Prokaryotic expression and in vitro activity of Ancylostoma ceylanicum calreticulin

doi:10.21203/rs.3.rs-1627668/v1

Download PDF

Research Article

Prokaryotic expression and in vitro activity of Ancylostoma ceylanicum calreticulin

https://doi.org/10.21203/rs.3.rs-1627668/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Ancylostoma ceylanicum is a zoonotic soil-derived nematode that parasitizes the intestine of humans and animals (dogs and cats), causing malnutrition and iron-deficiency anemia of the host. Studies have shown that the parasite can regulate or block the host's immune response by secreting calreticulin. However, no data are available on A. ceylanicum calreticulin. To study the biological function of A. ceylanicum calreticulin (Ace-CRT), we amplified the cDNA encoding Ace-CRT and constructed the prokaryotic expression vector pET28-Ace-CRT to express the target protein. The antigenicity of Ace-CRT was investigated by western blotting with canine serum. Mouse splenocytes and canine peripheral blood lymphocytes were stimulated with the recombinant protein in vitro to explore its proliferation activity and effect on the transcription level of cytokines. The recombinant protein was co-incubated with sensitized sheep erythrocytes to analyze the inhibitory effect on the complement-mediated hemolysis. Results showed that the rAce-CRT was abundantly expressed in Escherichia coli, with good antigenicity. The recombinant protein stimulated the proliferation of mouse splenocytes and canine peripheral blood mononuclear cells (PBMCs). Quantitative reverse-transcription polymerase chain reaction showed that rAce-CRT mainly promoted the expression of Th2 cytokines, especially IL-13, in canine peripheral blood lymphocytes. In vitro, rAce-CRT inhibited complement-mediated sheep erythrocytes hemolysis. These findings indicate that Ace-CRT has an immunomodulatory role and might be a promising candidate molecule for the hookworm vaccine.

Ancylostoma ceylanicum

calreticulin

prokaryotic expression

in vitro activity

cytokines expression

Hookworms are soil-derived nematodes that parasitize the intestines of humans and animals. The buccal capsule contains hook-shaped teeth that attach to and lacerate the host's intestinal mucosa to suck blood (Loukas et al. 2001), leading to host malnutrition and iron-deficiency anemia. Hookworm disease is a serious but easily overlooked intestinal parasitic disease. Globally, there are up to 500 million human hookworm infection cases (Bartsch et al. 2016). This disease is estimated to cause about 65,000 global deaths annually (WHO 2002). However, the long-term sequelae of hookworm-associated anemia and malnutrition may account for losing up to 22 million disability-adjusted life-years annually (Diemert et al. 2008). Necator americanus and Ancylostoma duodenale can only infect humans, while Ancylostoma ceylanicum and Ancylostoma caninum are zoonotic species that can infect dogs, cats as well as humans (Aula et al. 2020). Studies have shown that Ancylostoma ceylanicum has become the second-largest hookworm infecting people in Southeast Asian areas (Traub et al. 2013), causing abdominal pain, diarrhea, malnutrition, and iron-deficiency anemia (Sungkar et al. 2019). Therefore, it is urgent to develop new methods to control this disease.

Calreticulin (CRT) is a multifunctional protein that mainly regulates calcium ions homeostasis, intracellular calcium concentration, and calcium storage in the endoplasmic reticulum (Krause and Michalak 1997). Calreticulin also functions as an intracellular chaperone for glycoproteins, engaging carbohydrate side chains via well-defined lectin domains (Coppolino et al. 1997). In addition, CRT can also participate in signal transduction and cell adhesion, regulating gene expression and other functions (Tang et al. 2005; Johnson et al. 2001). The detection of CRT protein homologs in various parasites, including Trypanosoma carassii, Trichinella spiralis, Necator americanus, and Brugia malayi, suggests that this protein may play a variety of conserved roles (Pritchard et al. 1999; Ferreira et al. 2004, Oladiran and Belosevic 2010; Yadav et al. 2014; Zhao et al. 2017). When parasites invade the host, they may secrete CRT as a defense mechanism to divert host defensive responses (Ferreira et al. 2004). This protein became a target for the host's immune response (possibly generating antibodies cross-reactive with host CRT). Parasites may take advantage of CRT's anti-thrombotic and complement-inhibitory properties to suppress host defense (Ferreira et al. 2004), facilitating the establishment of parasitic infection. CRT binds to the host complement C1q and mannose-binding lectin (MBL) (Ramírez-Toloza et al. 2020), inhibiting the classic complement pathway and the lectin pathway's activation, counteracting the host immune system. Trichinella spiralis-CRT binding to C1q inhibited C1q involved pathogen-clearance functions, reducing the recruitment of immune cells (neutrophils, eosinophils, and macrophages) to the parasitic infection site and decreasing the release of reactive nitrogen intermediates and reactive oxygen intermediates (Zhao et al. 2017). B. malayi-CRT inhibited C1q-dependent lysis of immunoglobulin-sensitized red blood cells (Yadav et al. 2017). Presently, the function of Necator americanus calreticulin has been preliminarily explored. Na-CRT stimulated human basophils and mast cells to release type II cytokines (Pritchard et al. 1999), but there is no report on the study of A. ceylanicum CRT.

