The role of KiSS1 gene on the tumor growth and migration of prostate cancer and the underlying molecular mechanisms

doi:10.21203/rs.3.rs-1615647/v1

Download PDF

Research

The role of KiSS1 gene on the tumor growth and migration of prostate cancer and the underlying molecular mechanisms

https://doi.org/10.21203/rs.3.rs-1615647/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background Prostate cancers have a very high mortality rate, with no improvement in the survival rate being achieved over the past few decades. KiSS1 was originally identified as the metastasis suppressor gene in metastatic melanoma breast cancer, but its role in prostate cancer has been contradictory. This study was therefore undertaken to investigate the effects of KiSS1 overexpression on the growth and migration of human metastatic prostate cancer cells.

Methods DU145 human metastatic prostate cancer cells were infected with the culture medium of 293T cells, which produce lentivirus particles containing KiSS1. The tumor spheroid formation assay, qPCR and immunoblotting analysis, migration and invasion assays were performed in this study following KiSS1 introduction. A xenograft mouse model was employed to investigate the overexpression of KiSS1 in prostate cancer in vivo.

Results A significant increase in proliferation of KiSS1-overexpressing cancer cells was observed, and these cells formed tumor spheroids larger than the vector control group. qPCR and immunoblotting revealed the association between increased cell growth and regulation of the PI3K/Akt and cell cycle genes, and also that increases in β-catenin and CD133 contribute to tumor aggregation. KiSS1 overexpression resulted in upregulation of the β-arrestin1/2 and Raf-MEK-ERK-NF-κB pathways via KISS1R. Moreover, the migration and invasion of KiSS1-overexpressing cells were determined to be faster than the control group, along with increased metastatic colonization of the KiSS1-overexpressing cancer cells. These were associated to the regulation of EMT gene expressions, such as E-cadherin and N-cadherin, and the upregulation of MMP9. In the xenograft mouse model, KiSS1 significantly increased the tumor growth, with upregulation of PCNA and Ki-67 in the tumor tissues. In addition, KiSS1 increased the angiogenic capacity by upregulating VEGF-A and CD31, both in vitro and in vivo.

Conclusion These results indicate that KiSS1 not only induces prostate cancer proliferation, but also promotes metastasis by increasing the migration, invasion, and angiogenesis of malignant cells.

KiSS1

Kisspeptin

Prostate cancer

EMT

Migration

Angiogenesis

Metastasis

Metastasis is the process through which cancer cells disseminate to different areas of the body [1]. Morphological transformation is required for primary cancer cells to initiate migration to other tissues, via a process known as epithelial-mesenchymal transition (EMT) [2, 3]. The transdifferentiated cancer cells invade nearby normal tissue and, after intravasation, migrate to distant organs via blood vessels or lymphatic vessels [4]. At a distant location, the cancer cells break out of the blood vessels through extravasation, and imbed and grow in the surrounding tissue until a tiny tumor forms (colonization) [5]. Creation of new blood vessels supplies blood to maintain the growth of metastatic tumors [6].

Prostate cancer is the second leading cause of death among malignancies in men, accounting for 15% of all cancer diagnoses [7, 8]. The incidence of prostate cancer is globally increasing, with no significant improvement in the survival rate over the past few decades [8, 9]. Due to the numerous blood vessels distributed in the prostrate, malignant prostate cells are able to disperse to bones or lymph nodes through these blood vessels and facilitate metastasis through peripheral lymph nodes [10, 11]. Advanced and metastatic prostate cancer is rarely treatable by surgical incision, with a poor prognosis due to micrometastasis [12, 13]. Moreover, due to its high resistance to chemotherapy and radiation therapy, prostate cancer is also classified as a disease with very large unmet needs [14, 15]. Research, therefore, needs to focus on reestablishing a treatment strategy to suppress the progression of metastatic prostate cancer, minimize side effects, and prevent recurrence. Anticancer therapy using genetically engineered stem cells (GESTECs) inhibits tumor development through tumor tropic effects in metastatic cancers [15, 16]. Gene therapy using the homing effect and tropic effect of stem cells exhibits efficacy by expressing therapeutic genes in target cancer cells, thereby leading to fewer systemic side effects and being advantageous in the treatment of metastatic cancers [17, 18]. In order to select genes that function as therapeutic genes and apply them clinically, it is cardinal to clearly understand their nature, as well as the functional and genetic changes caused by these gene expressions.

KiSS1 is a gene encoding the KISS1 (known as kisspeptin) protein that acts as a ligand for the G-protein coupled receptor, KISS1 receptor (KISS1R) [19, 20]. KiSS1 was originally identified as a metastasis suppressor gene in metastatic melanoma breast cancer, and reports indicate that activation of this gene suppresses tumor growth [21]. Thereafter, numerous researchers have investigated the effect of KiSS1 in different carcinomas, and it was found that KiSS1 plays a role as a metastasis suppressor in various malignancies including pancreatic cancer, colorectal cancer, bladder cancer, ovarian cancer, and lung cancer [22–26].

It is now clear that KiSS1 regulates the development and progression of several cancers, but interestingly, some researchers have raised the possibility that KiSS1 may act as an oncogene and a dual-action mechanism. For the first time, one study reported increased expression of KiSS1 in estrogen receptor (ER)α-negative breast cancer as compared to ERα-positive breast cancer, and breast tumors that metastasized to lymph nodes showed higher KiSS1 levels than lymph node negative tumors [27]. Tamoxifen-treated ERα-positive MCF7 and T47D breast cancer cells had down-regulated kisspeptin/KISS1R levels, and increased expressions of KISS1R correlated more with metastasis than tumor growth [28, 29]. In addition, KISS1R signaling increased the expressions of Ak strain transforming (Akt), extracellular-signal-regulated kinase (ERK), and survivin, and stimulated the invasion of triple negative breast cancer (TNBC) cells via β-arrestin2 and ERK [28, 30]. Moreover, the in vivo evidence that haploinsufficiency in KISS1R inhibited the development and metastasis of breast cancer tissue raised the possibility of the role of KiSS1 as a metastasis promoter [31]. Consistent with these findings in breast cancer, increased KiSS1 mRNA and protein levels were observed in tumor tissues of liver cancer patients, which correlated with adverse prognosis and survival rates [32, 33].

To date, few studies have investigated the role of KiSS1 in prostate cancer, and the findings have been contradictory. In particular, researches investigating the functional and mechanistic roles related to the development and metastasis of prostate cancer by regulating the expression of KiSS1 gene and identifying their correlations are very limited. The expression of kisspeptin was low in tumor or prostate tissue samples from prostate cancer patients, and reports indicated a negative correlation with clinical staging [34]. In contrast, another study observed no significant differences in plasma kisspeptin levels in 92 prostate cancer patients [35]. Signal transduction systems in prostate cancer cells are very complex, interconnected, and have various heterogeneities, highlighting the need for further examination. Furthermore, since the effects of KiSS1 revealed to date may be dependent on the carcinoma, micro-environment and steroid receptors, efforts are needed to determine the exact role of this gene in prostate cancer.

Based on these interesting findings, we speculated that KiSS1 may have multiple unexplained signaling pathways in prostate cancer metastasis. This study therefore undertook to investigate the roles and molecular mechanisms of KiSS1 on cell growth and migration in human metastatic prostate cancer cells.

Cell culture and medium preparation

DU145 human metastatic prostate cancer cell line was purchased from Korean Cell Line Bank (KCLB; Seoul, Republic of Korea). 293tsA1609neo (293T) cells line was purchased from American Type Culture Collection (ATCC; Manassas, VA, USA). These cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% heat inactivated fetal bovine serum (FBS; Biowest Nuailléa, France), 1% antibiotic-antimycotic solution (Welgene, Gyeongsan, Republic of Korea) and 0.01 M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Welgene) at 37°C in the humidified CO₂ incubator. When cells reached approximately 70–80% confluence, they were trypsinized with 0.1% Trypsin-ethylenediaminetetraacetic acid (EDTA) (Invitrogen Life Technologies Inc., Carlsbad, CA, USA) for 5 min at 37°C, then subcultured at a split ratio of 1:8 (DU145 cells) and 1:10 (DU145-KiSS1 cells and 293T cells).

Human umbilical vein endothelial cells (HUVECs) were purchased from PromoCell GmbH (Heidelberg, Germany) and cultured in endothelial cell growth medium (PromoCell GmbH). Referring to our previous study [36, 37], HUVECs were immortalized by simian virus 40 (SV40) large T antigen in the second passage, and an SV40-HUVEC line was established. The SV40-HUVECs were also cultured in endothelial cell growth medium, when cells reached approximately 70–80% confluence, they were trypsinized with 0.05% Trypsin-EDTA for 3 min at 37°C, then subcultured at a split ratio of 1:3.

