Cell culture
We recently established healthy and WS patient-derived iPSCs 21. In this study all the experiments, except Fig. 4 and 6, were performed using three individual iPSC clones obtained from three different WS patients and three different age-matched healthy donors. In Fig. 4 and 6, we used two different iPSC clones from WS patients and age-matched healthy donors. On every passage, sub-confluent iPSCs were treated with 0.05% trypsin-EDTA (cat. #32778-34, Nacalai Tesque) at 37°C for 5-6 min and suspended with 1 ml Dulbecco’s Modified Eagle’s Medium (DMEM; cat. #08459-64, Nacalai Tesque) with 10% fetal bovine serum (FBS; cat. #FB-1365/500, Biosera) by gentle pipetting. Single cells were plated on newly prepared Matrigel (cat. #356230, Corning)-coated 6-cm plates at 2.5-3 × 103/cm2 with AK02N (ANJINOMOTO) supplemented with 1 µM Y-27632 (cat. #036-24023, Fujifilm). After 24 h, the culture medium was changed to medium without Y-27632. C3H10T1/2 cells were obtained and cultured as previously described 29. Human aortic endothelial cells obtained from Lonza (CC-2535), and human aortic smooth muscle cells obtained from Gibco (C0075C) were cultured according to the manufacturers’ protocols. All studies were performed in accordance with the Declaration of Helsinki. The ethics committee of Chiba University, Chiba, Japan (#1145) approved this study.
Differentiation of Mφs from iPSCs
We previously demonstrated that multipotent HPCs can be efficiently generated from human embryonic stem cells and iPSCs 28–31. Here, we modified the PS-sac method to generate functional Mφs (Extended Data Fig. 1a). To obtain HPCs, PS-sac-like structures in culture were maintained for 2 weeks to obtain CD34+ CD43+ cells, followed by an additional 7 days of culture with a cytokine cocktail supported by growth-arrested C3H10T1/2 feeder cells (Extended Data Fig. 1a). Briefly, iPSCs were dissociated into small colonies (< 100 cells) with the aid of CTK (phosphate buffered saline (PBS) containing 0.25% trypsin (cat. #15090-046, Gibco), 1 mM CaCl2, and 20% knock-out serum replacement (KSR; cat. #10828028, Gibco)) and cultured on a C3H10T1/2 feeder layer in differentiation medium (Iscove modified Dulbecco medium (IMDM) supplemented with a cocktail of 10 µg/mL human insulin, 5.5 µg/mL human transferrin, 5 ng/mL sodium selenite, 2 mM L-glutamine, 0.45 mM-monothioglycerol, 50 g/mL ascorbic acid, 15% highly filtered FBS) supplemented with 20 ng/mL recombinant human VEGF (R&D Systems) and 10 ng/mL human BMP4 (cat. #314-BP/CF-500, R&D Systems) in a low O2 (5%) incubator at 37°C. On day 4, the differentiation medium was changed to medium supplemented with 20 ng/mL recombinant human VEGF, 50 ng/mL human bFGF (cat. #064-04541, Fujifilm), 10 µM SB431542 (cat. #192-16541, Fujifilm), and 10 U/mL heparin (cat. #873334, Awai Pharma Co., Ltd.) and kept under low O2. On day 7, the differentiation medium was changed to medium without human bFGF and SB431542 (but including the other two factors at the same concentrations) and cultured in an atmospheric (20%) O2 incubator. Finally, on day 10, the medium was changed to medium without heparin (but including recombinant human VEGF at the same concentration). On days 14-15, PS-sacs were trypsinized with 2.5% trypsin-EDTA (cat. #209-16941, Fujifilm), gently crushed by pipetting, and passed through a 40-µm cell strainer. Cells were then spun down, resuspended in staining medium (2% FBS in PBS), and stained with anti-CD34 (cat. #343508, Biolegend) and anti-CD43 (cat. #343206, Biolegend) antibodies. FACS-sorted CD34+ CD43+ HPCs were cultured on a fresh C3H10T1/2 feeder layer in 24- or 96-well culture plates at a density of 1 × 105 cells/well for 24-well plates and 5 × 104 cells/well for 96-well plates and maintained in differentiation medium supplemented with 25 ng/mL SCF, 5 ng/mL TPO, 50 ng/mL M-CSF, 50 ng/mL GM-CSF, 25 ng/mL G-CSF, and 25 ng/mL IL-3 (all from R&D Systems).