This study aims to reveal the biological function of A. ceylanicum calreticulin (Ace-CRT). We cloned and expressed Ace-CRT and then analyzed the antigenicity, immunogenicity of the recombinant protein and its effect on sensitized red blood cells. This study may lay a foundation to screen hookworm vaccine candidate molecules.

PCR amplification of Ace-CRT gene

Ancylostoma ceylanicum cDNA used to amplify cDNA encoding Ace-CRT was provided by our laboratory. A pair of specific primers, Ace-CRT-F (5´-ACGGCCAGTGAATTCATGGCTGT-3´) and Ace-CRT-R (5´-CTATAAAAGCTT GGCG-3´), were designed according to A. ceylanicum CRT gene (EYB83200.1) in GenBank and synthesized by Sangon Bioengineering (Shanghai) Co., LTD. Ace-CRT-F and Ace-CRT-R primers contained the restriction sites for XcmⅠ (CCAGTGAATT CATGG) and HindⅢ (AAGCTT) endonuclease, respectively. The PCR reaction (25 µL) contained cDNA (0.5 µL), 1 µL of each forward and reverse primers, 2× PrimeStar HS PCR Master Mix (12.5 µL, TaKaRa, Dalian, China), and ddH₂O (10 µL). The cycling conditions were as follows: 94°C for 5 min; 35 cycles of 94°C for 30 s, 54.8°C for 40 s and 72°C for 90 s; and final extension at 72°C for 8 min. PCR products were visualized by 1% agarose gel electrophoresis and harvested by the E.Z.N.A.® Gel Extraction Kit (Omega Bio-Tek, Norcross, GA, USA).

Cloning and sequence analysis of Ace-CRT gene

The PCR product and pUC-57 vector (Tsingke, Beijing, China) were double-enzyme digested with XcmI and HindⅢ (New England Biolabs, Ipswich, UK) and ligated with T4 ligase (TaKaRa, Dalian, China). Then, the mixture was transformed into Escherichia coli (E. coli) DH5α competent cells (TaKaRa, Dalian, China), following the manufacturer's protocol. Single white colonies were selected and inoculated into a 2 mL centrifugal tube containing 1 mL Luria-Bertani (LB) broth with 1 µL ampicillin, followed by shaking at 180 rpm, 37°C for 8 h. The positive plasmids were identified by double-enzyme digestion and bacterial liquid PCR identification and sent to Sangon Biotech Company for sequencing. The amino acid sequences of Ace-CRT were predicted using the DNAMAN software. The size and position of signal peptide in the CDS region of Ace-CRT amino acid sequence were analyzed by the online software SignalP5.0 (http://www.cbs.dtu.dk/services/SignalP). The trans-membrane domain of Ace-CRT amino acid sequence was examined by the online tool TMPred (https://bio.tools/TMPred). The software ProtScale (https://web.expasy.org/ protscale/) was used to determine Ace-CRT hydrophobicity/hydrophilicity. The protein tertiary structure was predicted using the online tool Swiss-model (http://swissmodel. expasy.org/).