Establishment of stable cell line overexpressing KiSS1 gene

Transduction of the KiSS1 gene into 293T cells was performed according to the manufacturer's manual (Origene, Rockville, MD, USA). For transformation, we made 293T cells that stably expressed the lentviral vector pLenti-C-mGFP-P2A-Puro (Fig. 2A) as a lentivirus packaging. 293T cells were plated at a cell density of 5×10⁵ cells/well in 6-well plate. In a 1.5 mL tube, 1 µg of KiSS1 cDNA clone (pLenti-ORF expression construct), packaging plasmids and 6.6 µL of TurboFectin transfection reagent (Origene) were diluted in 250 µL of Opti-MEM (Gibco, Waltham, MA, USA), and the transfection mixture was gently mixed completely. The transfection mixture was incubated for 15 min at room temperature. The transfection mixture was added to the 293T cells and incubate for 18 h at 37°C in the humidified CO₂ incubator. The lentivirus-containing medium was collected, passed through a 0.22 µm low protein binding filter (Millipore, Darmstadt, Germany), at the half-confluent condition then, transferred to DU145 cells (50–60% confluency) with polybrene (10 µg/mL) (Sigma-Aldrich Inc., Saint Louis, USA) used to increase efficiency of lentivirus infection. After infection for 18 h, the lentivirus-containing medium was replaced with fresh cell culture medium and further incubated for 2 days. Transfectants were selected with antibiotics free-medium (DMEM supplemented with 10% FBS) containing puromycin (10 µg/mL; Sigma-Aldrich Inc.) for 48 h, and was selected 3 times. In this study, the DU145 cell line overexpressing the KiSS1 gene was named DU145-KiSS1 cell. For vector control group, mock transfection was performed without adding only KiSS1 cDNA clone.

Cell counting

Cell proliferation was measured by counting cells. The cells were seeded at a cell density of 1×10⁵ cells/well in 6-well plates (SPL Life Sciences Co., Ltd., Pocheon, Republic of Korea) and incubated at 37°C in the humidified CO₂ incubator. After 4 days (96 h), the number of cells was measured using EVE™ Automatic Cell Counter (NanoEntek, Seoul, Republic of Korea). The experiments were conducted independently three times, and the results all showed similar trends.

Tumor spheroid formation

The cells were seeded at a cell density of 2×10³ cells/well with 200 µL of cell culture medium in ultra-low attachment plate (96-well type, round bottom clear; Corning Inc., Corning, NY, USA). To minimize evaporation of the culture medium, the edge wells of the plate were filled with Dulbecco’s phosphate buffered saline (DPBS; Welgene). At the center of the round bottom, the cells were aggregated and formed tumor spheroids. After 1, 3, and 7 days, the tumor spheroids were photographed using a phase-contrast microscope (IX73, Olympus, Tokyo, Japan). The area of tumor spheroids was quantified by cellSens Dimension software (ver. 1.18; Olympus). The experiments were conducted independently three times, and the results all showed similar trends.

Transwell migration assay

To assess the migratory ability of the cells, migration assay was used as previously described, with slight modification [38, 39]. To prevent changes in the number of cells by cell division, the cells were treated with 12.5 µg/mL of Mitomycin C (MMC) for 2 h. After staining with 10 µg/mL of Hoechst 33342 for 10 min, the cells were seeded at a cell density of 2×10⁴ cells/well in the upper chamber of a transwell insert (8 µm pore; BD Biosciences, Franklin Lakes, NJ, USA) in a total of 200 µL of DMEM media containing 10% FBS. The lower chamber was added with 500 µL of DMEM media containing 15% FBS. The cells were then incubated at 37°C with 5% CO₂ for 72 h. Blue fluorescence of the cells that migrated from the upper chamber to the bottom chamber were photographed using a fluorescence microscope (IX73, Olympus) at ×100 magnification. The experiments were conducted independently three times, and the results all showed similar trends.

Transwell invasion assay

To assess the invasive ability of the cells, transwell invasion assay was used with slight modification [38, 39]. To prevent changes in the number of cells by cell division, the cells were treated with 12.5 µg/mL of MMC for 2 h. The cells were then stained with 10 µg/mL of Hoechst 33342 for 10 min. After 50 µL of fibronectin (250 µg/mL; Sigma-Aldrich Inc.) pre-coating of the bottom of a transwell (8 µm pore, BD Biosciences), the cells were seeded at a cell density of 2×10⁴ cells/well in the upper chamber of a transwell insert in a total of 200 µl of DMEM media containing 10% FBS. Fibronectin was used as extracellular matrix (ECM). The lower chamber was added with 500 µL of DMEM media containing 15% FBS. The cells were then incubated at 37°C with 5% CO₂ for 72 h. After invading the fibronectin layer from the upper chamber, the blue fluorescence of cells that migrated to the bottom chamber were photographed using a fluorescence microscope (IX73, Olympus) at ×100 magnification.

Collagen invasion assay

To test the ability of tumor spheroids to penetrate the ECM, a collagen invasion assay was performed with slight modifications referring to previous study [40]. MMC-treated cells were seeded at a cell density of 5×10³ cells/200 µL/well in ultra-low attachment plates (96-well type, round bottom clear; Corning Inc.) and tumor spheroids were formed for 72 h. Native collagen derived from bovine dermis (KOKEN; Tokyo, Japan) was mixed with cell culture media at a ratio of 2:1, and 50 µL of collagen mixture placed in a round bottom 96-well plate (SPL Life Sciences Co., Ltd.) was solidified in 37°C incubator for 2 h. One spheroid per well was transferred to a round bottom 96-well plate coated with collagen, and 200 µL of cell culture medium was added. To minimize evaporation of the culture medium, the edge wells of the plate were filled with DPBS (Welgene). Images of tumor spheroids were taken using a phase-contrast microscope (IX73, Olympus) every 24 h and for up to 96 h. Invasion area of tumor spheroids was quantified by cellSens Dimension software (ver. 1.18; Olympus), and the invasion area was normalized as initial area.

In vitro metastasis assay

To evaluate the ability of primary cancer cells to metastasize and then form secondary tumors at metastatic site, we developed an in vitro metastasis assay. After coating the outer bottom surface of the 96-well type transwell insert (Corning Inc.) with 12.5 µg/50 µL of fibronectin, the transwell inserts were mounted one by one on an ultra-low attachment plate (round bottom clear; Corning Inc.) (Fig. 1A). To minimize evaporation of the culture medium, the edge wells of the plate were filled with DPBS (Welgene). MMC-treated cells were seeded in the upper chamber of the transwell at a density of 2 × 10⁴ cells/100 µL/well, and 180 µL of cell culture medium was added to the bottom chamber (Fig. 1B). The spheroids formed in the bottom chamber were photographed using a phase-contrast microscope (IX73, Olympus) every 24 h and for up to 96 h. The area of spheroids was quantified by cellSens Dimension software (ver. 1.18; Olympus).

Tube formation assay

To evaluate the ability of KiSS1 overexpressing cancer cells for angiogenesis, a tube formation assay was used using SV40-HUVECs with slight modifications based on previous study [41]. DU145 cells (vector control) or DU145-KiSS1 cells were seeded in a 6-well plate (SPL Life Sciences Co., Ltd.) at a density of 5×10⁵ cells/well, and the cell culture medium was replaced with an endothelial cell growth medium after 2 h of cell adhesion. After 24 h of incubation with endothelial cell growth medium, the medium was harvested after 0.22 µm filtration (Millipore). Two hundred-fifty µl mixture of cold media and Matrigel (Corning Inc.) (1:4 ratio) was dispensed in each well of 24-well plates (Corning Inc.), and hardened for 30 min in 37°C incubator. SV40-HUVECs were stained with 2 µg/ml of Calcein-AM (Invitrogen Life Technologies), and the cells were seeded at a density of 7.5×10⁴ cells/100 µL/well with the cancer cell culture medium in the Matrigel coated plates. After 3 h, SV40-HUVECs formed tubes, observed using a fluorescence microscope (IX73, Olympus) at ×100 magnification.

Mouse line and husbandry

Five-week-old athymic nude mice (Foxn1^nu) were purchased from KOATECH (Pyeongtaek, Republic of Korea), and maintained at the Laboratory Animal Research Center of Chungbuk National University under specific pathogen-free conditions. The mice were housed in a temperature- and humidity-controlled environment under a 12-h light-dark cycle, and all animal experiments were performed during the light cycle. All animal experiments were approved by Institutional Animal Care and Use Committee (IACUC) at Chungbuk National University (CBNUA-1565-21-01).