Differentiation of vascular cells from iPSCs
iPSC-derived vascular cells were induced using a modified version of a previously established protocol 59,60. To generate VPCs, we took advantage of the previously established embryonic stem-sac method 28–31. iPSCs were dissociated into small colonies (< 100 cells) with the aid of CTK (PBS containing 0.25% trypsin, 1 mM CaCl2, and 20% KSR) and cultured on a C3H10T1/2 feeder layer in differentiation medium supplemented with 20 ng/mL recombinant human VEGF in an incubator at 37°C. The culture medium was changed with fresh medium every 3 days. On days 10-11, PS-sacs were trypsinized with 2.5% trypsin-EDTA, gently crushed by pipetting, and passed through a 40-µm cell strainer. Cells were then spun down, resuspended in staining medium, and stained with CD34 (cat. #343508, Biolegend), VEGF-R2 (CD309; cat. #359912, Biolegend), and TRA 1-60 (cat. #560173, BD Pharmingen) antibodies. FACS-sorted cells were seeded (CD34+ cells for VEC induction and CD34- VEGF-R2+ cells for VSMC induction) on a C3H10T1/2 feeder layer at a density of 1.5 × 104 cells/cm2 on a 24-well plate and maintained in differentiation medium supplemented with 10% FBS with (for VECs) or without (for VSMCs) 100 ng/mL recombinant human VEGF.
Differentiation of monocytes/macrophages from human peripheral blood derived mononuclear cells.
Peripheral blood from healthy donors and WS patients were obtained and purified to mononuclear cells according to our previous study 21. Peripheral blood-derived CD34 negative mononuclear cells were then stained with anti-CD33, anti-CD43, anti-CD14, and anti-CD11b antibodies followed by incubation for 30 min on ice in the dark, washed with cold staining medium, and sorted CD33+CD43+CD14+CD11b+ monocytes/macrophages using a BD FACSAria IIIu system (Becton Dickinson Japan, Tokyo, Japan).
Cell sorting and flow cytometric analyses
Cells were suspended in staining medium, incubated for 30 min with appropriate antibodies on ice in the dark, washed with cold staining medium, and sorted or analyzed using a BD FACSAria IIIu system (Becton Dickinson Japan, Tokyo, Japan) or BD FACS Canto II cytometer (Becton Dickinson Japan, Tokyo, Japan).
Giemsa staining
On day 21 of differentiation, iMφs were stained with Hemacolor (cat. #111661, Merec) according to the manufacturer’s protocol. Stained cells were air-dried and observed using a microscope (Nikon Eclipse Ts2R, Japan).
RT-qPCR
Total RNA was extracted using a RNeasy Micro Kit (cat. #74034, Qiagen, Hilden, Germany) and reverse-transcribed using SuperScript VILO™ Master Mix (cat. #11755250, Thermo Fisher Scientific, Waltham, MA). Primer sets were designed by our laboratory or purchased from Thermo Fisher Scientific. Quantitative real time PCR was carried out with SYBR™ Green PCR Master Mix (cat. #4472908, Applied Biosystems) using a Bio-Rad CFX real-time PCR system. Gene expression was analyzed relative to that of GAPDH.
