Wheat. Bio/Technology 1994, 12(3):276-278.
Zhai H, Feng Z, Du X, Song Y, Liu X, Qi Z, Song L, Li J, Li L, Peng H et al: A novel allele of TaGW2-A1 is located in a finely mapped QTL that increases grain weight but decreases grain number in wheat (Triticum aestivum L.). Theor Appl Genet 2018, 131(3):539-553.
Qin L, Hao C, Hou J, Wang Y, Li T, Wang L, Ma Z, Zhang X: Homologous haplotypes, expression, genetic effects and geographic distribution of the wheat yield gene TaGW2. BMC Plant Biol 2014, 14(1):107.
Su Z, Hao C, Wang L, Dong Y, Zhang X: Identification and development of a functional marker of TaGW2 associated with grain weight in bread wheat (Triticum aestivum L.). Theor Appl Genet 2011, 122(1):211-223.
Simmonds J, Scott P, Brinton J, Mestre TC, Bush M, Del Blanco A, Dubcovsky J, Uauy C: A splice acceptor site mutation in TaGW2-A1 increases thousand grain weight in tetraploid and hexaploid wheat through wider and longer grains. Theor Appl Genet 2016, 129(6):1099-1112.
Sestili F, Pagliarello R, Zega A, Saletti R, Pucci A, Botticella E, Masci S, Tundo S, Moscetti I, Foti S et al: Enhancing grain size in durum wheat using RNAi to knockdown GW2 genes. Theor Appl Genet 2019, 132(2):419-429.
Yang J, Zhou Y, Wu Q, Chen Y, Zhang P, Zhang Y, Hu W, Wang X, Zhao H, Dong L et al: Molecular characterization of a novel TaGL3-5A allele and its association with grain length in wheat (Triticum aestivum L.). Theor Appl Genet 2019, 132(6):1799-1814.
Zhang Y, Liu J, Xia X, He Z: TaGS-D1, an ortholog of rice OsGS3, is associated with grain weight and grain length in common wheat. Mol Breeding 2014, 34(3):1097-1107.
Akhunov ED, Akhunova AR, Anderson OD, Anderson JA, Blake N, Clegg MT, Coleman-Derr D, Conley EJ, Crossman CC, Deal KR et al: Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 2010, 11(1):702.
Wang S, Wong D, Forrest K, Allen A, Chao S, Huang BE, Maccaferri M, Salvi S, Milner SG, Cattivelli L et al: Characterization of polyploid wheat genomic diversity using a high-density 90,000 single nucleotide polymorphism array. Plant Biotechnol J 2014, 12(6):787-796.
Sun S, Wang L, Mao H, Shao L, Li X, Xiao J, Ouyang Y, Zhang Q: A G-protein pathway determines grain size in rice. Nat Commun 2018, 9(1):851.
Mao H, Sun S, Yao J, Wang C, Yu S, Xu C, Li X, Zhang Q: Linking differential domain functions of the GS3 protein to natural variation of grain size in rice. Proc Natl Acad Sci U S A 2010, 107(45):19579-19584.
Wang C, Chen S, Yu S: Functional markers developed from multiple loci in GS3 for fine marker-assisted selection of grain length in rice. Theor Appl Genet 2011, 122(5):905-913.
Li Q, Yang X, Bai G, Warburton ML, Mahuku G, Gore M, Dai J, Li J, Yan J: Cloning and characterization of a putative GS3 ortholog involved in maize kernel development. Theor Appl Genet 2010, 120(4):753-763.
Urano D, Miura K, Wu Q, Iwasaki Y, Jackson D, Jones AM: Plant Morphology of Heterotrimeric G Protein Mutants. Plant Cell Physiol 2016, 57(3):437-445.
Rubinovich L, Weiss D: The Arabidopsis cysteine-rich protein GASA4 promotes GA responses and exhibits redox activity in bacteria and in planta. PlJ 2010, 64(6):1018-1027.
Gutierrez-Gonzalez JJ, Mascher M, Poland J, Muehlbauer GJ: Dense genotyping-by-sequencing linkage maps of two Synthetic W7984×Opata reference populations provide insights into wheat structural diversity. Scientific Reports 2019, 9(1):1793.
Li Y, Xu M: CCT family genes in cereal crops: A current overview. The Crop Journal 2017, 5(6):449-458.
Sakuma S, Golan G, Guo Z, Ogawa T, Tagiri A, Sugimoto K, Bernhardt N, Brassac J, Mascher M, Hensel G et al: Unleashing floret fertility in wheat through the mutation of a homeobox gene. Proc Natl Acad Sci U S A 2019, 116(11):5182-5187.
Ma L, Li T, Hao C, Wang Y, Chen X, Zhang X: TaGS5-3A, a grain size gene selected during wheat improvement for larger kernel and yield. Plant Biotechnol J 2016, 14(5):1269-1280.
Edgar RC: MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 2004, 32(5):1792-1797.
Kumar S, Stecher G, Tamura K: MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol 2016, 33(7):1870-1874.
Rasheed A, Wen W, Gao F, Zhai S, Jin H, Liu J, Guo Q, Zhang Y, Dreisigacker S, Xia X et al: Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theor Appl Genet 2016, 129(10):1843-1860.