Establishment of xenograft mouse model

After a one-week acclimatization, DU145 cells (vector control) or DU145-KiSS1 cells were mixed 1:1 in Matrigel, and 200 µL of the cell mix was inoculated subcutaneously in right upper flank of mice (3×10⁶ cells/mouse; n = 6 per group). Tumor volume was measured using a digital caliper (CD-15APX; Mitutoyo Korea, Gunpo, Republic of Korea) every 2–3 days from 5 days after cancer cell inoculation, and calculated by shortest diameter²×longest diameter×0.5236 (mm³). Body weight of mice was also measured on the same day. On day 19 post-inoculation, all mice were sacrificed, and tumor tissues were weighed and fixed in 4% paraformaldehyde solution (GeneAll Biotechnology, Seoul, Republic of Korea) for histological analysis. The representative organs (lung, liver, spleen and kidney) of mice were weighed immediately after sacrifice.

Histological analysis (IHC and H&E staining)

Immunohistochemistry (IHC) was performed with some modifications based on our previous work [42]. The fixed tumor tissues were embedded in paraffin and cut into 4 mm sections. Tumor tissue sections deparaffinized in xylene (OCI, Seoul, Republic of Korea) were rehydrated according to the ethanol (OCI) concentration gradient. Antigen retrieval was achieved by rehydrating the slides, followed by incubation with 10 mM sodium citrate buffer (pH 6.0; Sigma-Aldrich Inc.) at 100°C for 10 min. After removal of endogenous peroxidase with 3% hydrogen peroxide (Sigma-Aldrich Inc.), blocking was performed with 5% bovine serum albumin (BSA; RMBIO, Missoula, MT, USA). The tissue sections were subsequently incubated 18 h with primary antibodies against proliferating cell nuclear antigen (PCNA; Biolegend, San Diego, CA, USA), Ki-67 (Biolegend), vascular endothelial growth factor-A (VEGF-A; Bioss Inc., Woburn, MA, USA) or cluster of differentiation 31 (CD31; Santa Cruz Biotechnology, Dallas, TX, USA) at 1:50, followed by incubation with biotinylated goat anti-mouse or anti rabbit IgG antibody (H + L) at 1:100 for 1 h. Then, the tissue sections were reacted with Avidin-biotin peroxidase complexes (Vector Labs, Burlingame, CA, USA) for 30 min. A 3,30-diaminobenzidine (DAB) kit (Vector Labs) was used to visualize the peroxidase, and a counterstain was performed with hematoxylin (Sigma-Aldrich Inc.).

Hematoxylin and eosin (H&E) stain was performed for pathological analysis of tumor tissue. The tumor tissue sections that had undergone the above-mentioned rehydrating process were stained with hematoxylin and eosin (Sigma-Aldrich Inc.). All slides were observed under a bright microscope (IX73, Olympus), and representative images were selected.

Total RNA extraction and cDNA synthesis

DU145 cells (vector control) or DU145-KiSS1 cells were seeded 100 mm cell culture dish. When cells reached approximately 80–90% confluence, total RNA was isolated from cells using TRIzol reagent (Invitrogen Life Technologies), following the manufacturer’s instructions. A RNA pellet was dissolved in 50–100 µL of UltraPure™ DNase/RNase-Free Distilled Water (Gibco). Total RNA concentration was measured with a microreader (BioTek Instruments Inc.) at 260/280 nm. cDNA synthesis was done using an PrimeScript RT Master Mix (Takara Bio Inc., Kusatsu, Japan), following their instructions. cDNA synthesis was performed at 37°C for 15 min, and the enzyme was inactivated at 95°C for 5 sec.

Quantitative reverse transcription polymerase chain reaction (RT-qPCR)

For quantitative analysis on the mRNA expression, the cDNA was amplified using 10 pmole/µL of each forward, reverse primer (Bioneer Co., Dae-Jeon, Republic of Korea) and TB Green Premix Ex Taq II (Takara Bio Inc.). qPCR was carried out for 40 cycles of 95ºC for 15 s, 58ºC for 60 s using QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). Table 1 shows the sequence of each primer used in this study. The housekeeping gene GAPDH was used as the internal control. The ΔCt was calculated using the following the formula: ΔCt = Ct (target gene) – Ct (GAPDH). Then, the ΔΔCt was calculated using the following the formula: ΔΔCt = ΔCt (transfected group) – ΔCt (vector control). Finally, expression of each sample as 2^−ΔΔCt was calculated.

Table 1

Primer sequences for RT-qPCR
Primer	Sequences (5'→3')
GHPDH	Forward: GGTTTCCATAGGACCTGCTG Reverse: TCTTGGGTGTCTCGTCTTCT
KiSS1	Forward: AGCAGCTAGAATCCCTGGG Reverse: GTTCCAGTTGTAGTTCGGCA
Akt3	Forward: TAGATGGGTAGGATGGCTGG Reverse: CTCAAATTTGGCCGTGTGAC
PIK3R1	Forward: ATGGTTGTTGTTCCCTGTCC Reverse: AGGCAGGAATTTGTGAAGCA
HRAS	Forward: AGCAGATCAAACGGGTGAAG Reverse: CATCAGGAGGGTTCAGCTTC
NRAS	Forward: CTTGAGGTTCTTGCTGGTGT Reverse: TGGTCTCTCATGGCACTGTA
B-RAF	Forward: GAGTCTTCCTGCCCAACAAA Reverse: TCCAACACTTCCACATGCAA
CCNE1	Forward: GCACTTTCTTGAGCAACACC Reverse: TCCTCAAGTTTGGCTGCAAT
CDKN2A	Forward: CCCCACTACCGTAAATGTCC Reverse: CAAGAGAAGCCAGTAACCCC
PTEN	Forward: AGATGGCACTTTCCCGTTTT Reverse: TCGGAAACCTCTCTTAGCCA
CXCR4	Forward: CCTGCCTGGTATTGTCATCC Reverse: CTCAAACTCACACCCTTGCT
CTNNB1	Forward: TGCAGTTATGGTCCATCAGC Reverse: CCTCACGATGATGGGAAAGG
EZH2	Forward: GACCACAGTGTTACCAGCAT Reverse: TTTCAGTCCCTGCTTCCCTA
BMP7	Forward: CATCCTAACCAAGTGTCCCG Reverse: ACATGGCCACAGTTTTCGAT
SNAI2	Forward: GCGATGCCCAGTCTAGAAAA Reverse: CATGCAAATCCAACAGCCAG
CDH1	Forward: TGACAACAAGCCCGAATTCA Reverse: TGACCACACTGATGACTCCT
CDH2	Forward: TGGATGAAGATGGCATGGTG Reverse: TCTGCTGACTCCTTCACTGA
VEGF-A	Forward: CCTAACCCCAGCCTTTGTTT Reverse: CAGCGTGGTTTCTGTATCGA
PECAM-1	Forward: CTGACCATCTGCTCTCACAC Reverse: TTCTGTCTCTGAGCCACTGA

To visualize the amplified KiSS1 genes, PCR products in which the KiSS1 gene was amplified were separated in a 1.5% agarose gel and the gels were scanned using Lumino Graph 2 (ATTO Corporation, Tokyo, Japan).

Automated capillary-based western immunoblot

The proteins were extracted using radio immunoprecipitation assay (RIPA) buffer (ATTO corporation) from the cells. Protein concentration was determined by a bicinchoninic acid (Sigma-Aldrich Inc.) assay at 562 nm. Immunoblotting was conducted on a JESS™ Simple Western automated nano-immunoassay system (ProteinSimple, San Jose, CA, USA), and a capillary based size separation of proteins was used with an internal system control. The protein that extracted from the cells were processed according to the manufacturer’s standard method for the 12–230-kDa Jess separation module. Briefly, a mixture of proteins, fluorescent 5× master mix, 400 mM dithiothreitol (ProteinSimple) and biotinylated molecular weight markers was prepared, and then denatured at 95 ◦C for 5 min. Primary antibodies were diluted with antibody diluent, Table 2 shows the information of the antibodies used in this study. HRP-conjugated anti-mouse and rabbit secondary antibodies included in this kit were used. For chemiluminescence detection, luminol-peroxide mix was prepared. Assay protocol was as follows: 25 min for separation time, 375 V for separation voltage, 20 min for blocking time, 45 min for primary antibody incubation, 45 min for secondary antibody incubation. The Compass Simple Western software (version 6.0.0, ProteinSimple) was used to capture the digital image of the capillary chemiluminescence. Band intensity was quantified with CSAnalyzer4 software (ATTO Corporation). All protein expression levels were normalized to the levels of GAPDH protein expression in each band. Statistical analysis was performed only for blots with a sample number of 3 or greater.

