Materials
The host strain E. coli BL21 (DE3) (NEB, Ipswich, MA, USA) and plasmid pET-30a(+) (Merck, Darmstadt, Germany) were stored at the Korea Research Institute of Bioscience and Biotechnology (KRIBB). The full-length KGF-1 was fused to TRX via the cleavage site (DDDDK) of enterokinase, and the E. coli-based codon-optimized fusion gene was synthesized from DNA2.0 (ATUM, Menlo Park, CA, USA). AKTA Prime Plus, HiTrap SP HP (5 mL), HiTrap CM HP (5 mL), and HisTrap HP (5 mL) columns were purchased from GE Healthcare Life Sciences. Restriction enzymes, DNA polymerase, the In-Fusion HD Cloning Kit, and In-Fusion HD cloning kit were purchased from Takara (Takara Bio, Otsu, Japan).
Construction of full-length KGF-1 and KGF-1135 expression vectors and strains
The synthesized TRX-6H-KGF-1 plasmid was inserted into the pET-30a plasmid. TRX-6H was amplified by polymerase chain reaction (PCR) using the oligopeptide primers TRX-6H F and TRX-6H R, GCCCTCCTTGTCGTCGTCATCACC and GGAGATATACATATGGTGAAACAGATC, respectively. KGF-1135 was amplified by PCR using the oligopeptide primers KGF-1 135 F and KGF-1 135 R, GACGACAAGGAGGGCGGCGACATT and GTGGTGGTGGTGCTCGAGTTACGTAATGGCCATCGG, respectively. TRX-6H-KGF-1135 was amplified by the fusion PCR, the mixture of TRX-6H and KGF-1135 used for the template, using the oligopeptide primers KGF-1 135 F and TRX-6H R. The digested and amplified products were ligated into the vector pET-30a at EcoRI and XhoI sites using In-Fusion HD cloning kit. The recombinant plasmids were transformed into E. coli BL21 (DE3) cells using the heat shock method as following our previous report [24]. Briefly, E. coli BL21 (DE3) competent cells and each plasmid were mixed and incubated on ice for 30 min. Subsequently, each mixture was subjected to heat shock at 42°C for 40 s and incubated on ice for 2 min. Finally, curing was conducted at 37°C for 1 h after the addition of Luria-Bertani (LB) medium. The cells were spread on an LB plate containing 50 µg/mL kanamycin and incubated at 37°C overnight.
Cultivation
The flask cultivation and 5 L fermentation media and method were described in our previous study [24]. Flask cultivation was performed in 1 L shake baffle flasks in 250 mL of auto-induction media containing 0.5 g/L of glucose, 3 g/L of glycerol, 2 g/L of lactose, 0.15 g/L of MgSO4·7H2O, 10 g/L of yeast extract, 16 g/L of tryptone, 3.3 g/L of (NH4)2SO4, 1 mL/L of trace elements, 6.8 g/L of KH2PO4, and 7.1 g/L of Na2HPO4·12H2O. Trace elements consisted of 0.5 g/L CoCl2·6H2O, 65 g/L FeSO4·7H2O, 3 g/L MnSO4·5H2O, 5 mL/L H2SO4 (95–98%), 0.08 g/L KI, 6 g/L CuSO4·5H2O, 20 g/L ZnCl2, 0.02 g/L H3BO3, 0.2 g/L Na2MoO4·2H2O, and 0.2 g biotin. The transformants were cultured overnight in test tubes with 3 mL of LB medium and 50 µg/mL of kanamycin; 2.5 mL of the culture was transferred into 1-L baffled flasks containing 250 mL of auto-induction medium with 50 µg/mL kanamycin and incubated on a shaker at 200 rpm and three temperature (37, 30, and 25°C).