Expression and purification of Ace-CRT recombinant protein

According to the Ace-CRT sequence (without the signal peptide), a pair of primers, F: 5´-GATAAGCTAGCATTCATGGC-3´ and R: 5´-CCGTCCCAAGCTTTTATAG T-3´, were designed to amplify the mature peptide sequence of Ace-CRT. The underlined parts represent NheI and HindIII's restriction sites. The PCR reaction mixture and cycling program were the same as mentioned above in the PCR amplification of Ace-CRT. The PCR products were examined on 1% agarose gel and harvested by the E.Z.N.A.® Gel Extraction Kit. The purified PCR products and the expression vector pET28a were digested by NheI and HindIII enzymes (New England Biolabs, Ipswich, UK), analyzed by 1% agarose gel electrophoresis, and then purified from the gel. The recovered products were ligated, transformed into E. coli BL21 competent cells (Sangon Biotech, Shanghai, China) and spread on LB plates supplemented with kanamycin. A single transformed colony was mixed into LB broth/ 0.1% kanamycin and incubated (200 rpm, 37℃) until 0.6 OD value. Then, the isopropyl β-D-1-thiogalactopyranoside (IPTG) with the final concentration of 0.5 mM was added to induce expression for 16 h. The bacterial solution was centrifuged (10,000 × g, 4℃, 5 min), and the supernatant was discarded. The bacteria pellets were resuspended in phosphate buffer saline (PBS). The mixtures were crushed in an ice bath by an ultrasonic cell disruptor (Toshiba, Tokyo, Japan) at 250W for 40 min with an interruption for 3 s every 2 s of sonication. After centrifuging at 12,000 × g for 5 min at 4℃, supernatant and precipitate were separated. The supernatant was transferred to the Ni-NTA Affinity Chromatography Column (Beyotime, Shanghai, China), let stand overnight at 4℃ and eluted with a 0–50 mM gradient imidazole solution. The supernatants, precipitates, and eluted proteins were mixed with SDS-PAGE loading buffer, heated at 95°C for 5 min and analyzed by 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis, followed by staining with Coomassie Brilliant Blue (Solarbio, Beijing, China). The Bicinchoninic Acid (BCA) Protein Assay Kit (Sangon Biotech, Shanghai, China) was utilized to measure the purified recombinant protein concentration.

Analysis of the specificity and antigenicity of recombinant Ace-CRT

Blood samples (2 mL) were collected from the cephalic vein of A. ceylanicum infected and healthy dogs in collection tubes and refrigerated at 4°C overnight. The positive serum of infected dogs and the negative serum of healthy dogs were collected by centrifuging blood samples at 4000 × g for 15 min. After SDS-PAGE analysis, purified Ace-CRT protein was electrotransferred to nitrocellulose (NC) membrane (Sangon Biotech, Shanghai, China). Western blot was performed with mouse anti-His tag antibody (1:3000, Abbkine, California, USA), positive dog serum, and negative dog serum as primary antibodies. Horseradish peroxidase (HRP)-conjugated goat anti-mouse and rabbit anti-dog antibodies (1:3000, Abbkine, California, USA) were used as the corresponding secondary antibodies. The specificity and antigenicity of the recombinant protein were tested by the 3,3´-diaminobenzidine substrate (DAB) Western blot detection kit (Solarbio, Beijing, China).

The effect of r Ace -CRT on the splenocyte proliferation in mouse

The primary splenocytes were isolated from BALB/c mice (6–8 weeks old). The mice were sacrificed and soaked in alcohol for disinfection. The spleen was removed from the abdominal cavity, crushed into pieces, and filtered through a 200-mesh sieve to collect the primary splenocytes. Then, RPMI-1640 medium containing 10% fetal bovine serum was added to isolated splenocytes and centrifuged at 2400 × g for 5 min, decanting the supernatant. Washing and centrifugation of splenocytes were repeated. The cell pellets were harvested and resuspened in RPMI-1640 medium, and viable cells were counted after staining with trypan blue (Sangon Biotech, Shanghai, China). Samples with viability over 95% were selected for subsequent analysis. The mouse splenocytes (2×10³) were added to each well in a 96-well plate and cultured in a 5% CO₂ cell incubator at 37℃. After stabilization, 100 µL of recombinant Ace-CRT at 15 µg/mL, 30 µg/mL, 60 µg/mL, and 90 µg/mL and BSA (negative control) were added at each well and placed in a 37°C, 5% CO₂ cell incubator for 24 h. Then, the absorbance values at 570 nm were measured in each group by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay (van Meerloo et al. 2011).