Immunocytochemistry
For detection of intracellular proteins, vascular cells were cultured in four-well slide chambers (cat. #SCS-N04, Matsunami). On days 17-18 of differentiation, VECs or VSMCs were washed twice with PBS and fixed with 4% paraformaldehyde (cat. #161-20141, Fujifilm) in PBS for 10 min at room temperature. Cells were then washed three times with PBS and permeabilized with 0.1% Triton X100 (cat. #35501-15, Nacalai Tesque) and 10% FBS (Biosera) in PBS for 30-40 min, followed by blocking for at least 1 h at room temperature with Blocking One (cat. #03953-66, Nacalai Tesque). Blocked cells were incubated with primary antibodies diluted in blocking solution at 4°C overnight on a rotator. On the following day, after three washes with PBS, appropriate fluorescence-labeled secondary antibodies were added and incubated at room temperature for at least 1 h in the dark, after which cells were washed thoroughly with PBS and mounted on microscope slides using ProLong™ Diamond Antifade Mountant with DAPI (cat. #P36962, Invitrogen, Carlsbad, CA). Slides were allowed to air-dry before examination using a fluorescence microscopy (Nikon), and images were merged using Adobe Photoshop software. Primary antibodies were anti-α-SMA (1:1,000, cat. #ab7817, Abcam, Cambridge, UK), anti-calponin-1 (1:500, cat. #abt129, Merck-Millipore, Darmstadt, Germany), and anti-VE cadherin (1:500, cat. #ab33168, Abcam). Secondary antibodies were goat anti-mouse IgG H&L (cat. #ab150113, Abcam) and goat anti-rabbit IgG H&L (cat. #ab150078, Abcam).
oxLDL and acetylated low-density lipoprotein uptake assay
iMφs were serum-starved for 24-36 h in Iscove's Modified Dulbecco's Medium (IMDM) supplemented with 1% bovine serum albumin (BSA) on day 20 of differentiation. oxLDL labeled with 1, 1′-dioctadecyl-3,3′,3′- tetramethylindocarbocyanine (DiI; cat. #L34358, Invitrogen) was added to cells at a concentration of 50 μg/mL with IMDM containing 1% BSA and incubated for 5-6 h in a 37°C incubator.
iVECs and human aortic endothelial cells were serum-starved for 24-36 h in IMDM supplemented with 1% BSA on day 16 of differentiation (in the case of iVECs). Acetylated low-density lipoprotein labeled with DiI (cat. #BT-902, Alfa Aesar) was added to cells at a concentration of 50 μg/mL with IMDM containing 1% BSA and incubated for 5-6 h in a 37°C incubator.
Apoptosis assay by flow cytometry
On day 20 of differentiation, healthy- and WS-iMφs were serum-starved for 24-36 h, incubated for 5-6 h with DiI-oxLDL at a concentration of 50 μg/mL, and washed three times with PBS. Apoptosis assay was performed for untreated and oxLDL-treated iMφs using the FITC Annexin V detection kit (cat. #556547, BD Pharmingen) according to the manufacturer’s protocol and analyzed with a FACS CantoII cytometer (BD).
Senescence assay by flow cytometry
On day 20 of differentiation, healthy- and WS-iMφs were serum-starved for 24-36 h, incubated for 5-6 h with DiI-oxLDL at a concentration of 50 μg/mL, and washed three times with PBS. Senescent SA-β-gal+ cells were then detected among untreated and oxLDL-treated iMφs using the Cellular Senescence Flow Cytometry Assay Kit (cat. #CBA-232, Cell Biolabs, Inc.) according to the manufacturer’s protocol and analyzed with a FACS CantoII cytometer (BD).
Coculture of iMφs with iPSC-induced vascular cells
On day 20 of differentiation, iMφs were serum-starved for 24-36 h and incubated for 5-6 h with DiI-oxLDL at a concentration of 50 μg/mL. After washing three times with PBS, untreated or oxLDL-treated 7 × 104 iMφs (on a 24-well plate) were seeded onto iPSC-derived mature vascular cells (on day 17) and maintained with iMφ differentiation medium for 72 h until further analysis. Cell culture supernatant was collected and filtered with a 0.22-µm filter followed by ELISA to assess protein levels. Cells were then trypsinized with 0.05% trypsin-EDTA (Gibco), gently crushed by pipetting, spun down and resuspended in staining medium, and stained with CD14 (cat. #A22331, Backman Counter) for 30 min on ice in the dark. CD14- iPSC-derived vascular cells were then sorted for RT-qPCR gene expression analysis.