Fermentation (5 L) was performed using media containing 15 g/L of glucose, 1 g/L of MgSO4·7H2O, 10 g/L of yeast extract, 10 g/L of casein peptone, 10 g/L of (NH4)2SO4, 0.5 g/L of NaCl, 3 g/L of Na2HPO4·12H2O, 3 g/L of KH2PO4, 1 mL/L of trace element solution, and 50 µg/mL of kanamycin. For the additional feed solution, 600 g/L glucose and 20 g/L of yeast extract were prepared. Fermentation was controlled under the following conditions: cell growth at 37°C, protein expression at 25°C, pH adjusted to 7.0 with ammonium hydroxide, an airflow of 1 vvm, and agitation from 200–900 rpm to maintain the dissolved oxygen levels above 30%. All the controlled conditions were monitored, and glucose levels were analyzed using a glucose analyzer (YSI 2700 Biochemistry Analyzer; Yellow Springs Instrument, Yellow Springs, OH, USA). For the seed culture, a single colony of each recombinant E. coli from the LB plate with 50 µg/mL kanamycin was inoculated into 200 mL of the same medium in a 2 L baffled flask and incubated at 37°C overnight. Fermentation was initiated at a working volume of 2 L. After consumption of the initial glucose, additional glucose was added at a rate of 6–7 g/L/h. When the cell density reached approximately 35, the temperature was decreased to 30°C and glucose was added at a rate of 5 g/L/h for 0.5 h. Then, the temperature was decreased to 25°C and the glucose feeding rate was reduced to 4 g/L/h. After 1.5 of temperature shift, lactose was added at a final concentration of 15 g/L to induce KGF-1 protein expression. After 28.5 h of fermentation, cells were harvested by centrifugation at 7,000 rpm at 4°C for 30 min, and the harvested cells were stored at -70°C.
To analyze the expression levels and solubility, the cells were diluted to an OD600 of 5. After washing twice with phosphate buffered saline (PBS), the precipitate was resuspended in the same buffer and disrupted by sonication (Cole-Parmer Instruments, Vernon Hills, IL, USA) on ice at 40% amplitude for 3s on time and 5s off time for a total of 10 min. Disrupted cells were stored for the total fraction. After removal of debris by centrifugation at 12,000 rpm at 4°C for 5 min, the supernatant was stored for the soluble fraction. For the insoluble fraction, the debris was washed twice with PBS and resuspended in the same buffer. Protein concentration was determined using the Pierce™ BCA protein assay kit (Thermo Scientific, Waltham, MA, USA), and absorbance was measured at 550 nm using an Infinite 200 PRO plate reader (TECAN, Männedorf, Switzerland). Protein expression was analyzed by loading the protein samples and culture media onto a 4–12% Bis-Tris Plus SDS-PAGE gel (Thermo Scientific) and running at 170 V and 500 mA for 32 min, followed by staining with InstantBlue (Abcam, Cambridge, UK).
Purification of full-length KGF-1 and KGF-1135
For the full-length KGF-1 protein, primary purification was conducted using a 5 mL HisTrap column. The supernatant was applied to HisTrap columns at a flow rate of 3 mL/min, which were pre-equilibrated with a binding buffer (20 mM Tris-HCl pH 8.0, 300 mM NaCl). After washing with binding buffer containing 50 mM imidazole at a flow rate of 3 mL/min, TRX-KGF-1 was eluted using an elution buffer (binding buffer with 500 mM imidazole), and the eluent was dialyzed against 20 mM Tris-HCl (pH 8.0). hEKL C112S (for the cleavage of the fusion protein) was purified as previously reported [26]. After cleavage with hEKL C112S at 4°C overnight, KGF-1 was purified using a HiTrap SP column. KGF-1 was applied to a HiTrap SP column at a flow rate of 3 mL/min, which was pre-equilibrated with a binding buffer (20 mM Tris-HCl, pH 8.0). After washing with a binding buffer containing 500 mM NaCl at a flow rate of 5 mL/min, KGF-1 was eluted using an elution buffer (20 mM Tris-HCl pH 8.0, 600 mM NaCl). KGF-1 concentration was measured using the BCA method, and purity was measured using C18 RP-HPLC and SDS-PAGE.