Table 2

List of primary antibodies used in automated capillary-based western immunoblot
Antigen	Type	Dilution	Manufacturer	Catalog number
GAPDH	MM	1:100	Abcam	ab8245
Cyclin E1	MM	1:100	Abcam	ab3927
p21	MM	1:100	Cell Signaling Technology	2946
p27	RM	1:100	Abcam	ab32034
PCNA	MM	1:100	Biolegend	307901
p85α	MM	1:20	Santacruz	sc-1637
p-Akt^Ser473	RM	1:100	Cell Signaling Technology	4060T
Akt 1/2/3	RM	1:100	Abcam	ab179463
β-catenin	MM	1:100	Biolegend	862602
CD133	MM	1:100	Biolegend	372802
KiSS1R	RM	1:20	Cell Signaling Technology	13776
β-arrestin1/2	MM	1:100	Santacruz	sc-74591
p-Raf^Ser445	RP	1:100	Cell Signaling Technology	2696T
B-Raf	RM	1:100	Cell Signaling Technology	14814
p-MEK1/2^Ser217/221	RM	1:20	Cell Signaling Technology	9154T
MEK1/2	MM	1:100	Cell Signaling Technology	4694
p-ERK1/2^{Thr202/Tyr204}	MM	1:100	Biolegend	369501
ERK1/2	RM	1:100	Cell Signaling Technology	4695T
p50	MM	1:100	Biolegend	616701
p65	MM	1:20	Biolegend	653001
E-cadherin	RP	1:20	Abcam	ab15148
N-cadherin	MM	1:100	Biolegend	844702
Slug	MM	1:100	Santacruz	sc-166476
MMP9	RM	1:100	Abcam	ab76003
VEGF-A	RP	1:100	Bioss	bs-0279R
CD31	MM	1:100	Santacruz	sc-376764
MM: Mouse monoclonal; RM: Rabbit monoclonal; RP: Rabbit polyclonal

Statistical analysis

All experiments were run at least three times, and all data presented as means ± standard error of the mean (SEM). Data from the experiments were statistically analyzed by Student's t-test, or multiple t-test using the GraphPad prism 7.0 software (GraphPad Software Inc., San Diego, CA, US). Statistical significance was presented at * (p < 0.05), ** (p < 0.01) or *** (p < 0.001).

Overexpression of KiSS1 in metastatic prostate cancer cells and characterization

To investigate the role of KiSS1 in metastatic prostate cancer, we first established the DU145-KiSS1 cell line overexpressing KiSS1 in the DU145 human metastatic prostate cancer cell line (Fig. 2). DU145-KiSS1 cells expressed the KiSS1 gene 2,485 times higher than the control vector-inserted cells (Fig. 2B). Moreover, the KiSS1 overexpressing cells showed mesenchymal morphology, as compared to the vector control (Fig. 2C). Based on this morphological alteration of the cells by KiSS1 overexpression, we questioned whether KiSS1 overexpression affects the metastatic capacity of prostate cancer cells. To address this question, we investigated the effects of KiSS1 on cell proliferation, followed by examination of the effects on the migratory and invasive ability.

KiSS1 increases the proliferation of prostate cancer cells

The effects of KiSS1 were first investigated on cell proliferation and tumor spheroid formation (Fig. 3). We observed a 2.5-fold increase in the proliferation of DU145-KiSS1 compared to the vector control (Fig. 3A), which correlated with the expressions of genes that regulate the cell cycle (CCNE1 and CDKN2A). Immunoblotting revealed that KiSS1 overexpression also upregulates the protein levels of Cyclin E1 and PCNA, and downregulates the protein expressions of p21 and p27 (Fig. 3B and D). In addition, KiSS1 increased the gene expressions of the phosphoinositide 3-kinase (PI3K) regulatory subunits p85α and Akt3, increased the gene expressions of the Harvey rat sarcoma oncogene homolog (HRAS) and neuroblastoma rat sarcoma viral oncogene homolog (NRAS) among the rat sarcoma (RAS) gene family, and also increased the expression of the B-BAF gene (Fig. 3C). Changes in the mRNA levels of p85α and Akt induced alterations in the translation level and increased protein levels of p85α and total Akt (Fig. 3E). Interestingly, KiSS1 not only increased the total-form of Akt, but also phosphorylation of the serine 473 site (Fig. 3E). Moreover, a significant increase was obtained in the p-Akt/Akt ratio, suggesting that KiSS1 increases not only the protein level of Akt, but also signal transduction through phosphorylation (Fig. 3E). These results indicate that KiSS1 overexpression increases the proliferation of prostate cancer cells by increasing the expressions of cell cycle-related genes and PI3K/Akt activity.

We further observed that the ability of prostate cancer cells to aggregate and form spheroids is significantly promoted by KiSS1 in a time-dependent manner (Fig. 3F). The vector control cells start to aggregate on the 4th day after seeding, whereas the KiSS1 overexpressing cells aggregate and form spheroids just one day after seeding (Fig. 3F). Based on the previous study reports that cancer stem cells promote tumor formation [43–45], we attempted to determine whether the expression of cancer stem cell markers is altered in the DU145-KiSS1 cells (Fig. 3G and H), and observed that KiSS1 overexpression significantly increases the expressions of β-catenin and cluster of differentiation 133 (CD133) (Fig. 3H). Particularly, both mRNA and protein expressions were increased for β-catenin (Fig. 3G and H). We therefore speculated that increased tumor spheroid formation by KiSS1 is associated with increased cancer stem cell markers.

KiSS1 regulates KISS1R-mediated downstream signaling

Given that KiSS1 is translated into kisspeptin (a ligand of KISS1R), we investigated changes in the protein levels involved in the KISS1R-mediated signaling pathways (Fig. 4). There was a 2-fold increase in the protein level of KISS1R (Fig. 4A), and the total protein levels of β-arrestin1 and β-arrestin2 (downstream proteins of KISS1R) were significantly increased in DU145-KiSS1 cells (Fig. 4B). Examination of the Ras-Raf-MEK-ERK pathway with KiSS1 overexpression revealed that both, the protein levels and phosphorylation of Rapidly Accelerated Fibrosarcoma (Raf), Mitogen-activated protein kinase (MEK) and ERK, were increased in DU145-KiSS1 cells (Fig. 4C-E). Therefore, similar to the results obtained in Fig. 3E, we considered that KiSS1 promotes signal transduction by increasing both the translation and phosphorylation of Raf, MEK, and ERK. Furthermore, we observed that both p65 and p50, which are subunits of nuclear factor kappa light chain enhancer of activated B cells (NF-κB), were significantly increased via the NF-κB signaling pathway (Fig. 4F and G). These results imply that overexpression of KiSS1 activates KISS1R and increases the expression of NF-κB via the β-arrestin1/2 and Raf-MEK-ERK pathways.

KiSS1 increases metastatic capacity by increasing migratory and invasive ability of prostate cancer cells

Next, we investigated whether KiSS1 affects the migratory and invasive ability of metastatic prostate cancer cells (Fig. 5). We observed that DU145-KiSS1 cells migrated faster than vector control cells, along with a relatively increased invasive ability (Fig. 5A). The collagen invasion assay performed to evaluate the ability of prostate cancer cells to penetrate the ECM (Fig. 5B and C) revealed that the spheroids formed from DU145-KiSS1 cells penetrated the collagen relatively faster in all directions (Fig. 5B), and this invasion area increased significantly in a time-dependent manner (Fig. 5C). In general, since metastasis involves the dissemination of cancer cells and results in metastatic colonization, the metastatic ability of cancer cells can therefore be predicted by evaluating the ability to form spheroids at metastatic sites. As presented in Fig. 5D, the DU145-KiSS1 cells which migrated from the upper chamber to the bottom chamber (metastatic sites) aggregated relatively faster and rapidly formed spheroids. In contrast, vector control cells had relatively slower spheroid formation, due to lesser aggregation and wider distribution in the bottom chamber (Fig. 5D). We determined a statistically significant increase in the metastasized area of DU145-KiSS1 cells (Fig. 5E).

To further investigate the mechanism of the migratory and invasive ability of prostate cancer cells increased by KiSS1 overexpression, the expressions of EMT markers and matrix metallopeptidase 9 (MMP9) were further determined (Fig. 5F-J). Our results revealed that the expression of epithelial cadherin (E-cadherin), an epithelial marker, decreases at both the mRNA and protein levels (Fig. 5F and G), whereas the mRNA and protein expressions of neural cadherin (N-cadherin), a mesenchymal marker, were increased (Fig. 5F and H), and slug expression was increased only at the mRNA level (Fig. 5F and I). In addition, the protein level of MMP9, a type IV collagenase that degrades ECM, was determined to be significantly increased (Fig. 5J). These results indicate that KiSS1 increases the migratory and invasive ability by inducing expressions of the EMT genes and proteins, and the protein expression of MMP9, thereby consequently increasing the metastatic capacity.