Mφ-VEC adhesion assay
On day 20 of differentiation, iMφs were serum-starved for 24-36 h and incubated for 6 h with DiI-oxLDL at a concentration of 50 μg/mL. After washing three times with PBS, untreated or oxLDL-treated 7 × 104 iMφs were seeded onto iPSC-derived mature vascular cells on day 17 and maintained with iMφ differentiation medium for 72 h until further analysis. Cells were gently washed with PBS three times, trypsinized with 0.05% trypsin-EDTA (Gibco), gently crushed by pipetting, spun down and resuspended in staining medium, and stained with CD14 for 30 min on ice in the dark. CD14+ Mφs were then counted with CountBright (cat. #C36950, Invitrogen) using a BD FACSAria IIIu system.
RNA-seq and analysis
On day 20 of differentiation, iMφs were serum-starved for 24-36 h and incubated for 6 h with DiI-oxLDL at a concentration of 50 μg/mL. Cells were then washed three times with PBS, suspended in staining medium, incubated for 30 min with anti-CD14 and anti-CD11b antibodies (cat. #301318, Biolegend) on ice, and washed with cold staining medium. oxLDL+ CD14+ CD11b+ cells were sorted into Buffer RLT Plus. Total RNA from untreated or oxLDL-treated healthy- and WS-iMφs was isolated using an RNeasy Micro Kit (QIAGEN). RNA-seq libraries were prepared from at least three biological replicates according to the manufacturer’s protocol. Briefly, ~10 ng total RNA was used as input for cDNA conversion using a SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (cat. #634890, Clontech, Takara). cDNA was fragmented using an S220 Focused-ultrasonicator (Covaris). The cDNA library was then amplified using a NEBNext® Ultra™ DNA Library Prep Kit for Illumina (cat. #E7370L, New England Biolabs). Finally, NEBnext library size was estimated using a bioanalyzer with an Agilent High Sensitivity DNA kit. Sequencing was performed using an HiSeq1500 (Illumina) with a single-read sequencing length of 60 bp. TopHat (version 2.1.1; with default parameters) was used to map to the reference genome (UCSC/hg19) with annotation data from iGenomes (Illumina). Levels of gene expression were quantified using Cuffdiff (Cufflinks version 2.2.1; with default parameters).
ATAC-seq and analysis
On day 21 of differentiation, untreated or oxLDL-treated healthy- and WS-iMφs were stained with anti-CD14 and anti-CD11b antibodies, incubated for 30 min on ice, and washed and sorted into 5 × 103 CD14+ CD11b+ cells in PBS containing 2% FBS. Library preparation for ATAC-seq was performed on 10,000 cells with a Nextera DNA Sample Preparation kit (cat. #FC-121-1030, Illumina) according to a previously reported protocol 39,40. Libraries for ATAC were sequenced with a HiSeq 2500 System (Illumina) to generate single-end 50-bp reads. Sequenced single-end reads were mapped to hg19. Duplicate, unmapped or poor-quality reads, mitochondrial reads, and overlaps with the ENCODE blacklist were removed. MACS2 was used to calculate accessible chromatin regions using the options –keep-dup all –nomodel –extsize147 –callsummits –q 0.05. Peaks identified in samples were merged to obtain common genomic coordinates. Peaks with at least 20 CPM in at least one sample were used for further analysis. DARs were calculated between groups of samples using DESeq2. NMF was performed on DARs using the R package “NMF”. Motif enrichment in DARs was performed using HOMER.
RTE enrichment analysis
Genomic coordinates of RTEs along with their names, classes, and families were downloaded from the UCSC Genome Browser using the Table Browser with “group” set to “Repeats” and “track” set to “RepeatMasker”. Each RTE was assigned reads obtained from the mapped RNA-seq samples within its genomic coordinates. Differentially expressed RTEs between sample groups were calculated using DESeq2.
Detection of total cellular ROS
On day 20 of differentiation, iMφs were serum-starved for 24-36 h and incubated for 6 h with 50 μg/mL DiI-oxLDL. Total cellular ROS was detected in untreated and oxLDL-treated iMφs with the CellROX Deep Red Flow Cytometry Assay Kit (cat. #C10491, Invitrogen) according to the manufacturer’s protocol and analyzed with a FACS AriaIII cytometer (BD).