Table 1 Primers used in this study

Primer	Sequence (5'-3')	explanation	predicted PCR product Size
TaGS3-4A-F	CGATCCTTCTCTGCGGCAAG	primers for amplifying TaGS-4A	2435bp
TaGS3-4A-R	CCTACAGACCGACGACTTCCTG	primers for amplifying TaGS-4A	2435bp
TaGS3-7A-F	CGACTTCCTGTCTCCTTCCGG	primers for amplifying TaGS-7A	2389bp
TaGS3-7A-R	TCATGCCCGTCAAAAACACCAG	primers for amplifying TaGS-7A	2389bp
TaGS3-7D-F	GACGACTTCCTGTCTCCTACTTCC	primers for amplifying TaGS-7D	2409bp
TaGS3-7D-R	TCATGCCCGTCAAAAACACCAG	primers for amplifying TaGS-7D	2409bp
TaGS3-7A-1907-F1	FAM-GCGCCGGTTGCTCCTCATCTTGCG	KASP marker for distinguishing A/G allele
TaGS3-7A-1907-F2	HEX-GCGCCGGTTGCTCCTCATCTTGCA
TaGS3-7A-1907-CR	AGGGACGCCRCCGCAGCACACGGT

Table 2 Variants detected for TaGS3-4A. The position was accounted from ATG (1).

position

location

Changzhi 6406

Sankecun

Shannong 7859

Kangdingxiaomai

Xingyi 4

Youmangbaifu

Dongnong 101

Gansu 96

Fuzhuang 30

Bima 4

amino acid change

-306

5'UTR

-129

5'UTR

-53

5'UTR

1st exon

A/M

200

1st intron

250

1st intron

331

1st intron

354

1st intron

ACT

ACTG

ACTACTG

378

1st intron

397

1st intron

633

2nd intron

712

2nd intron

1140

2nd intron

1747

5th exon

L/P

1897

5th exon

A/V

1976

3'UTR

2004

3'UTR

Table 3 Variants detected for TaGS3-7A. The position was accounted from ATG (1)

position

location

Changzhi 6406

Sankecun

Shannong 7859

Kangdingxiaomai

Xingyi 4

Youmangbaifu

Dongnong 101

Gansu 96

Fuzhuang 30

Bima 4

amino acid change

-285

5'UTR

-244

5'UTR

(CCG)₆

(CCG)₃

(CCG)₅

(CCG)₆

(CCG)₃

-210

5'UTR

-159

5'UTR

417

1st intron

GCTAGC.....

TAGTAGCT

GCTAGC.....

TAGTAGCT

GCTAGC.....

TAGTAGCT

GCTAGCTACTG

TAGTAGCT

GCTAGC.....

TAGTAGCT

GCTAGC.....

TAGTAGCT

GCTAGC.....TAGTAGCT

GCTAGCTACTGTAGTAGCT

479

1st intron

582

2nd intron

785

2nd intron

1022

2nd intron

1117

2nd intron

1435

4th exon

I/T

1515

4th intron

1523

4th intron

1543

4th intron

1814

5th exon

G/R

1907

5th exon

T/A

1948

5th exon

2000

3'UTR

Table 4 Association analysis of kernel traits between GS3-7Aa and GS3-7Ab genotypes

Trait Allele		N	Mean	Sig
TKW_E1	TaGS3-7A-G	116	36.3984±0.6876	0.010**
TKW_E1	TaGS3-7A-A	20	40.962±1.2836	0.010**
TKW_E2	TaGS3-7A-G	140	32.7631±0.6115	0.075
TKW_E2	TaGS3-7A-A	21	35.7688±1.4403
TKW_E3	TaGS3-7A-G	145	34.5766±0.6054	0.004**
TKW_E3	TaGS3-7A-A	24	39.1142±1.222
GL_E1	TaGS3-7A-G	147	0.6385±0.0051	0.27
GL_E1	TaGS3-7A-A	24	0.6535±0.0129
GL_E2	TaGS3-7A-G	143	0.643±0.0047	0.089
GL_E2	TaGS3-7A-A	22	0.6647±0.0108
GL_E3	TaGS3-7A-G	145	0.6678±0.0047	0.134
GL_E3	TaGS3-7A-A	24	0.6861±0.0097
GW_E1	TaGS3-7A-G	147	0.3034±0.0026	0.013*
GW_E1	TaGS3-7A-A	24	0.3208±0.0058
GW_E2	TaGS3-7A-G	143	0.3006±0.002	0.007**
GW_E2	TaGS3-7A-A	22	0.3159±0.0051
GW_E3	TaGS3-7A-G	145	0.3058±0.0018	0.020*
GW_E3	TaGS3-7A-A	24	0.3177±0.0057
GT_E1	TaGS3-7A-G	147	0.2665±0.0021	0.010**
GT_E1	TaGS3-7A-A	24	0.2809±0.0044
GT_E2	TaGS3-7A-G	143	0.278±0.0018	0.005**
GT_E2	TaGS3-7A-A	22	0.292±0.0035
GT_E3	TaGS3-7A-G	145	0.2894±0.0018	0.083
GT_E3	TaGS3-7A-A	24	0.2975±0.0035
GL/GW_E1	TaGS3-7A-G	147	2.1188±0.0193	0.221
GL/GW_E1	TaGS3-7A-A	24	2.0534±0.0585	0.221
GL/GW_E2	TaGS3-7A-G	143	2.1462±0.016	0.456
GL/GW_E2	TaGS3-7A-A	22	2.1132±0.0437	0.456
GL/GW_E3	TaGS3-7A-G	145	2.1902±0.0164	0.784
GL/GW_E3	TaGS3-7A-A	24	2.1776±0.0533	0.784

supplement1.docx

Download PDF

Journal Publication

published 18 Dec, 2019

Read the published version in BMC Genetics →

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Cloning, characterization of TaGS3 gene and identification of allelic variation associated with kernel traits in wheat (Triticum aestivum L.)

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Tables

Supplementary Files

Status:

Journal Publication

Version 1