Animals
All animals were kept under a 12/12 h light/dark cycle and temperature (21-23°C) controlled environment and were fed ad libitum with a standard chow diet (5LOD, LabDiet, USA). Animal procedures were reviewed and approved by the University of Michigan Institutional Animal Care and Use Committee, in accordance with the National Research Council Guide for the Care and Use of Laboratory Animals. Mice were housed in an Association for Assessment and Accreditation of Laboratory Animal Care–accredited facility.
All mouse lines were maintained as homozygous, except for ErbB4-/+, which were generated from mating of ErbB4-/- males and ErbB4+/+ females. ErbB4-/- litters were cross-fostered to ErbB4+/+mothers for weaning. The genotypes of mice were confirmed by PCR detection of the transgenes in tail-derived DNA from the ErbB4+/+, ErbB4+/-, ErbB4-/-, ErbB4TUC/TUC, ErbB4 JMa-/- and each control mice at weaning and at the end of experiments.
For tissue harvesting, experiments were performed in 2–3 month-old mice. For embryonic harvesting, breeding cages of homozygous mouse lines (or ErbB4-/- males with ErbB4+/+ females for ErbB4-/+ embryos) were established, and confirmation of vaginal plugging was used for embryonic dating. Positive plug date has been denoted as embryonic day 0.5 (E0.5). Following vaginal plugging, females were euthanized at the indicated time points for embryonic tissue collection.
CRISPR/Cas9 gene editing to create mutant mice
Mouse lines were generated in collaboration with the Transgenic Animal Model Core, University of Michigan. Two single guide RNAs (sgRNA) (sequences: AAGTGGAATGGCCCGTCCAT and CGTGTTGTGGTAAAGTGGAA) were designed to create cut sites in the ErbB4-JMa sequence within Exon 16. These guides were expected to create a double strand break and introduce the ultramer oligonucleotide bearing the H641N;S642P mutations by homology directed repair, replacing the wild type sequence with the mutant sequence in exon 16. Alternatively, repair of the chromosome break by non-homologous end joining was expected to create other mutations in ErbB4 exon 16. The sgRNAs were co-injected into fertilized C57BL/6 eggs with the CRISPR/Cas9 components (px3330 plasmid, Addgene) and the ultramer oligonucleotide bearing the mutations. From more than 300 injections with both sgRNAs we received 39 putative founder mice. Sequencing analysis of ErbB4 Exon 16 identified 3 mice with the correct mutations (H641N;S642P) and 20 with other mutations. All founders with discernable H641N;S642P mutations and 12 other founders were crossed with wild type mice to create obligatory heterozygotes and ErbB4 Exon 16 sequence of the progeny was analyzed. Of the founders, one mouse had only the H641N;S642P mutation and 2 had progeny carrying a single base pair deletion that creates a premature termination codon within ERBB4 exon 16. Male and female heterozygote offspring from the founders were inbred to create homozygotes and back-crossed onto the C57Bl6 background. ErbB4-TUC (for the “TACE uncleavable” mice bearing the mutation H641N;S642P) and ErbB4-JMa- (for the mice bearing a premature termination codon which will result in NMD of ErbB4-JMa transcripts) were the names given to the alleles.
Genotyping mutant mice
To determine mutations in ERBB4 exon 16 of founder mice Sanger sequencing was carried out on PCR product of ERBB4 exon 16. PCR amplification of crude genomic lysates from ear biopsies was done using the following primers: Forward: AGA ATG TGG CGC ATC CAG TA; and Reverse: TGC TCT CAT AAT TCC AAT ATG TGC T
To genotype ErbB4-JMa-/- mice, the primers above were used to amplify exon 16 by PCR. The PCR product was then subjected to restriction enzyme digest with NcoI to create discernible products.
To genotype ErbB4TUC/TUC mice, two PCRs were carried out on crude genomic lysates using forward primers that are specific to the wild type sequence or the TUC mutations as follows: WT Forward Primer: GAC GGG CCA TTC CAC TTT A; TUC Forward Primer: ACC GGC AAT CCA ACA CTG C; and Universal Reverse Primer: TGC TCT CAT AAT TCC AAT ATG TGC TTT AAT C
ErbB4+/+, ErbB4-/+ and ErbB4-/+ mice were genotyped as described previously3,15
Cell culture and transfections
Human embryonic kidney (HEK-293) cells or mouse neuro 2A (N2A) cells were maintained in DMEM GlutaMAX (Gibco) with 10% fetal bovine serum (Atlanta) and 10 units/mL penicillin and 0.1 mg/mL streptomycin in a humidified 5% CO2/95% air incubator at 37°C. All transfections were carried out with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol.