Knock-down assay
Oligonucleotides of shRNA against IRF3, IRF7, DHX58, and LacZ (control) were inserted into CS-CDFRfa-EPR lentiviral vector plasmid DNA 42. The inserted oligonucleotide sequences were as follows:
shCtrl,
CCGGTGTTGGCTTACGGCGGTGATTTCTCGAGAAATCACCGCCGTAAGCCAACTTTTTG
shIRF3_921:
GATCCCCGCCAACCTGGAAGAGGAATTTCTCGAGAAATTCCTCTTCCAGGTTGGCTTTTTGGAAAT
shIRF3_923: GATCCCCGATCTGATTACCTTCACGGAACTCGAGTTCCGTGAAGGTAATCAGATCTTTTTGGAAAT
shIRF7_859: GATCCCCGCTGGACGTGACCATCATGTACTCGAGTACATGATGGTCACGTCCAGCTTTTTGGAAAT
shIRF7_862: GATCCCCCGCAGCGTGAGGGTGTGTCTTCTCGAGAAGACACACCCTCACGCTGCGTTTTTGGAAAT
shDHX58_264: GATCCCCCTGTTCGATGACCGCAAGAATCTCGAGATTCTTGCGGTCATCGAACAGTTTTTGGAAAT
shDHX58_482: GATCCCCGCCAGTACCTAGAACTTAAACCTCGAGGTTTAAGTTCTAGGTACTGGCTTTTTTGGAAAT
Obtained plasmid DNA was co-transfected with pMD2.G and psPAX2 (both from Addgene) into HEK293T cells using the CalPhos™ Mammalian Transfection Kit (Clontech). HEK293T cells were maintained in IMDM (Gibco) supplemented with 10% fetal calf serum and pen strep L-glutamine (PSG, cat. #10378-016, Gibco). After a medium change with IMDM (10% FBS, PSG, and 1 mM sodium butyrate (B5887, Sigma Aldrich)) on the next day, lentiviruses were concentrated using an Optima L-100 XP ultracentrifuge (Beckman Coulter, rotor type 19, 19000 rpm, 4.5 h, 4°C) and titrated on MOLM-13 AML cell lines.
dsRNA analysis by J2 staining
On day 21 of differentiation, 5 × 104 healthy- and WS-iMφs were washed in PBS and fixed with 4% paraformaldehyde for 10 min at room temperature. Cells were then permeabilized with permeabilization solution (PBS containing 0.1% Triton X-100) for 30 min at room temperature, after which cells were incubated with anti-dsRNA monoclonal antibody J2 (cat. #RNT-SCI-10010200, Jena Bioscience) diluted 1:40 in permeabilization solution for 30 min on ice. Following a wash with permeabilization solution, cells were stained with secondary goat anti-rabbit IgG H&L (cat. #ab150078, Abcam) diluted 1:200 in permeabilization solution for 30 min on ice in the dark. After incubation, cells were washed twice in permeabilization solution and analyzed with a BD FACS Canto II cytometer.
MAVS staining
On day 21 of differentiation, untreated or oxLDL-treated 5 × 104 healthy- and WS-iMφs were washed in PBS and fixed with 4% paraformaldehyde for 10 min at room temperature. Cells were then permeabilized with permeabilization solution for 30 min at room temperature. Cells were resuspended in permeabilization solution, and MAVS monoclonal antibody (ABM28H9) conjugated with APC (cat. #17-9835-41, eBioscience) was added to the cells followed by 30 min incubation on ice in the dark. After incubation, cells were washed twice in permeabilization solution and analyzed with a BD FACS Canto II cytometer.
Statistical analysis
All analyses were performed with three biological replicates with at least n = 3. Data are shown as mean ± standard error of the mean (SEM). One-way ANOVAs with Bonferroni post hoc tests were performed to determine statistical significance using GraphPad Prism 8 (GraphPad Software, Inc., La Jolla, CA, USA).