KiSS1 increases prostate tumor growth in vivo

To investigate the effect of KiSS1 on tumor growth, vector control cells and DU145-KiSS1 cells were inoculated into athymic mice, and the tumor growth was monitored for 19 days (Fig. 6). We observed that compared to the control, KiSS1 overexpression induces a statistically significant increase in tumor growth from 5 days after inoculation (p < 0.05, 2.7-fold), and after 19 days, the tumor volume was increased approximately 25-fold (Fig. 6A-B). Similar to the data of tumor volume, macroscopic observation revealed that KiSS1 overexpression significantly increases the tumor weight (Fig. 6C), and induces a remarkable difference in size (Fig. 6D). However, no significant differences were obtained for body weight or weight of organs such as lung, liver, spleen and kidney (Fig. 6E-G). Macroscopic examination of all organs by necropsy revealed no metastasis of the subcutaneously xenografted cancer cells (data not shown). Histological analysis of the specimens revealed higher expressions of the tumor proliferation index markers, Ki-67 and PCNA, in the DU145-KiSS1 group (Fig. 6H). Interestingly, higher PCNA expression was observed around the blood vessels (Fig. 6H). These results indicate that KiSS1 increases the expressions of Ki-67 and VEGF, which subsequently induces increased tumor growth.

KiSS1 increases angiogenesis in prostate cancer cells

Since it has been documented that angiogenesis is essential for cancer cells to receive sufficient nutrients from the host and to secure a metastatic pathway [46, 47], we questioned whether KiSS1 overexpression affects the angiogenic ability of metastatic prostate cancer cells. We therefore investigated the role of KiSS1 on angiogenesis in cellular and animal models (Fig. 7). Compared with vector control cells, the medium cultured with DU145-KiSS1 cells promoted tube formation of SV40-HUVECs, indicating that KiSS1 increases the angiogenic ability of vascular endothelial cells (Fig. 6A). We further determined that KiSS1 increases the VEGF and CD31 expressions at the cellular level, with no alteration in the mRNA level of VEGF-A (Fig. 7B-E). It is noteworthy that overexpression of KiSS1 induces more than 4-fold increase in the CD31 protein level (Fig. 7E). Furthermore, histopathological analysis of xenografted tumors stained by H&E showed remarkable evidence of blood vessels in the DU145-KiSS1-tumor tissue (marked with black arrows) (Fig. 7F). In addition, the expressions of VEGF and CD31 were significantly increased in the tumor tissue overexpressing KiSS1, as compared to the vector control (Fig. 7G). These results indicate that KiSS1 promotes angiogenesis in prostate cancer by regulating the expressions of VEGF and CD31.

Depending on the cancer type, the KiSS1 gene is reported to play a role as either a tumor suppressor or oncogene, and therefore it is very important to understand the exact role of this gene in each cancer type [48]. Results of a previous study indicate that low expression of kisspeptin detected in prostate tissue samples from patients with prostate cancer negatively correlates with patient prognosis and clinical staging [34]. However, another study reported no significant differences in plasma kisspeptin levels in prostate cancer patients, as compared to healthy subjects [35]. Therefore, the role and mechanism of KiSS1 in metastatic prostate cancer remains unanswered. In the current study, we determined that KiSS1 potentially acts as an oncogene and promotes metastasis by increasing the growth, migratory and invasive ability, and angiogenic ability of metastatic prostate cancer, and eventually promoting the metastasis of prostate cancer.

In this report, we focus on our study on the effect of KiSS1 on cancer growth and migration in metastatic prostate cancer. We determined that overexpression of KiSS1 results in increased cell proliferation and tumor growth by regulating the expression of cell cycle genes involved in the G1/S phase, and up-regulation of PI3K/Akt. The cell cycle is also upregulated by altering the expression of p21 by phosphorylation of Akt and suppressing the glycogen synthase kinase 3 beta (GSK-3β) activity, or by repressing the expression of p27 via forkhead [49, 50]. This supports our hypothesis that increased expression of PI3K/Akt by KiSS1 promotes the proliferation of prostate cancer cells by suppressing expression of the cell cycle arrest gene involved in the G1/S phase. In addition, it is reported that the PI3K-Akt signaling pathway increases cell survival by indirectly activating NF-κB through phosphorylation of I-kappaB (I-κB) kinase; thus, the Akt increased by KiSS1 overexpression probably upregulates NF-κB expression and increases prostate cancer cell survival [50, 51]. Increased PCNA by KiSS1 induces the activity of cyclin-dependent kinases by decreasing the expression of p21, which subsequently inhibits the G1/S phase and increases the proliferation of prostate cancer cells [52]. Taken together, our results indicate that KiSS1 increases the activity of PI3K/Akt, which induces the growth of prostate cancer by regulating the expressions of cell cycle genes, and increases cell survival through NF-κB.

We further showed that KiSS1 overexpression increases the formation of tumor spheroids, which are clusters of cancer cells aggregated and adherent to each other, mimicking tumorigenesis [53, 54]. In addition, tumor spheroids were identified to have characteristics similar to cancer stem cells [55]. Therefore, increase in the size of tumor spheroids by KiSS1 indicates the potential to promote tumor growth. One possible explanation for this observation can be speculated from our results that CD133 and β-catenin are relatively upregulated in DU145-KiSS1 cells. It has previously been reported that CD133, a cancer stem cell marker, induces tumorigenesis in various carcinomas including prostate cancer, by directly promoting tumorigenesis, or upregulating the expressions of other critical genes that drive tumorigenesis [56–59]. Emerging observations have suggested that CD133 interacts with the PI3K regulatory subunit p85 to activate the PI3K/Akt pathway and activate the Wnt/β-catenin signaling pathway through Akt [60–62]. This suggests that the KiSS1-induced CD133 contributes to increased cell proliferation and promotes tumor growth by upregulating PI3K and Akt in prostate cancer cells. Furthermore, based on the results of a previous study that β-catenin mediates the enrichment of cancer stem cells in tumors and increases the growth of tumor spheroids and tumors, KiSS1 probably contributes to prostate cancer tumor growth by upregulating β-catenin [55].

In the current study, we further established that KiSS1 overexpression results in mesenchymal morphological changes in DU145 prostate cancer. EMT occurs when epithelial cells undergo long-term morphological and molecular changes as a result of trans-differentiation to a mesenchymal cell type [63]. This EMT is related to carcinogenesis, and confers metastatic properties to cancer cells by enhancing the mobility and invasion [4, 64]. Before examining the effect of KiSS1 overexpression on the migration and invasion of prostate cancer cells, we first investigated alterations in the EMT-related markers. Our results of qPCR and immunoblotting showed up-regulated N-cadherin and down-regulated E-cadherin, and mesenchymal changes were therefore attributed to changes in the EMT protein expressions. A previous study reported that the activity of KISS1R induces the acquisition of the mesenchymal phenotype by acting on EMT genes such as snail, slug, vimentin, N-cadherin, and E-cadherin [64]. Our results indicate that prostate cancer acquires metastatic properties by regulating the expressions of N-cadherin and E-cadherin via KISS1R. Since Wnt/β-catenin signaling activation up-regulates EMT-related genes, the mesenchymal morphology of prostate cancer cells transformed by KiSS1 may indirectly be due to increased β-catenin expression [60]. Meanwhile, KISS1R, also called G-protein-coupled receptor 54 (GPR54), is known to regulate ERK1/2 activity via β-arrestins [65]. β-arrestins play a role in various pathological processes, including GPCR desensitization and sequestration. β-arrestin2 potentiates GPR54 signaling to ERK, whereas β-arrestin1 inhibits this signaling [65–67]. It is interesting to note that KiSS1 overexpression results in increased total level of β-arrestin1/2, with a concurrent increase in the protein level and phosphorylation of ERK1/2, which is downstream of β-arrestins. Similar to the results of previous studies, we found increased ERK activity via phosphorylation of Raf-MEK1/2, and increased MMP9 expression by promoting transcription of NF-κB subunits (p65/p50) [68, 69]. Moreover, KISS1R also induced increased expression of MMP9 by indirectly interacting with the NF-κB protein via I-κB [68]. We therefore propose that KiSS1 increases the mobility and invasiveness of prostate cancer via the above signaling pathways.

