Construction of the recombinant expression strain BL21 (DE3)(pXK88ac3STaLT2)
Based on the STa , LT2 and K88acsequence reported by Chongbo Xu et al[28,29] and Dykes et al[30], three STa mutant genes were amplified using C83902 plasmid DNA as the template and the primer15’-CCCAAGCTTAACAACACATTTTACTGC-3’, the primer25’-GGAATTCCATATGAT AACTTCCAGCACTGGC-3’, the primer3 5’-GGAATTCCATATGAACAACACATTTTACTG
C-3’, the primer4 5’-CCGGAATTCATAACTTCCAGCACTGGC-3’ and the primer5 5’-CCG GAATTCAACAACACATTTTACTGC-3’, the primer6 5’-CGCGGATCCATAACTTCCAGCA
CTGGC-3’. The primers contained the Hind III, Nde I, EcoR I and BamH I restriction endonuclease sites(italics) and protective bases, respectively.The K88ac gene fragment was amplified from the template C83902 plasmid by primer7 5-’CATGCCATGGCATTTACTGAC TATGAAGAA-3’ and P8 5’-CCCAAGCTTGAGAATATCATTTCTTGATAG-3’. Primer7 and primer8 contained Nco I and Hind III restriction endonuclease sites(italics)and protective bases, respectively.The LT2 gene fragment was amplified from the template C83902 plasmid by
P9 5’-CGCGGATCCCCAGACTATTACAGAACT A-3’ and P10 5’-ATAAGAATGCGGCCGC
AAGCTTGCCCCTCCAGCCTAG C-3’. Primer9 and primer10 contained BamH Iand Not I restriction endonuclease sites(italics)and protective bases, respectively. The three cloned STa mutant genes were connected in series and connected with the K88ac and LT2 genes to construct the fusion gene K88ac-3STa-LT2 . The fusion gene was cloned into the expression vector pET-28b and the recombinant expression plasmid pXK88ac3STaLT2 was constructed. Then the recombinant plasmid pXK88ac3STaLT2 was transformed to the BL21(DE3) recipient strain and the recombinant expression strain BL21(DE3) (pXK88ac3STaLT2) was constructed. The pXK88ac3STaLT2 plasmid was extracted for restriction digestion identification and nucleotide
sequence analysis.
Induction and SDS-PAGE analysis of BL21(DE3)(pXK88ac3STaLT2) and ELISA detection of K88ac-3STa-LT2 fusion protein
BL21(DE3)(pXK88ac3STaLT2) was coated separately to Kan-containing LB plates and cultured overnight at 37℃. Single colony were picked and inoculated in 5 mL Kan-resistant liquid LB medium, then cultured overnight at 37℃ with shaking at 170 r/min. The recombinant bacteria were inoculated into a culture flask containing 250 mL of LB medium at a ratio of 1% to logarithmic growth phase (OD600=0.4~0.6). Then, IPTG was added at a final concentration of 1mmoL/L and cultured overnight at 37℃ with shaking at 170 r/min. Cultures (1mL) of BL21(DE3)(pXK88ac3STaLT2) was centrifuged separately at 12,000 g for 10 min at 4℃, and the supernatants were discarded. The pellets were resuspended in 0.5 mL of 50 mmoL/L Tris-HCl pH 7.4 and centrifuged at 12,000 g for 10 min at 4℃. Pellets were resuspended in 25 μL of water. Once the bacteria are dispersed, 25 μL of 2×SDS gel electrophoresis loading buffer was immediately added and shaken for 20 seconds. Boiled in a boiling water bath for 3~5 minutes, and then was centrifuged at 12,000 g for 10 min at room temperature. 25 μL of supernatant was taken for SDS-PAGE analysis. The BL21(DE3) (pXK88ac3STaLT2) cells were lysed with ultrasound and the K88ac, STa and LT2 in the fusion protein were detected by ELISA test kit(Nanjing Jin
Yibai Biological Technology Co. Ltd.).
K88ac-3STa-LT2 antigen preparation
The 50 mL cultures induced by IPTG for 4 hours were centrifuged to collect the bacteria, then resuspended in 5 mL TE (50 mmoL/L Tris·Cl, 2 mmoL/L EDTA). The lysozyme at a final concentration of 100 μg/mL and 5 mL of 1% TritonX-100 were added and incubated at 30 ℃ for 15 minutes.The lysate was treated with an ultrasonic machine twice times for 10 seconds each, and then centrifuged at 12,000 r/min for 15 minutes. The precipitate was the crude inclusion body. After diluted 10 times, the aluminum hydroxide gel was added at a final concentration of 10% and the mixture was used as an antigen for immunization. In addition, formaldehyde is added to the engineering bacteria culture solution at a final concentration of 0.4% to inactivate the bacteria, and then aluminum hydroxide gel is added to 10% as an antigen for immunization.