The effect of r Ace -CRT on PBMC cytokine expression

An anticoagulated blood sample (2 mL) was collected from a healthy dog and used to isolate canine peripheral blood mononuclear cells (PBMCs) using Lymphocytes Isolation Kit (TBD, Tianjin, China). The precise isolation method was mentioned by He et al. (2021). Isolated lymphocytes were resuspended in RPMI-1640 medium supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin. The cell density was adjusted to 3×10⁶ cells/mL and inoculated to a 24-well culture plate. The cells were cultured in a 5% CO₂ incubator at 37℃. After the lymphocyte growth was stabilized, the experimental groups (with purified protein), blank control and negative control (BSA protein) were set up. Eight working concentrations of purified protein (5, 10, 15, 30, 45, 60, 75 and 90 µg /mL) were used in experimental groups, with three repetitions for each group. The prepared plate was incubated in a cell culture incubator (37⁰C, 24 h, 5% CO2). Following centrifugation of the cell suspensions, the precipitates were harvested and used to extract PBMC total RNAs according to the instructions of the E.Z.N.A.® Total RNA Kit (Omega Bio-Tek, Norcross, GA, USA). A microplate reader was used to assess the quality of the RNA (OD260/OD280 ≈ 2.0). Agarose gel electrophoresis was performed to determine RNA integrity.

The recovered PBMC total RNA was used to synthesize the first-strand cDNA by reverse transcription using the HiScript III RT SuperMix for qPCR (+ gDNA wiper) (Vazyme, Nanjing, China) following the manufacturer^’s protocol. Briefly, genomic DNA contamination was removed by mixing 1 µg template RNA with 4 µL of 4× gDNA wiper Mix and RNase free ddH₂O up to 16 µL, followed by incubation at 42℃ for 2 min. Then, 4 µL of 5× Hiscript III qRT SuperMix was gently mixed with the previous mixture and incubated at 37℃ for 15 min and 85℃ for 5 s. The resulting cDNA was stored at -20°C.

The fluorescence quantitative reverse-transcription PCR (qRT-PCR) was performed to detect the cytokines expression in PBMCs stimulated by Ace-CRT different concentrations using a LightCycler® 96 Real-time PCR. The sequence and lengths of qPCR primers used for amplifying canine 18S rRNA, and cytokine IL-4, IL-5, IL-6, IL-10, IL-12, IL-13, IL-23, IFN-γ genes are shown in Table 1. The reaction systems (10 µL) were as follows: 5 µL of ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China), 0.4 µL of each forward and reverse primers, cDNA (1 µL), and double-distilled water (3.2 µL). qPCR reaction conditions comprised 50 cycles of 95℃ for 1 min, 95℃ for 10 s, and 60℃ for 30 s. The 18S rRNA was used as the internal reference gene, and each sample was examined in triplicate. Relative expression levels of cytokines were calculated by the 2-ΔΔCT method (Livak and Schmittgen 2001).

Table 1

Primers used for the quantitative real-time PCR in this study
Target gene	Primer sequence (5’- 3’)	Fragment size	References
18S rRNA	F: CTCAACACGGGAAACCTCAC R: CGCTCCACCAACTAAGAACG	110	Espíndola et al.(2012)
IL-4	F: CACCTCCCAACTGATTCCAA R: CTCGCTGTGAGGATGTTCAA	123	Li et al. (2021)
IL-5	F: ACCTGCAAGTATTTCTTGGTGTA R: AAGCCGGTTTGTTCTCAACTT	67	Fairfax et al.(2018)
IL-6	F: TCCACAAGCGCCTTTCTCCCTGG R: TCACGCACCTCATCCTGCGACTG	80	Varga et al.(2021)
IL-10	F: CAGAGCACCCTACCTGAGGA R: AAGTCTTCACCCTCCCGAAG	97	Huang et al.(2021)
IL-12	F: AAGCCACCTGGACCACCTTA R: AATATTCCTGGGCTCGGTGA	66	Kurata et al.(2004)
IL-13	F: CCTCCTCAGAGCAAAGTG R: CCCAGCACAAACAAAGAC	148	Chenery et al. (2021)
IFN-γ	F: GCGCAAGGCGATAAATGAAC R: CTGACTCCTTTTCCGCTTCCT	82	Abe et al. (2019)

Ace -CRT inhibitory effect on complement-mediated hemolysis of sheep erythrocytes