Primary tumors which have undergone EMT disseminate into other tissues, initiating metastatic colonization at distant sites [70]. The prognosis and clinical outcomes of prostate cancer are highly dependent on the occurrence of metastases, and most recurrences are caused by disseminated tumor cells that have already colonized in other tissues [71]. Examining metastatic colonization requires systematic and macroscopic observation using animal models of tumor metastasis, but this is time-consuming and labor intensive. Therefore, we established a cellular model that can predict the ability to colonize at metastatic sites. This experimental approach has the advantage of being able to evaluate metastatic colonization that cannot be reproduced in conventional transwell invasion assays, and can be applied to evaluate metastatic colonization after intravasation or extravasation of a primary tumor by seeding endothelial cells on the opposite side of the transwell insert. Plating tumor spheroids instead of trypsinized cells in the upper chamber conserves the characteristics of the primary tumor, and allows the evaluation of EMT and its reverse process, MET. Based on our results, the in vitro metastasis assay developed in this study provides the first clue that KiSS1 has the ability to increase metastatic colonization at distant sites.

Progression of malignant tumors depends on their ability to promote host responses to angiogenesis and lymphangiogenesis in a phase of rapid growth [6, 72, 73]. In the current study, KiSS1 overexpression resulted in increased angiogenesis and increased levels of VEGF and CD31 in xenografted metastatic prostate tumors. VEGF is known as a key mediator of angiogenesis in metastatic prostate cancer, and it has been reported that CD31 interacts with VEGF to result in higher levels of angiogenesis in prostate cancer [74–76]. Therefore, KiSS1 may induce angiogenesis in prostate cancer by upregulating VEGF and CD31. In addition, CD31 upregulates the MMP9 expression to increase cancer cell migration and invasion, indicating that it helps facilitate the invasion of vascular endothelial cells into tissues, which in turn increases angiogenesis [77, 78].

Prostate cancer cells injected with the control vector had relatively smaller and slow growing tumors during the observation period. Given that the absence of nutrient supply via blood vessels can lead to tumor necrosis or even apoptosis [79], it is reasonable to postulate from our findings that prostate tumors with relatively low KiSS1 expression are smaller in size. In other words, KiSS1 promotes tumor growth by stimulating angiogenesis, an important factor in cancer progression [6, 80]. However, simply increasing the activity of angiogenic factors is insufficient for tumor angiogenesis, and there needs to be accompanying downregulation of negative regulators or inhibitors of vessel growth [72, 81]. Thus, subsequent studies are required to investigate the effect of KiSS1 on inhibitors of angiogenesis. Meanwhile, one study has reported that CD133 promotes angiogenesis by interacting with CD31 or VEGF, thereby supporting our findings that KiSS1 overexpression induces a cancer stem cell marker to increase neovascularization and tube formation [60].

Given these observations, we conclude that KiSS1 not only induces prostate cancer proliferation, but also facilitates metastasis by increasing the migration, invasion, and angiogenesis of metastatic prostate cancer. Based on the interactions between proteins involved in signal transduction related to cancer cell growth and migration reported in previous studies, and the changes in the levels of genes and proteins by KiSS1 overexpression found in this study, Fig. 8 proposes a molecular mechanism by which KiSS1 regulates the development and metastasis of metastatic prostate cancer. It is still unclear whether KiSS1 can serve as a biomarker in specific malignant cancer cells, and whether regulation of KiSS1 gene expression via a viral vector system can be applied for therapeutic purposes in malignant tumors. Further studies are required to investigate whether the KiSS1-knock out/knock down model using the RNAi system exhibits an effect reversal to the results of this study. In addition, it is necessary to investigate the role of KiSS1 in PC-3 and LNCaP cell lines, which are the more widely used prostate adenocarcinomas for prostate research. Nevertheless, we expect that this study provides a strong foundation for delineating the underlying molecular mechanisms for the role of KiSS1 in tumor growth and metastasis of prostate cancer, thereby enhancing its clinical value for prostate treatment.

CD: Cluster of differentiation

ECM: Extracellular matrix

EMT: Epithelial-mesenchymal transition

ER: Estrogen receptor

IHC: Immuno-histological analysis

GSK-3β: glycogen synthase kinase 3 beta

GESTECs: Genetically engineered stem cells

HRAS: Harvey rat sarcoma oncogene homolog

H&E: Hematoxylin and eosin

HUVECs: Human umbilical vein endothelial cells

KISS1R: KISS1 receptor

MAPK: Mitogen-activated protein kinase

NRAS: Neuroblastoma rat sarcoma viral oncogene homolog

PI3K: Phosphoinositide 3-kinase

RAS: rat sarcoma

Raf: Rapidly accelerated fibrosarcoma

RT-qPCR: Quantitative reverse transcription polymerase chain reaction

SV40: Simian virus 40

TNBC: Triple negative breast cancer

VEGF: Vascular endothelial growth factor

Ethics approval

All animal experiments were approved by Institutional Animal Care and Use Committee (IACUC) at Chungbuk National University (CBNUA-1565-21-01).

Consent for publication

Not applicable

Availability of data and material

All data generated or analyzed during this study are included in this published article. The materials used in this study are available to any qualified researcher upon reasonable request addressed to K.C.C.

Competing interests

The authors do not have any conflicts of interest to declare.

Funding

This work was supported by the Basic Science Research Program (2020R1A2C2006060) and the Global Research and Development Center (GRDC) Program (2017K1A4A3014959) through the National Research Foundation (NRF) of Korea, funded by the Ministry of Science and ICT. This work was also supported by the Sejong Fellowship of National Research Foundation of Korea (NRF) funded by the Ministry of Science and ICT (2021R1C1C2093998).

Author’s contributions

K.C.C. conceived an idea of the manuscript and held the research funding for this study. C.W.K., H.K.L, and M.W.N. performed the experiments and statistical analysis. C.W.K. made the first draft of the manuscript and H.K.L. and K.C.C. edited and revised the manuscript based on the concept. C.W.K., H.K.L. and M.W.N. provided essential techniques for this study.