Safety test of BL21(DE3)(pXK88ac3STaLT2) and minimum lethal dose test of challenge strain
In order to determine whether the K88ac-3STa-LT2 fusion protein expressed by the recombinant strain had lost the STa enterotoxin activity, forty mice were selected and randomly divided into 8 groups of 5 mice, of which 4 groups were injected intraperitoneally with the recombinant strain BL21(DE3)(pXK88ac3STaLT2). The other 4 groups were inoculated orally. The clinical response of the test mice was observed daily, and the necropsy was performed after continuous observation for 3 weeks.
Sixty mice weighing 18-22g were divided randomly into six groups of 10 mice. One of the group was used as a control group and the other groups were challenged separately with 25 , 50, 100, 150 and 200 million live bacteria. After 3 days of observation, the minimum lethal dose (MLD) was determined according to the death of the mice.Twelve newborn piglets were divided randomly into four groups of 3 piglets. Each of three groups was challenged separately with 0.2, 2 and 10 billion live bacteria and the last group was used as a control group. After 7 days of observation, the minimum lethal dose (MLD) was determined according to the death of the piglets.
Immune protection test
One-hundred sixty mice weighing 18-22g were divided randomly into four groups of 40 mice. Two groups were injected intraperitoneally with crude inclusion bodies, and the other two groups were injected intraperitoneally with inactivated vaccines of genetically engineered strains. The animals were injected twice with a 14-d interval at a dose of 0.2 mL per animal. Fourteen days after the second immunization, the mice were challenged with 1 MLD and 2 MLD virulent strains of E. coli C83902, and the death of the mice was observed daily. Another forty mice with 20 mice in each group were selected and served as the negative control group.
Five pregnant sows were selected. Two of them were immunized with crude inclusion body via neck muscle on 30 to 35 days and 15 to 20 days before delivery at a dose of 5mL/animal each time. The other two were immunized with inactivated vaccines of genetically engineered strains via neck muscles on 30 to 35 days and 15 to 20 days before delivery at a dose of 5mL/animal each time. The last one was not inoculated and used as the negative control. After the sows gave birth, one day after the piglets sucked the colostrum, the healthy piglets from the immunized sow and the healthy piglets from the control sow were all challenged, and each piglet was administrated with 1 MLD E. coli C83902(K88ac+, ST+ and LT+). All animals were observed for 7 days after challenge and the test results were recorded.
STa enterotoxin preparation and activity determination
Six rabbits were randomly divided into three groups of 2 rabbits and they were all immunized with crude inclusion body. Group 1 was immunized once, and blood was collected on the 20th day to separate serum. Group 2 was immunized twice, with an interval of 14 days for the second immunization, after the second immunization, blood was collected for preparation of serum on the 15th day. Group 3 was immunized three times, with an interval of 14 days each time, after the third immunization, blood was collected for preparation of serum on the 10th day. And the above-mentioned sera were respectively subjected to neutralization test of intragastric
administration in the suckling mice.The E. coli HB101 strain (pSLM004) producing enterotoxin STa was streaked and inoculated on Amp-containing LB plates and cultured at 37°C for 18 hours. Single colony were picked and inoculated in 5 mL Amp-resistant liquid LB medium, then cultured at 37℃ for 24 hours with shaking at 170r/min. Cultures (2mL) was inoculated in 200 mL of Amp-containing LB broth at 37℃ for 24 hours with shaking at 170r/min. After centrifuged at 5,000g for 20min at 4℃, the supernatant was filtered and sterilized and diluted 10 times with normal saline for activity determination and neutralization test. The prepared STa enterotoxin was taken in different doses (10, 12, 15, 17, 20 μL), diluted with normal saline to 0.1 mL, and then the intragastric administration was performed in the suckling mice to determine the minimum amount
of STa enterotoxin of 1 mouse unit.
Neutralization Test of intragastric administration in the suckling mouse
An equal volume of immune rabbit serum was added to STa enterotoxin of 1 mouse unit and diluted to 0.1mLwith normal saline. After incubated at 37°C for 1 hour, the activity of STa enterotoxin in the mixture was measured by intragastric administration in the suckling mouse. The G/C (intestinal weight/residual corpse weight) value was calculated. The G/C value not less than 0.09 was considered positive for STa toxin, and the result of neutralization test was judged as negative. The G/C value not higher than 0.083 was considered negative for STa toxin, and the result of neutralization test was judged as positive. Furthermore, the neutralization effect of the immunized rabbit serum antibodies was evaluated.