Site-directed mutagenesis
Site-directed mutagenesis was carried out on the ErbB4-JMa-CYT2 plasmid in pcDNA3.1 using the QuikChange Site-Directed Mutagenesis Kit (Aligent) according to the guidelines. The following primers were used to create H641N;S642P: Forward: TAC TAC CCA ATG GAC GGC AAT CCC ACT TTA CCA CA; and Reverse: TGT GGT AAA GTG GGA TTG CCG TCC ATT GGG TAG TA.
Neural Precursor Cell Cultures
Timed pregnant females were euthanized via cervical dislocation at E14.5. Embryos were dissected in ice-cold phosphate-buffered saline (PBS) under sterile conditions, and the whole telencephalon without meninges was collected in a 15 mL conical tube containing PBS on ice. PBS was removed and cortices were dissociated into single cells with StemPro Accutase (ThermoFisher) for 5 min at RT, triturated then centrifuged at 2,000 rpm for 2 mins. Next, the pellets were resuspended in NPC media (DMEM GlutaMAX (Gibco) with 2% B27 without vitamin A (Invitrogen), 10 units/mL penicillin and 0.1 mg/mL streptomycin). NPCs were seeded as neurospheres in T75 flasks at 500,000 cells/mL and expanded for 2 days in NPC media supplemented with epidermal growth factor (EGF, 20 ng/mL) and basic fibroblast growth factor (bFGF, 20 ng/mL) in a humidified 5% CO2/95% air incubator at 37°C. Growth factors and B27 were replenished daily. On day 3, neurospheres were dissociated with Accutase (Invitrogen) into a single cell suspension and reseeded for NPC expansion or plated in NPC media supplemented with bFGF (20 ng/mL) onto plates coated with Poly-L-Lysine (Sigma) and Fibronectin (Corning).
To assess GFAP protein and mRNA levels, NPCs were plated at 500,000 cells per well in 12-well plate format. Half of the media was replaced after one day, replenishing bFGF, then on the second day all the media was replaced with or without bFGF (to induce astrocytic differentiation and GFAP expression) and treated with 2 nM NRG1 (R&D Systems) or vehicle. After 24 hrs, cells were lysed in 100 µl RIPA buffer (Sigma) on ice to assess protein levels by western blotting or total RNA was extracted according to RNeasy Mini Kit (Qiagen) for qRT-PCR.
Luciferase Assay
To assess GFAP promoter activity by luciferase assay, NPCs were plated at 800,000 cells per well in 24-well plate format. Half of the media was replaced after one day, replenishing bFGF and cells were co-transfected with a GFAP-promoter luciferase construct and CMV-Renilla3 at a 50:1 ratio using Lipofectamine 3000 (Invitrogen). After 24 hrs the media was replaced with or without bFGF and treated with 2 nM NRG1 (R&D Systems) or vehicle for 2 days with bFGF and NRG1 replenishment after 1 day. GFAP-promoter driven luciferase activity was measured using the Dual-Luciferase Assay Kit (Promega), following the manufacturer’s instructions on a BioTek plate reader. Relative values were obtained by normalizing firefly luciferase to Renilla luciferase in technical triplicates.
Western Blotting
Cells were treated as described and lysed with ice cold RIPA buffer (Sigma-Aldrich) or triton-based lysis buffer (Cell Signaling Technologies) with protease and phosphatase inhibitors (Invitrogen) for 10 min. Cerebellum tissue was incubated at 37°C for 45 mins prior to dounce homogenization in RIPA buffer. Lysates were vortexed and centrifuged at 14,000 rpm for 10 min and supernatant protein concentration was standardized via BCA assay (Pierce) and diluted in 4× Laemmli buffer (Bio-Rad) with 10% β-mercaptoethanol and run on 6% SDS polyacrylamide gels or 7.5% or 10% Mini-PROTEAN TGX Stain-Free Precast Gels (BioRad). Protein was transferred from the gel onto 0.45 µm pore PVDF membrane for 1.5 hr at 15 V with a semi-dry transfer unit. Membranes were then incubated in 5% bovine serum albumin (Sigma-Aldrich) in 0.2% Tween-20 in TBS (TBS-T) blocking solution for 1 hr and then primary antibody (1:1000, ErbB4, phospho-ErbB4, Erk, phospho-ERK, Cell Signaling Technologies; 1:1000 GFAP, Dako; 1:5000 GAPDH, Abcam) in blocking solution overnight at 4°C. The next day, blots were washed in TBS-T, then incubated in HRP-conjugated secondary antibody (1:1000 goat anti-rabbit or 1:1000 goat anti-mouse, Cell Signaling Technology) in blocking solution for 45 mins. All blots were exposed with SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Scientific) and imaged on a Bio-Rad Chemidoc and analyzed using Bio-Rad Image Lab software.