Tsilimigras DI, Brodt P, Clavien PA, Muschel RJ, D'Angelica MI, Endo I, Parks RW, Doyle M, de Santibanes E, Pawlik TM. Liver metastases. Nat Rev Dis Primers. 2021;7(1):27.
Deshmukh AP, Vasaikar SV, Tomczak K, Tripathi S, den Hollander P, Arslan E, Chakraborty P, Soundararajan R, Jolly MK, Rai K, et al: Identification of EMT signaling cross-talk and gene regulatory networks by single-cell RNA sequencing. Proc Natl Acad Sci U S A 2021, 118(19).
Ribatti D, Tamma R, Annese T. Epithelial-Mesenchymal Transition in Cancer: A Historical Overview. Transl Oncol. 2020;13(6):100773.
Kim CW, Hwang KA, Choi KC. Anti-metastatic potential of resveratrol and its metabolites by the inhibition of epithelial-mesenchymal transition, migration, and invasion of malignant cancer cells. Phytomedicine. 2016;23(14):1787–96.
Szmulewitz R, Taylor J, Rinker-Schaffer C. Metastatic colonization. Encyclopedia of Cancer 2011, 2.
Nishida N, Yano H, Nishida T, Kamura T, Kojiro M. Angiogenesis in cancer. Vasc Health Risk Manag. 2006;2(3):213–9.
Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin. 2016;66(1):7–30.
Han HH, Park JW, Na JC, Chung BH, Kim CS, Ko WJ. Epidemiology of prostate cancer in South Korea. Prostate Int. 2015;3(3):99–102.
Schroder FH, Hugosson J, Roobol MJ, Tammela TL, Ciatto S, Nelen V, Kwiatkowski M, Lujan M, Lilja H, Zappa M, et al: Prostate-cancer mortality at 11 years of follow-up. N Engl J Med 2012, 366(11):981–990.
Singh O, Bolla SR. Anatomy, Abdomen and Pelvis, Prostate. In: StatPearls. edn. Treasure Island (FL); 2021.
Klusa D, Lohaus F, Furesi G, Rauner M, Benesova M, Krause M, Kurth I, Peitzsch C. Metastatic Spread in Prostate Cancer Patients Influencing Radiotherapy Response. Front Oncol. 2020;10:627379.
Sooriakumaran P, Karnes J, Stief C, Copsey B, Montorsi F, Hammerer P, Beyer B, Moschini M, Gratzke C, Steuber T, et al. A Multi-institutional Analysis of Perioperative Outcomes in 106 Men Who Underwent Radical Prostatectomy for Distant Metastatic Prostate Cancer at Presentation. Eur Urol. 2016;69(5):788–94.
Murray NP, Reyes E, Tapia P, Badinez L, Orellana N, Fuentealba C, Olivares R, Porcell J, Duenas R. Redefining micrometastasis in prostate cancer - a comparison of circulating prostate cells, bone marrow disseminated tumor cells and micrometastasis: Implications in determining local or systemic treatment for biochemical failure after radical prostatectomy. Int J Mol Med. 2012;30(4):896–904.
Fitzgerald TJ, Wang T, Goel HL, Huang J, Stein G, Lian J, Davis RJ, Doxsey S, Balaji KC, Aronowitz J, et al. Prostate carcinoma and radiation therapy: therapeutic treatment resistance and strategies for targeted therapeutic intervention. Expert Rev Anticancer Ther. 2008;8(6):967–74.
Johnson MJ, Huang C, Chen H, Jones L, Twiddy M. Prostate cancer: unmet supportive and palliative care needs: national survey of patients and family carers. BMJ Support Palliat Care 2021.
Yi BR, Kim SU, Choi KC. Synergistic effect of therapeutic stem cells expressing cytosine deaminase and interferon-beta via apoptotic pathway in the metastatic mouse model of breast cancer. Oncotarget. 2016;7(5):5985–99.
Kim SU, Jeung EB, Kim YB, Cho MH, Choi KC. Potential tumor-tropic effect of genetically engineered stem cells expressing suicide enzymes to selectively target invasive cancer in animal models. Anticancer Res. 2011;31(4):1249–58.
Sun XY, Nong J, Qin K, Warnock GL, Dai LJ. Mesenchymal stem cell-mediated cancer therapy: A dual-targeted strategy of personalized medicine. World J Stem Cells. 2011;3(11):96–103.
Pasquier J, Kamech N, Lafont AG, Vaudry H, Rousseau K, Dufour S. Molecular evolution of GPCRs: Kisspeptin/kisspeptin receptors. J Mol Endocrinol. 2014;52(3):T101–17.
Lee DK, Nguyen T, O'Neill GP, Cheng R, Liu Y, Howard AD, Coulombe N, Tan CP, Tang-Nguyen AT, George SR, et al. Discovery of a receptor related to the galanin receptors. FEBS Lett. 1999;446(1):103–7.
Lee JH, Miele ME, Hicks DJ, Phillips KK, Trent JM, Weissman BE, Welch DR. KiSS-1, a novel human malignant melanoma metastasis-suppressor gene. J Natl Cancer Inst. 1996;88(23):1731–7.
McNally LR, Welch DR, Beck BH, Stafford LJ, Long JW, Sellers JC, Huang ZQ, Grizzle WE, Stockard CR, Nash KT, et al. KISS1 over-expression suppresses metastasis of pancreatic adenocarcinoma in a xenograft mouse model. Clin Exp Metastasis. 2010;27(8):591–600.
Okugawa Y, Inoue Y, Tanaka K, Toiyama Y, Shimura T, Okigami M, Kawamoto A, Hiro J, Saigusa S, Mohri Y, et al. Loss of the metastasis suppressor gene KiSS1 is associated with lymph node metastasis and poor prognosis in human colorectal cancer. Oncol Rep. 2013;30(3):1449–54.
Takeda T, Kikuchi E, Mikami S, Suzuki E, Matsumoto K, Miyajima A, Okada Y, Oya M. Prognostic role of KiSS-1 and possibility of therapeutic modality of metastin, the final peptide of the KiSS-1 gene, in urothelial carcinoma. Mol Cancer Ther. 2012;11(4):853–63.
Cao F, Chen L, Liu M, Lin W, Ji J, You J, Qiao F, Liu H. Expression of preoperative KISS1 gene in tumor tissue with epithelial ovarian cancer and its prognostic value. Med (Baltim). 2016;95(46):e5296.
Zheng S, Chang Y, Hodges KB, Sun Y, Ma X, Xue Y, Williamson SR, Lopez-Beltran A, Montironi R, Cheng L. Expression of KISS1 and MMP-9 in non-small cell lung cancer and their relations to metastasis and survival. Anticancer Res. 2010;30(3):713–8.
Martin TA, Watkins G, Jiang WG. KiSS-1 expression in human breast cancer. Clin Exp Metastasis. 2005;22(6):503–11.
Marot D, Bieche I, Aumas C, Esselin S, Bouquet C, Vacher S, Lazennec G, Perricaudet M, Kuttenn F, Lidereau R, et al. High tumoral levels of Kiss1 and G-protein-coupled receptor 54 expression are correlated with poor prognosis of estrogen receptor-positive breast tumors. Endocr Relat Cancer. 2007;14(3):691–702.
Smith JT, Cunningham MJ, Rissman EF, Clifton DK, Steiner RA. Regulation of Kiss1 gene expression in the brain of the female mouse. Endocrinology. 2005;146(9):3686–92.
Zajac M, Law J, Cvetkovic DD, Pampillo M, McColl L, Pape C, Di Guglielmo GM, Postovit LM, Babwah AV, Bhattacharya M. GPR54 (KISS1R) transactivates EGFR to promote breast cancer cell invasiveness. PLoS ONE. 2011;6(6):e21599.
Cho SG, Wang Y, Rodriguez M, Tan K, Zhang W, Luo J, Li D, Liu M. Haploinsufficiency in the prometastasis Kiss1 receptor Gpr54 delays breast tumor initiation, progression, and lung metastasis. Cancer Res. 2011;71(20):6535–46.
Ikeguchi M, Hirooka Y, Kaibara N. Quantitative reverse transcriptase polymerase chain reaction analysis for KiSS-1 and orphan G-protein-coupled receptor (hOT7T175) gene expression in hepatocellular carcinoma. J Cancer Res Clin Oncol. 2003;129(9):531–5.
Schmid K, Wang X, Haitel A, Sieghart W, Peck-Radosavljevic M, Bodingbauer M, Rasoul-Rockenschaub S, Wrba F. KiSS-1 overexpression as an independent prognostic marker in hepatocellular carcinoma: an immunohistochemical study. Virchows Arch. 2007;450(2):143–9.
Wang H, Jones J, Turner T, He QP, Hardy S, Grizzle WE, Welch DR, Yates C. Clinical and biological significance of KISS1 expression in prostate cancer. Am J Pathol. 2012;180(3):1170–8.
Curtis AE, Murphy KG, Chaudhri OB, Ramachandran R, Young AM, Waxman J, Nijher GM, Bewick GA, Ghatei MA, Bloom SR, et al. Kisspeptin is released from human prostate cancer cell lines but plasma kisspeptin is not elevated in patients with prostate cancer. Oncol Rep. 2010;23(6):1729–34.
Kim CW, Go RE, Lee GA, Kim CD, Chun YJ, Choi KC. Immortalization of human corneal epithelial cells using simian virus 40 large T antigen and cell characterization. J Pharmacol Toxicol Methods. 2016;78:52–7.
Kim CW, Kim CD, Choi KC. Establishment and evaluation of immortalized human epidermal keratinocytes for an alternative skin irritation test. J Pharmacol Toxicol Methods. 2017;88(Pt 2):130–9.
Kim CW, Lee HM, Lee K, Kim B, Lee MY, Choi KC. Effects of cigarette smoke extracts on cell cycle, cell migration and endocrine activity in human placental cells. Reprod Toxicol. 2017;73:8–19.
Kim CW, Go RE, Lee HM, Hwang KA, Lee K, Kim B, Lee MY, Choi KC. Cigarette smoke extracts induced the colon cancer migration via regulating epithelial mesenchymal transition and metastatic genes in human colon cancer cells. Environ Toxicol. 2017;32(2):690–704.