Selection of the best medium
The prepared LB, modified LB and common broth medium were added separately into the fermentor tank, 100,000 mL per tank, inoculated with the seed solution of E. coli strain at a ratio of 2%. After cultured with aeration at 37°C for 6 hours, the glucose solution was added to the final concentration of 0.2%. After culturing for 16 hours, the number of viable bacteria was counted. The test was repeated 3 times for each medium, and the number of bacteria in each medium was recorded and the average value (CFU/mL) was calculated.
Selection of the best inducer
The modified LB medium was added to four fermentation tanks, 100,000 mL per tank, inoculated with the seed solution of E. coli strain at a ratio of 2%. After cultured with aeration at 37°C for 4~6 hours, the glucose was added with a final concentration of 0.2% to supplement the carbon source. After culturing for 4 hours, the final concentration of 1mmol/LIPTG, 1mmol/Llactose, 10mmol/Llactose, 100mmol/Llactose were added respectively to each tank for induction. After induced for 6 hours, 1 mL of bacterial solution from each tank was analyzed by SDS-PAGE and the expression of the target protein was detected.
Screening of the best induction conditions for lactose
The seed solution was inoculated into the fermentation tanks at a ratio of 2%. After culturing at 37°C for 4~6 hours, the glucose was added with a final concentration of 0.2% to supplement the carbon source. After continuing to culture with aeration for 4 hours, the final concentration of 100 mmol/L lactose was added to induce 6 hours. During this period, 1 mL of bacterial solution was taken every 1 hour to count the viable bacteria. At the same time, the expression of the target protein was detected by SDS-PAGE.
Selection of the best aeration culture condition
The seed liquid of E. coli BL21(DE3) (pXK88ac3STaLT2) strain was inoculated into three fermentation tanks at a ratio of 2%, 100,000 mL per tank, and the aeration volume of the three tanks was 50 L/min, 100 L/min, and 500 L/min. After culturing at 37°C for 6 hours, the glucose was added with a final concentration of 0.2% to supplement the carbon source. After continuing to culture with aeration for 4 hours, the final concentration of 100 mmol/L lactose was added. After induced for 6 hours, 1 mL of bacterial solution from each tank was analyzed by SDS-PAGE and the expression of the target protein was detected. The experiment was repeated 3 times to improve the credibility of the data and found the most suitable ventilation.
Inactivation test of K88ac-3STa-LT2 genetic engineering bacteria
The E. coli bacteria liquid with the bacteria count between 1.15~1.23×1010 CFU/mL was selected from three fermentation tanks. Each tank was divided into a total of 27 parts. The 27 parts of bacteria liquid were randomly divided into 3 groups, each of which had a total of 9 parts. The 9 parts of bacteria liquid were randomly divided into 3 groups, each of which had a total of 3 parts. Each group was inactivated by adding formaldehyde solution with final concentration of 0.4%, 0.6% and 0.8% at 37°C. The inactivation time was 12h, 24h, 48h, respectively. During the inactivation process, the bacterial solution needed to be shaken several times to ensure the complete inactivation of the bacterial solution.
Passive protection test of newborn piglets during the susceptible period
Sixteen pregnant sows were randomly divided into eight groups of 2 sows. Group1, group3, group5 and group7 were used as the immunization group, and each sow was immunized twice via neck muscles on 30 to 35 days and 15 to 20 days before delivery at a dose of 5mL/animal each time. Group2, group4, group6 and group8 were not immunized as the control group. The piglets produced by the sows in each group were challenged on the 1st, 7th, 14th and 28th day after suckling.
Determination of the minimum immune dose in mice
One-hundred twenty mice were randomly divided into six groups of 20 mice. Group1, group3 and group5 were used as the immunization group, and each mouse was injected intraperitoneally twice twice with a 14-d interval. The immunization doses of the three groups were 0.1mL/mouse, 0.2mL/mouse and 0.3mL/mouse of inactivated vaccines each time. Group2, group4 and group6 were used as the control group and were injected with saline only. 14 days after the second immunization, each mouse in the immunization group and the control group was injected intraperitoneally with 1 MLD of the virulent strain C83902. Observed for 7 days, the immune protective effects of different vaccine doses on the mice were recorded.
Determination of the minimum immune dose of pregnant sows
Eight pregnant sows were randomly divided into four groups of 2 sows . Group1 and group3 were used as the immunization group, and each sow was immunized twice via neck muscles on 30 to 35 days and 15 to 20 days before delivery. The immunization doses of the two groups were 2.5mL/sow and 5.0mL/sow of inactivated vaccines each time. Group2 and group4 were used as the control group and were injected with saline only. The piglets were challenged with 1 MLD of the virulent strain C83902 on the 1st day after suckling. After the challenge, the clinical response was observed daily for 7 days. The piglets with diarrhea were not treated until they healed or died. The immune protection effects of different vaccine doses on the newborn piglets were recorded.