A hemolysis test was slightly improved from the method of Rose et al. (1997). The whole blood of a healthy dog was collected into a clean collection tube, left stand for 1 h at room temperature, kept at 4℃ for 2 h and centrifuged at 6000 × g for 10 min at 4℃ to collect serum. The canine serum sample was serially diluted at 1:2, 1:5, 1:10, 1:20, 1:40, 1:80, and 1:160 with barbitone buffer solution (BBS-GM) to determine the optimal dilution of serum. Each serum dilution was mixed with sensitized sheep erythrocytes and BBS-GM (200 µL each) and used for the hemolysis test, with three replicates for each group. A mixture of sheep erythrocytes (2%, 100 µL) and ultrapure water (500 µL) was considered the complete hemolysis group. The absorbance of this group was used as the standard to calculate the hemolysis rate. Next, the optimal dilution of canine serum (200 µL) was mixed with 200 µL of rAce-CRT of different concentrations (5, 10, 15, and 25 µg/mL). Then serum/ rAce-CRT suspensions were gently mixed with 200 µL of sensitized sheep erythrocytes, incubated at 37°C for 30 min in a water bath and centrifuged at 2400 × g for 10 min. The supernatant (150 µL) was collected from each group to measure the absorbance value at 405 nm (A1). BBS-GM, rAce-CRT, and sensitized sheep red blood cells were used as the control group to measure the absorbance at 405 nm (A2). BBS-GM, canine serum, and sensitized sheep erythrocytes (200 µL each) were set as the complement group for measuring the absorbance value at 405 nm (A0). Hemolysis inhibition rate =[1-(A1-A2)/A0] ×100%.

Data analysis

The data were expressed as the mean ± SD values. All results were analyzed with SPSS 22.0 (SPSS Inc., USA) and GraphPad Prism 6.2 (GraphPad Inc., USA). A significant difference was considered when p-value < 0.05.

Amplification and cloning of Ace-CRT gene

The cDNA encoding Ace-CRT was amplified from A. ceylanicum cDNA with a PCR product size of approximately 1200 bp (Fig. 1A). Following cloning, the bacterial liquid PCR demonstrated that the size of amplified bands corresponded to the expected fragment size (Fig. 1B). After double-enzyme digestion of the recombinant plasmid pET28a-Ace-CRT, a fragment of nearly 1200 bp was resulted, consistent with the expected target fragment size (Fig. 1C).

Bioinformatics analysis of Ace-CRT

Sequencing results showed that the Ace-CRT gene was 1224 bp in total length (OM280324) and encoded an open reading frame of 407 amino acids. The amino acid sequence of Ace-CRT was analyzed by bioinformatics software. The results showed that the average hydrophilicity coefficient of the protein was less than zero, indicating that Ace-CRT is a hydrophilic protein (Fig. 2A). There was a transmembrane domain (Fig. 2B), and the first 20 amino acids of the protein represented a signal peptide sequence (Fig. 2C). The quality assessment value of the protein's 3D structure model was 0.66, indicating good modeling quality (Fig. 2D).

Expression, purification and antigenicity analysis of r Ace -CRT

We used SDS-PAGE to analyze the bacterial culture (before and after expression induction), precipitate, supernatant, and purified protein. Results showed that the protein of interest was mainly expressed in the supernatant, and the purification result was optimal with 50 mM imidazole. The size of the recombinant protein was about 50 kDa (Fig. 3), which was consistent with the expected size of the target protein.

After Western blot analysis, this recombinant protein could be recognized by anti-His-tag antibodies, with a specific band at 50 kDa (Fig. 4A). The recombinant protein was also identified by positive canine serum with a clear band at 50 kDa. No reaction bands were formed with negative canine serum (Fig. 4B), indicating good antigenicity of the recombinant protein.

Effect of r Ace -CRT on the proliferation of mouse primary splenocytes

To assess rAce-CRT effect on splenocyte proliferation, we measured the OD570 nm value of mouse primary splenocytes after co-culturing with different rAce-CRT concentrations. As shown in Fig. 4, rAce-CRT significantly stimulated the mouse primary splenocyte proliferation. When rAce-CRT concentration was 15 and 30 µg/mL, the proliferation activity of splenocytes was the highest, significantly different from the control group. Additionally, the splenocyte proliferation simulation at the concentrations 60 and 90 µg/mL was significantly higher than in the control group (Fig. 5).

