Cell culture
Human lens epithelial B3 (HLE-B3) cells were obtained from American Type hCulture Collection (ATCC, Rockville, MD, USA). Cells were cultured in eagle's minimum essential medium (EMEM, Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Gibco) and were incubated at 37 °C in a humidified chamber with 5% CO2.
Cell transfection
MiR-182-5p mimics or negative controls (RiboBio, Guangzhou, China) were transfected into the cells according to the instructions on the Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA). HLEC-B3 cells were treated with pcDNA3.1-NOX4 (oe-NOX4) or pcDNA3.1 negative control (oe-NC) (RiboBio, Guangzhou, China), followed by treatment with the miR-182-5p mimics or negative controls. At 48h after transfection, HLE-B3 cells were treated with H2O2 (250 μmol/L) for 12h.
Luciferase assays
The putative binding sites of miR-182-5p and NOX4 were predicted by targetscan human 7.2. The 3’untranslated regions (3’UTR) sequences containing wild-type or mutant binding sites of NOX4 were subcloned into pmirGlO luciferase reporter vector (Promega, Madison, WI, USA) to generate the wild-type plasmids (NOX4-WT) or mutant-type plasmids (NOX4-MUT), respectively. The miR-NC, miR-182-5p mimics was cotransfected with reporter plasmids into HLE-B3 cells using Lipofectamine 3000. Luciferase activities were analyzed 24h after transfection using the Dual-luciferase Reporter Assay Kit (Promega, Madison, USA).
Cell Counting Kit-8 (CCK-8) assay
Cells were seeded in a 96-well plate (1×104) and incubated for 24h. Then 10μL CCK8 reagents (Beyotime Institute of Biotechnology, Jiangsu, China) was added to the cells. A microplate reader (Bio-Tek, Winooski, VT, USA) was utilized to test the absorbance at 450 nm.
5-ethynyl-2’-deoxyuridine (EdU) Assay
To detect the function of miR-182-5p on cell proliferation, EdU proliferation assay (RiboBio, Guangzhou, China) was conducted. Cells were incubated with 50μM EdU. The EdU positive cells were then visualized under a fluorescence microscope (leica, Germany).
Apoptosis Detection
Cells were collected and incubated with Annexin V-FITC/PI apoptosis detection kit (KeyGEN Biotech, Nanjing, China) in the dark for 15min. Cell apoptosis were analyzed by using a flow cytometer (A60-Micro, Apogee, UK).
Detection of MMP (mitochondrial membrane potential)
Cells were added to 6-well plates(1×106) and divided into groups as described above. Then, the changes of cell MMP in different groups of cells were measured using 5 μg/mL JC-1 (Beyotime Biotechnology, Shanghai, China). The cells were washed with PBS buffer and detected by flow cytometer (Apogee).
Detection of Oxidative Stress Products
The concentrations of reactive oxygen species (ROS) in the cells were measured by adding 200μL DCFH-DA (5μmol/L final concentration, Sigma-Aldrich, St.Louis, MO, USA). After washed, cells were detected by the flow cytometer (Apogee). The malondialdehyde (MDA) content, superoxide dismutase (SOD), and glutathione peroxidase (GSH-Px) activities were detected by using measurement kits (Nanjing Jiancheng Bioengineering Institute) separately.
Real time quantitative RT-PCR (RT-qPCR)
Total RNA was isolated from LECs using TRIzol reagent and converted into cDNA (TaKaRa, Dalian, China). For quantitative real-time PCR (qRT-PCR), the SYBR (Roche) was used according to the manufacturer’s protocol with the Analytik-jena qTOWER PCR System (Jena, Germany). Primers were listed as follows, miR-182-5p (ACACTCCAGCTGGGTTTGGCAATGGTAGAACT and TGGTGTCGTGGAGTCG), U6 (CTCGCTTCGGCAGCACA and AACGCTTCACGAATTTGCGT), NOX4 (CGATTCCGGGATTTGCTACTG and CCTCAAATGGGCTTCCAAATG), β-actin (TGAGCGCGGCTACAGCTT and TCCTTAATGTCACGCACGATTT).
Western blot
Cells were lysed in lysis buffer to extract protein samples. 50µg total protein was separated by SDS-PAGE and transferred onto PVDF membranes. The membranes were probed with appropriate primary antibodies, including Cleaved caspase 3(#9664, CST,1:1000), Cleaved caspase9(#9509,CST,1:1,000), p-p38(#4511,CST,1:1000), p38(#8690,CST,1:1000), p-ERK(#4370, CST,1:1000), ERK (#4695,CST,1:1000), p-JNK(#9255,CST,1:1000), JNK(#9252,CST,1:1000), NOX4 (ab133303,abcam 1:1000), β-actin (#3700, CST, 1:5000,). Then, membranes were incubated with secondary antibodies for 2h. Finally, the protein bands were detected by chemiluminescence reagents.
Statistical analysis
GraphPad Prism 7 (GraphPad, San Diego, CA, USA) was applied for statistical analysis. All experiments were repeated three times. Data are shown as the mean ± SD. Differences between multiple groups were assessed by one-way ANOVA and Tukey’s multiple comparisons test. Differences between groups were considered significant when P < 0.05.