RNA extraction and quantitative RT-PCR
Following RNA extraction with Qiagen RNeasy Kit with on-column DNase digestion (Qiagen 74004), RNA concentration and quality was assessed on Bio Tek plate reader. 1 µg of RNA per sample was transcribed into cDNA using an iScript cDNA Synthesis Kit (Bio-Rad) following manufacturer’s instructions and diluted 1:4 in nuclease free water. Quantitative PCR was performed using iTaq SYBR Green Supermix (Bio-Rad) on a Bio-Rad CFX96 Thermocycler in 96 well format or an Applied Biosystems QuantStudio 5 Real-Time PCR System in 384 well format. Each well contained 5 μL iTaq SYBR Green Supermix, 3 pM of each forward and reverse primers and 2.5 μL diluted cDNA. The thermal cycler was run as follows as follows: 95°C for 30 s followed by 39 cycles of 95°C for 5 s and 60°C for 30 s. Normalized Gene Expression (NGE) was calculated using the efficiency of each primer with the following formula: [efficiency_target–CTtarget/efficiency_reference–CTref]. The primers used for qRT-PCR are listed in Table 2.
Immunoprecipitation
Cerebellum samples were obtained by dissection of adult mouse brain and stored in ice cold DMEM. Once all samples were collected, they were incubated at 37°C for 45 mins, washed on PBS and lysed in ice cold 500ul RIPA buffer (Invitrogen) using a dounce homogenizer, vortexed and then centrifuged for 10 mins at 14,000 rpm and the supernatant was collected.
NPCs were plated in 10 cm dishes at 4 million cells per dish, with two dishes per condition in bFGF-containing NPC media. After 2 days of growth, replenishing half the media and bFGF each day, cells were treated with 100 ng/mL TPA (12-O-Tetradecanoylphorbol-13-Acetate, Cell Signaling Technologies) for 45 mins, washed with ice cold PBS and lysed with 500ul lysis buffer (Cell Signaling Technologies). Lysates were subjected to 3 x 5 sec sonication using a probe sonicator, then centrifuged at 14,000 rpm for 10 min and supernatants were collected.
An ErbB4 WB was carried out on the supernatant to normalize input levels of total ErbB4 using 40 µl of the sample, while the remaining lysate was frozen at -80°C. Lysates were defrosted on ice and diluted to equal total ErbB4 levels in RIPA buffer (ErbB4-/- samples were diluted to the same protein level as the highest concentration sample). ErbB4-conjugated agarose beads (Santa Cruz) were washed in RIPA buffer and 30 μl beads were added to 500 μl of each sample and incubated at 4°C overnight with rotation. Beads were washed four times in RIPA buffer and the sample was eluted in 1.5x Laemmli sample buffer (Bio-Rad) for 5 mins at 95°C. Western blot was carried out with ErbB4 antibody (1:1000, ErbB4, Cell Signaling Technologies). Samples from input, IP and supernatant were analyzed by anti-ErbB4 Western blot to measure the levels of the 80 kD E4ICD and full length 180 kD ErbB4.