Effect of r Ace -CRT on PBMC cytokine expression

After stimulation of canine PBMCs with different concentrations of rAce-CRT, the expression levels of IL-4, IL-10, IL-12, and IL-13 increased compared with the control group, of which IL-13 was significantly different from the control group. However, the expression levels of IL-5, IL-6, and IFN-γ decreased compared with the control group (Fig. 6).

Inhibitory effect of r Ace -CRT on sensitized erythrocyte hemolysis

Increasing the canine serum dilution ratio gradually reduced the hemolysis of sensitized sheep erythrocytes. When the serum dilution ratio was 1:50, the hemolysis rate was 90.7% (Fig. 7A). Therefore, 1:50 was selected as the optimal dilution ratio. Compared to the control group, rAce-CRT at different concentrations inhibited the hemolysis of sensitized sheep erythrocytes. The hemolysis inhibition rate increased with increasing protein concentration (Fig. 7B).

Currently, benzimidazoles are mainly used for deworming and controlling hookworm disease (Sungkar et al. 2019). Still, this measure cannot prevent re-infection of hookworm and is prone to drug resistance (Soukhathammavong et al. 2012). Therefore, there is an urgent need to find a new vaccine candidate molecule for further prevention and control measures. Calreticulin (CRT) is a multifunctional protein with anti-inflammatory, hemostatic, and immune potential. Pritchard et al. (1999) reported that CRT of Necator americanus (Na-CRT) can directly induce human basophils and mast cells to produce type II cytokines, causing allergic reactions. When researchers combined the purified recombinant protein with human complement protein C1q, the hemolytic function of C1q was significantly inhibited (Kasper et al. 2001; Pritchard et al. 2003; Logan et al. 2020). This finding indicates that Na-CRT has an immunomodulatory role. In addition, upon Necator americanus larval challenge, mice vaccinated with Na-CRT showed a 43–49% reduction rate in worms recovered from lung compared with the control group, indicating the potential of Na-CRT as a vaccine (Winter et al. 2005). So far, no studies on CRT of Ancylostoma ceylanicum have been reported.

In this study, the Ace-CRT gene was cloned and expressed for the first time. The cDNA encoding Ace-CRT length was 1224 bp, and the recombinant protein size was about 50 kDa. SDS-PAGE analysis of the pellet and supernatant showed that the recombinant protein was expressed in the supernatant in large quantities, which provided great convenience for subsequent purification, consistent with the results of bioinformatics analysis (hydrophilicity). This recombinant protein could bind to His-tag antibodies and be recognized by positive canine serum, indicating good antigenicity. Co-incubation of rAce-CRT with mouse primary splenocytes at different concentrations showed that rAce-CRT significantly stimulated lymphocyte proliferation. This result suggests that Ace-CRT could promote the proliferation of immune cells and have an immunomodulatory role.

Cytokines are polypeptide molecules synthesized and secreted by immune cells that regulate cell differentiation and immune function (Ramakrishnan et al. 2012). This study showed that the expression levels of cytokines IL-4, IL-10, IL-12, and especially IL-13 were significantly increased in canine PBMCs stimulated by Ace-CRT recombinant protein. IL-4 is a product of T cells and can induce helper T cells (naive CD4⁺ T cells) differentiation into the Th2 subset of effector cells. This subset is characterized by the stereotypic production of a suite of cytokines by committed Th2 cells, including IL-4, IL-5, IL-10 and IL-13 (Balic et al. 2006). Studies have shown that IL-4 plays a crucial role in parasites' primary and secondary infection, contributing to the host resistance to parasite invasion (Rzepecka et al. 2009). Mosmann et al. (1990) initially classified IL-10 as a Th2 cytokine. However, subsequent research has revealed that IL-10 is a key anti-inflammatory regulatory cytokine produced by various cell types, including both T and non-T cell classes. Recently, IL-10 production has been linked to a new CD4⁺ T cell subpopulation with regulatory rather than effector properties (Treg cells) (Grous et al. 1998; Balic et al. 2006). As an anti-inflammatory cytokine, IL-10 can down-regulate the immunopathological response of the host, inhibit the differentiation of Th1 cells, causing T cell response to tilt toward the Th2 type and remains a critical component of resistance and survival during helminth infection (Balic et al. 2006). IL-13 is a typical type Th2 cytokine with an anti-inflammatory effect (Anthony et al. 2007), which can inhibit the activation of macrophages and stimulate the proliferation of B cells. IL-12 secreted by antigen-presenting cells promotes the differentiation of Th0 to Th1 cells, which primarily resist intracellular pathogen infection but cannot effectively counteract hookworms. In addition, the results of this study showed decreased expression levels of IL-5, IL-6 and IFN-γ. IL-5 cytokine stimulates the maturation of eosinophil and induces Th2 inflammatory response (Liu et al. 2007). The primary function of IL-6 is to enhance the proliferation of T cells (Rzepecka et al. 2009), and INF-γ antagonizes IL-4, activates macrophages and inhibits the proliferation of Th2 cells. Therefore, we concluded that calreticulin of A. ceylanicum might mainly contribute to the dominance of Th2 immune response in the host to resist the parasite infection, similar to the conclusion of the research on calreticulin of Taenia solium (Mendlovic et al. 2017).

