Cell culture
Human lens epithelial B3 (HLE-B3) cells were obtained from American Type Culture Collection (ATCC, Rockville, MD, USA). Cells were cultured in Eagle's minimum essential medium (EMEM; Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco) at 37 °C in a humidified chamber with 5% CO2.
Cell transfection
MiR-182-5p mimics or negative controls (RiboBio, Guangzhou, China) were transfected into HLE-B3 cells using the Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. HLEC-B3 cells were treated with pcDNA3.1-NOX4 (oe-NOX4) or pcDNA3.1 negative control (oe-NC) (RiboBio, Guangzhou, China), followed by treatment with miR-182-5p mimics or negative controls. At 48h post transfection, HLE-B3 cells were treated with H2O2 (250 μmol/L) for 12 h.
Luciferase assays
The putative binding sites of miR-182-5p and NOX4 were predicted by TargetscanHuman 7.2. The 3′untranslated regions (3′UTR) sequences containing wild-type or mutant binding sites of NOX4 were subcloned into pmirGlO luciferase reporter vector (Promega, Madison, WI, USA) to generate the wild-type (NOX4-WT) or mutant-type plasmids (NOX4-MUT), respectively. The miR-NC or miR-182-5p mimics were cotransfected with reporter plasmids into HLE-B3 cells using Lipofectamine 3000. Luciferase activities were analyzed 24h after transfection using the Dual-luciferase Reporter Assay Kit (Promega, Madison, USA).
Cell Counting Kit-8 (CCK-8) assay
Cells were seeded in a 96-well plate (1×104). At 24, 48, 72 and 96 h, 10 μL of CCK8 reagent (Beyotime Institute of Biotechnology, Jiangsu, China) was added to the cells. The absorbance of the wells was measured at 450 nm using a microplate reader (Bio-Tek, Winooski, VT, USA).
5-Ethynyl-2′-deoxyuridine (EdU) assay
To investigate the influence of miR-182-5p on cell proliferation, EdU proliferation assay (RiboBio, Guangzhou, China) was conducted. Briefly, cells were incubated with 50 μM EdU for 2 h at 37°C. Cells were fixed with 4% paraformaldehyde and treated with 0.5% Triton X-100 at room temperature. Next, the cells were washed with phosphate buffered saline (PBS) and incubated with Hoechst 33342 (100 μL) at room temperature for 30 min. The EdU positive cells were then visualized under a fluorescence microscope (Leica, Germany).
Apoptosis detection
Cellular apoptosis was determined by flow cytometry using the Annexin V-fluorescein isothiocyanate (V-FITC)/propidium iodide (PI) kit (KeyGEN Biotech, Nanjing, China). Briefly, the collected cells were resuspended in 500 µL of 1× binding buffer, 5 µL Annexin V-FITC and 5 µL PI were added and incubated at room temperature in the dark for 15min. Cell apoptosis was analyzed by using a flow cytometer (A60-Micro, Apogee, UK).
Detection of mitochondrial membrane potential (MMP)
Cells were added to 6-well plates (1×106) and divided into groups as described for cell transfection. The changes of cell MMP in different groups of cells were measured using 5 μg/mL JC-1 (Beyotime Biotechnology, Shanghai, China). The cells were washed with PBS and detected by flow cytometer (Apogee, UK).
Detection of oxidative stress products
The concentrations of reactive oxygen species (ROS) in the cells were measured by adding 200μL 2'-7'-dichlorofluorescin diacetate (DCFH-DA) (5μmol/L final concentration, Sigma-Aldrich, St.Louis, MO, USA). After washing, cells were detected by the flow cytometer (Apogee, UK). The malondialdehyde (MDA) contentand superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activities were detected using measurement kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), separately.
Quantitative real-time PCR (qRT-PCR)
Total RNA was isolated from LECs using TRIzol reagent. 1 µg RNA was used to reverse transcript to cDNA by using PrimeScript RT Master Mix (TaKaRa, Japan). For qRT-PCR, the SYBR (Roche, Basel, Switzerland) was used according to the manufacturer’s protocol with the Analytik-jena qTOWER PCR System (Jena, Germany). U6 and β-actin were used as an internal control for miR-182-5p and NOX4, respectively. Primers are listed as follows, miR-182-5p (ACACTCCAGCTGGGTTTGGCAATGGTAGAACT and TGGTGTCGTGGAGTCG), U6 (CTCGCTTCGGCAGCACA and AACGCTTCACGAATTTGCGT), NOX4 (CGATTCCGGGATTTGCTACTG and CCTCAAATGGGCTTCCAAATG), β-actin (TGAGCGCGGCTACAGCTT and TCCTTAATGTCACGCACGATTT).
Western blot
Cells were lysed in lysis buffer to extract protein samples. Total proteins were quantified using the bicinchoninic acid method (Wuhan Boster Biological Technology., LTD, China). 50µg of total protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes (Millipore, USA). The membranes were probed with appropriate primary antibodies, including Cleaved caspase 3 (#9664, CST, 1:1000), Cleaved caspase 9 (#9509, CST, 1:1000), p-p38 (#4511, CST, 1:1000), p38 (#8690, CST, 1:1000), p-ERK (#4370, CST, 1:1000), ERK (#4695, CST, 1:1000), p-JNK (#9255, CST, 1:1000), JNK (#9252, CST, 1:1000), NOX4 (ab133303, abcam, 1:1000), and β-actin (#3700, CST, 1:5000). Then, membranes were incubated with secondary antibodies (horseradish peroxidase-labeled goat anti-rabbit IgG, ab6721, abcam, 1:10000) for 2h. Finally, the protein bands were detected by chemiluminescence reagents (Pierce, Rockford, IL, USA).
Statistical analysis
GraphPad Prism 7 (GraphPad, San Diego, CA, USA) was applied for statistical analysis. All experiments were repeated three times. Data have been presented as the mean ± SD. Differences between multiple groups were assessed by one-way ANOVA and Tukey’s multiple comparisons test. Differences between groups were considered significant when P < 0.05.