P0 Cortex Immunofluorescence
Whole brains were dissected from P0 pups in the afternoon following birth and fixed in 4% PFA at 4°C overnight and then cryopreserved in 30% sucrose in PBS for 2 days at 4°C. Brains were embedded in OCT Compound (Fisher) and snap frozen in isopentane on dry ice. Frozen brains were cryosectioned at 50 μm into antifreeze solution and stored at -20°C. Sections were washed/permeabilized in TBS 0.2% Triton (TBS-T) for 20 mins and blocked in 5% normal goat serum in TBS-T for 1 hour. Sections were then incubated overnight at 4°C in primary antibody (1:1000. GFAP, Dako) then washed in TBS-T at room temperature. Sections were incubated in secondary antibody (1:1000, Alexa fluor 564 nm goat anti-rabbit, Invitrogen) for 1 hr at room temperature then washed in TBS-T and coverslipped with Fluoro-Gel II with DAPI (Electron Microscopy Services) on Superfrost plus slides (Fisher). For analysis, confocal images were taken at a magnification of 63x at the same location in the ventricular zone with a 12 μm and a 2 μm interval z-step, by a blinded investigator. The average GFAP intensity per ventricular zone area was calculated using Fiji software. Biological replicates were the average of the left and right side of the cortex at the position indicated in the figure.
Neurofilament immunochemistry
Embryos were taken at E11.5 directly into 4% PFA and incubated overnight at 4°C, then kept at 4°C in 0.4% PFA. The following Embryos were washed in TNT, then dehydrated in a methanol grade and incubated in Dents solution (3% hydrogen peroxide, 70% methanol, and 20% DMSO) overnight. Embryos were incubated for 2 days TNT and for 2 days in 5% normal horse serum in TNT (HS-TNT) block, then for 5 days in 0.75 ug/mL 2H3 antibody (Developmental Studies Hybridoma Bank) in HS-TNT. Embryos were washed in TNT, then were incubated for 3 days in 1:250 horse anti-mouse IgG HRP-conjugated Ab (Vector Labs) in HS-TNT then washed in TNT. Signal was developed according to Vectastain DAB Kit (Vector Labs) then washed in TNT for 45 mins five times and dehydrated in a methanol grade. Tissue was cleared in BABB solution (1:2 benzyl alcohol/benzyl benzoate) and stored in BABB in glass containers. Images were taken on a dissecting microscope with camera at the magnifications indicated.
Mammary gland histology
At post-natal day 1 (P1) the number 4 inguinal mammary gland was dissected from the female mice. Mammary glands were spread onto Superfrost plus slides and fixed in 4% PFA overnight. Then, mammary glands were paraffin embedded and processed for haemotoxylin and eosin staining and imaged at 4x and 40x magnification using bright field microscopy.
Statistical Analysis
All statistical analyses were performed using GraphPad Prism 9.3.1, except for RNA-seq analysis, described below. For data with two groups, an unpaired t test was used. For data with multiple groups, an ordinary one-way ANOVA with Dunnett’s multiple comparisons to control ErbB4+/+ data was used. Normality was assessed using a Shapiro-Wilks test. Bars for each of the graphs represent mean ± SEM.
RNA-Sequencing and Analysis
Pregnant females were euthanized via cervical dislocation. E15.5 embryos were placed in ice-cold PBS, brains were dissected, and the cortical hemispheres were isolated. The meninges and ganglionic eminences were removed from the cortex, and the tissue was stored in RNAlater (Invitrogen) until RNA extraction. RNA was extracted from wild type (WT) and ErbB4 KO dorsal cortex using the Qiagen RNeasy Mini Kit with on-column DNase digestion (Qiagen), then analyzed with a BioAnalyzer to measure RNA quality. RNA with RNA integrity numbers (RINs) greater than 8 were sequenced (n = 4 of each genotype). Non-strand specific polyA-selected cDNA libraries were prepared. Single-end sequencing was then completed with read lengths of 50 nucleotides using an Illumina HiSeq-4000 Sequencing System. cDNA library preparation and sequencing were carried out by the University of Michigan DNA Sequencing Core. Sequences were mapped to the mouse genome (mm9) using HISAT, transcript counts obtained with HTseq-count, and differential gene expression analysis completed using DESeq2 with Galaxy software. p-Values adjusted for multiple comparisons (q-value) < 0.05 indicated genes with statistically significant differences. Differential expression data was submitted to Qiagen’s Ingenuity Pathway Analysis (IPA) software – version 70750971 (Qiagen Inc., https://digitalinsights.qiagen.com/IPA) using core analysis of up- and down-regulated expressed genes. Top-scoring enriched pathways, functions, upstream regulators, and networks for these genes were identified utilizing the algorithms developed for Qiagen IPA software based on Qiagen’s IPA database of differentially expressed genes48.
The datasets generated and analyzed during the current study have been submitted to NCBI Gene Expression Omnibus (GSE202063).