For the KGF-1135 protein, primary purification was conducted using a 5 mL HisTrap column. The supernatant was applied to the HisTrap columns at a flow rate of 3 mL/min, which were pre-equilibrated with a binding buffer (20 mM Tris-HCl pH 8.0, 300 mM NaCl). After washing with the binding buffer containing 50 mM imidazole at a flow rate of 3 mL/min, TRX-6H-KGF-1135 was eluted using an elution buffer (20 mM Tris-HCl pH 8.0, 300 mM NaCl, and 500 mM imidazole), and the eluent was dialyzed against 20 mM Tris-HCl (pH 8.0). After cleavage with hEKL C112S at 4°C overnight, KGF-1135 was purified using a HiTrap SP column. KGF-1135 was applied to a HiTrap SP column at a flow rate of 3 mL/min, which was pre-equilibrated with binding buffer (20 mM Tris-HCl, pH 8.0). After washing with a binding buffer containing 500 mM NaCl at a flow rate of 5 mL/min, KGF-1135 was eluted with an elution buffer (20 mM Tris-HCl with 1 M NaCl). KGF-1135 concentration was measured using the BCA method, and purity was measured using C18 RP-HPLC and SDS-PAGE.
Purity analysis of KGF-1 135 with HPLC
The HPLC was described in our previous study [24]. Briefly, the purity of KGF-1135 was evaluated using HPLC (1200 Series; Agilent Technologies, Santa Clara, CA, USA) with a UV detector at a wavelength of 214 nm. For the analysis, a C18 reverse-phase column (Zorbax Eclipse XDB, 80 Å C18, 4.6 ⋅ 150 mm, 5 µm; Agilent Technologies) was maintained at 40°C. The column was pre-equilibrated with buffer A (0.1% trifluoroacetic acid in distilled water) and 5% (v/v) buffer B (0.1% trifluoroacetic acid in acetonitrile). The flow rate was 0.5 mL/min; the sample volume was 20 µL, and the run time for each sample was 45 min. The injected sample was separated using a gradient of 5–100% B in A for 35 min. Equilibrium was achieved after an additional 10 min.
N-terminal sequencing and LC-MS/MS
The N-terminal sequencing and LC-MS/MS were described in our previous study [24]. Briefly, p
rotein N-terminal sequences were obtained by transferring the purified recombinant KGF-1 and KGF-1135 proteins to a polyvinylidene difluoride membrane using a Procise ABI 492 protein sequencer (Applied Biosystems, Foster City, CA, USA). The authenticity of the purified proteins was verified using native mass spectrometry at eMASS (Seoul, Republic of Korea). Samples were analyzed according to the service provider’s protocol. Briefly, they were first resolved by UHPLC Ultimate 3000 (Thermo Scientific) on an ACQUITY-C8 column (2.3⋅130 mm, 1.7 µm; Waters, Milford, MA, USA). Mobile phases A [H2O/formic acid, 100/0.2 (v/v)] and B [acetonitrile/formic acid, 100/0.2 (v/v)] were used for the analysis. Approximately 10 µL of the sample was injected for analysis and separated using a gradient of 5–100% B in A for 12 min. Native protein mass was detected using a TripleTOF 5600+ (AB SCIEX, Framingham, MA, USA).
CD analysis
The CD analysis was described in our previous report [40]. Far-UV CD measurements of KGF-1135 were performed using an automated Chirascan CD spectrometer (Applied Photophysics, Leatherhead, UK). Spectra were recorded over a range of 195 to 260 nm using a 0.5-mm path length at 25°C to determine the secondary structure of KGF-1135. To evaluate the thermal stability of KGF-1135, the temperature was increased by 1.0°C stepwise from 20°C to 90°C. The purified protein was adjusted to 0.3 mg/mL for CD analysis. The background CD spectrum of the buffer was subtracted from the CD spectrum of KGF-1135.
Cell culture
The immortalized human breast cell line, MCF7 was maintained in Dulbecco's modified Eagle’s medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 2 mmol/l glutamine, and 100 U/ml penicillin/streptomycin in 5% CO2 at 37°C.
Immunoblot analysis
After treatment under different conditions as described in the figure legends, cells were collected and lysed in M2 buffer (20 mM Tris, pH 7.6, 0.5% NP-40, 250 mM NaCl, 3 mM Ethylenediaminetetraacetic acid (EDTA), 3 mM EGTA, 2 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 20 mM β-glycerol phosphate, 1 mM sodium vanadate, and 1 µg/ml leupeptin). 30 µg of cell lysate was subjected to 10% SDS-PAGE and transferred to nitrocellulose membrane. After blocking with 5% skim milk in PBS/T, the membrane was probed with the relevant antibodies and visualized using Super Signal West Pico chemiluminescent Substrate kit (Thermo Fisher Scientific Inc.) according to the manufacturer′s instructions.