Miyazaki K, Oyanagi J, Hoshino D, Togo S, Kumagai H, Miyagi Y. Cancer cell migration on elongate protrusions of fibroblasts in collagen matrix. Sci Rep. 2019;9(1):292.
DeCicco-Skinner KL, Henry GH, Cataisson C, Tabib T, Gwilliam JC, Watson NJ, Bullwinkle EM, Falkenburg L, O'Neill RC, Morin A, et al: Endothelial cell tube formation assay for the in vitro study of angiogenesis. J Vis Exp 2014(91):e51312.
Lee HK, Shin HJ, Koo J, Kim TH, Kim CW, Go RE, Seong YH, Park JE, Choi KC. Blockade of transforming growth factor beta2 by anti-sense oligonucleotide improves immunotherapeutic potential of IL-2 against melanoma in a humanized mouse model. Cytotherapy. 2021;23(7):599–607.
Jordan CT. Cancer stem cell biology: from leukemia to solid tumors. Curr Opin Cell Biol. 2004;16(6):708–12.
Lamb R, Ozsvari B, Lisanti CL, Tanowitz HB, Howell A, Martinez-Outschoorn UE, Sotgia F, Lisanti MP. Antibiotics that target mitochondria effectively eradicate cancer stem cells, across multiple tumor types: treating cancer like an infectious disease. Oncotarget. 2015;6(7):4569–84.
Reynolds DS, Tevis KM, Blessing WA, Colson YL, Zaman MH, Grinstaff MW. Breast Cancer Spheroids Reveal a Differential Cancer Stem Cell Response to Chemotherapeutic Treatment. Sci Rep. 2017;7(1):10382.
Kim CW, Choi KC: Potential Roles of Iridoid Glycosides and Their Underlying Mechanisms against Diverse Cancer Growth and Metastasis: Do They Have an Inhibitory Effect on Cancer Progression? Nutrients 2021, 13(9).
Zetter BR. Angiogenesis and tumor metastasis. Annu Rev Med. 1998;49:407–24.
Guzman S, Brackstone M, Radovick S, Babwah AV, Bhattacharya MM. KISS1/KISS1R in Cancer: Friend or Foe? Front Endocrinol (Lausanne). 2018;9:437.
Yohn NL, Bingaman CN, DuMont AL, Yoo LI. Phosphatidylinositol 3'-kinase, mTOR, and glycogen synthase kinase-3beta mediated regulation of p21 in human urothelial carcinoma cells. BMC Urol. 2011;11:19.
Luo J, Manning BD, Cantley LC. Targeting the PI3K-Akt pathway in human cancer: rationale and promise. Cancer Cell. 2003;4(4):257–62.
Ozes ON, Mayo LD, Gustin JA, Pfeffer SR, Pfeffer LM, Donner DB. NF-kappaB activation by tumour necrosis factor requires the Akt serine-threonine kinase. Nature. 1999;401(6748):82–5.
Strzalka W, Ziemienowicz A. Proliferating cell nuclear antigen (PCNA): a key factor in DNA replication and cell cycle regulation. Ann Bot. 2011;107(7):1127–40.
Kwak TJ, Lee E. In vitro modeling of solid tumor interactions with perfused blood vessels. Sci Rep. 2020;10(1):20142.
Wu Y, Zhou Y, Qin X, Liu Y. From cell spheroids to vascularized cancer organoids: Microfluidic tumor-on-a-chip models for preclinical drug evaluations. Biomicrofluidics. 2021;15(6):061503.
Pandit H, Li Y, Li X, Zhang W, Li S, Martin RCG. Enrichment of cancer stem cells via beta-catenin contributing to the tumorigenesis of hepatocellular carcinoma. BMC Cancer. 2018;18(1):783.
Lee HJ, You DD, Choi DW, Choi YS, Kim SJ, Won YS, Moon HJ. Significance of CD133 as a cancer stem cell markers focusing on the tumorigenicity of pancreatic cancer cell lines. J Korean Surg Soc. 2011;81(4):263–70.
Glumac PM, LeBeau AM. The role of CD133 in cancer: a concise review. Clin Transl Med. 2018;7(1):18.
Yang ZL, Zheng Q, Yan J, Pan Y, Wang ZG. Upregulated CD133 expression in tumorigenesis of colon cancer cells. World J Gastroenterol. 2011;17(7):932–7.
Li Z. CD133: a stem cell biomarker and beyond. Exp Hematol Oncol. 2013;2(1):17.
Behrooz AB, Syahir A. Could We Address the Interplay Between CD133, Wnt/beta-Catenin, and TERT Signaling Pathways as a Potential Target for Glioblastoma Therapy? Front Oncol. 2021;11:642719.
Manoranjan B, Chokshi C, Venugopal C, Subapanditha M, Savage N, Tatari N, Provias JP, Murty NK, Moffat J, Doble BW, et al. A CD133-AKT-Wnt signaling axis drives glioblastoma brain tumor-initiating cells. Oncogene. 2020;39(7):1590–9.
Wei Y, Jiang Y, Zou F, Liu Y, Wang S, Xu N, Xu W, Cui C, Xing Y, Liu Y, et al. Activation of PI3K/Akt pathway by CD133-p85 interaction promotes tumorigenic capacity of glioma stem cells. Proc Natl Acad Sci U S A. 2013;110(17):6829–34.
Marchesi V. Breast cancer: Epithelial-mesenchymal transitions in human breast cancer samples. Nat Rev Clin Oncol. 2013;10(4):184.
Mittal V. Epithelial Mesenchymal Transition in Tumor Metastasis. Annu Rev Pathol. 2018;13:395–412.
Szereszewski JM, Pampillo M, Ahow MR, Offermanns S, Bhattacharya M, Babwah AV. GPR54 regulates ERK1/2 activity and hypothalamic gene expression in a Galpha(q/11) and beta-arrestin-dependent manner. PLoS ONE. 2010;5(9):e12964.
Smith JS, Rajagopal S. The beta-Arrestins: Multifunctional Regulators of G Protein-coupled Receptors. J Biol Chem. 2016;291(17):8969–77.
Song Q, Ji Q, Li Q. The role and mechanism of betaarrestins in cancer invasion and metastasis (Review). Int J Mol Med. 2018;41(2):631–9.
Zhu N, Zhao M, Song Y, Ding L, Ni Y. The KiSS-1/GPR54 System: Essential roles in physiological homeostasis and cancer biology. Genes & Diseases. 2022;9(1):28–40.
Stathaki M, Stamatiou ME, Magioris G, Simantiris S, Syrigos N, Dourakis S, Koutsilieris M, Armakolas A. The role of kisspeptin system in cancer biology. Crit Rev Oncol Hematol. 2019;142:130–40.
Massague J, Obenauf AC. Metastatic colonization by circulating tumour cells. Nature. 2016;529(7586):298–306.
Manna F, Karkampouna S, Zoni E, De Menna M, Hensel J, Thalmann GN, Kruithof-de Julio M. Metastases in Prostate Cancer. Cold Spring Harb Perspect Med 2019, 9(3).
Gupta MK, Qin RY. Mechanism and its regulation of tumor-induced angiogenesis. World J Gastroenterol. 2003;9(6):1144–55.
Folkman J. Tumor angiogenesis: therapeutic implications. N Engl J Med. 1971;285(21):1182–6.
Roberts E, Cossigny DA, Quan GM. The role of vascular endothelial growth factor in metastatic prostate cancer to the skeleton. Prostate Cancer. 2013;2013:418340.
Carmeliet P. VEGF as a key mediator of angiogenesis in cancer. Oncology. 2005;69(Suppl 3):4–10.
Fernandez A, Udagawa T, Schwesinger C, Beecken W, Achilles-Gerte E, McDonnell T, D'Amato R. Angiogenic potential of prostate carcinoma cells overexpressing bcl-2. J Natl Cancer Inst. 2001;93(3):208–13.
Hiratsuka S, Nakamura K, Iwai S, Murakami M, Itoh T, Kijima H, Shipley JM, Senior RM, Shibuya M. MMP9 induction by vascular endothelial growth factor receptor-1 is involved in lung-specific metastasis. Cancer Cell. 2002;2(4):289–300.
Ahn GO, Brown JM. Matrix metalloproteinase-9 is required for tumor vasculogenesis but not for angiogenesis: role of bone marrow-derived myelomonocytic cells. Cancer Cell. 2008;13(3):193–205.
Suwa T, Kobayashi M, Nam JM, Harada H. Tumor microenvironment and radioresistance. Exp Mol Med. 2021;53(6):1029–35.
Lee WS, Yang H, Chon HJ, Kim C. Combination of anti-angiogenic therapy and immune checkpoint blockade normalizes vascular-immune crosstalk to potentiate cancer immunity. Exp Mol Med. 2020;52(9):1475–85.
Farnoodian M, Sorenson CM, Sheibani N. Negative Regulators of Angiogenesis, Ocular Vascular Homeostasis, and Pathogenesis and Treatment of Exudative AMD. J Ophthalmic Vis Res. 2018;13(4):470–86.

Download PDF

Version 1

posted

You are reading this latest preprint version

The role of KiSS1 gene on the tumor growth and migration of prostate cancer and the underlying molecular mechanisms

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Cell culture and medium preparation

Establishment of stable cell line overexpressing KiSS1 gene

Cell counting

Tumor spheroid formation

Transwell migration assay

Transwell invasion assay

Collagen invasion assay

In vitro metastasis assay

Tube formation assay

Mouse line and husbandry

Establishment of xenograft mouse model

Histological analysis (IHC and H&E staining)

Total RNA extraction and cDNA synthesis

Quantitative reverse transcription polymerase chain reaction (RT-qPCR)

Automated capillary-based western immunoblot

Statistical analysis

Results

Overexpression of KiSS1 in metastatic prostate cancer cells and characterization

KiSS1 increases the proliferation of prostate cancer cells

KiSS1 regulates KISS1R-mediated downstream signaling

KiSS1 increases metastatic capacity by increasing migratory and invasive ability of prostate cancer cells

KiSS1 increases prostate tumor growth in vivo

KiSS1 increases angiogenesis in prostate cancer cells

Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Version 1