C1q is the recognition protein of the classical complement pathway and the main connecting protein between innate immunity driven by the classical complement pathway and acquired immunity mediated by IgG or IgM (Gasque 2004; Yadav et al. 2014). In this study, canine serum was used as a complement, and then the complement activity (CH50) method (Kageyama et al. 2021) was used to detect the reaction between rAce-CRT and complement. When the dilution ratio of dog serum was 1:50, the hemolysis rate was 90.7%, and rAce-CRT could effectively inhibit the hemolysis of sensitized sheep erythrocytes. Similarly, Necator americanus calreticulin could bind to human C1q and inhibit hemolysis mediated by C1q (Logan et al. 2020). This finding could contribute to bloodsucking by hookworm. Calreticulin of Haemonchus contortus could bind to C1q and inhibit the cleavage of sensitized erythrocytes mediated by C1q (Suchitra et al. 2005). These data were conducive to the host's survival, consistent with the results of this study. Due to the limitation of experimental conditions, whether rAce-CRT can affect other pathways of complement activation cannot be directly explored, and further research is needed.

In summary, cDNA encoding Ancylostoma ceylanicum calreticulin was cloned for the first time in this study. The recombinant plasmid was constructed, and the expression, purification and function of recombinant proteins were explored. Recombinant Ace-CRT had good antigenicity and could stimulate the proliferation of mouse spleen cells and canine peripheral blood mononuclear cells. Ace-CRT also stimulated the secretion of Th2 cytokines and inhibited complement-mediated hemolysis. These findings lay the foundation to screen candidate molecules for A. ceylanicum vaccine.

Acknowledgments

This work was supported by grants from the National Natural Science Foundation of China (Grant No. 31672541) and the Science and Technology Planning Project of Guangdong Province, China (Grant No. 2014A020214005).

Conflict of interests

The authors declare that there is no conflict of interest regarding the publication of this paper.

Ethical approval

Animal experiments involved in this study were performed following the guidelines of the Animal Welfare Law and Regulations of the Department of Health and Human Services, China and were reviewed and approved by the South China Agricultural University Animal Care and Use Committee (approval number SYXK(Yue)2019-0136).

Abe Y, Yamamoto N, Nakamura K (2019) IL-13 attenuates early local CXCL2-dependent neutrophil recruitment for Candida albicans clearance during a severe murine systemic infection. Immunobiology 224(1):15–29
Anthony RM, Rutitzky LI, Urban JF, Stadecker MJ, Gause WC (2007) Protective immune mechanisms in helminth infection. Nat Reviews Immunol 7(12):975–987
Aula OP, McManus DP, Weerakoon KG, Olveda R, Ross AG, Rogers MJ, Gordon CA (2020) Molecular identification of Ancylostoma ceylanicum in the Philippines. Parasitology 147(14):1718–1722
Balic A, Harcus YM, Taylor MD, Brombacher F, Maizels RM (2006) IL-4R signaling is required to induce IL-10 for the establishment of Th2 dominance.Int Immunol(10):1421–1431
Bartsch SM, Hotez PJ, Asti L, Zapf KM, Bottazzi ME, Diemert DJ, Lee BY (2016) The global economic and health burden of human hookworm infection. PLoS Negl Trop Dis 10(9):e0004922
Chenery AL, Rosini S, Parkinson JE, Ajendra J, Herrera JA, Lawless C, Chan BH, Loke P, MacDonald AS, Kadler KE, Sutherland TE, Allen JE (2021) IL-13 deficiency exacerbates lung damage and impairs epithelial-derived type 2 molecules during nematode infection. Life Sci Alliance 4(8):e202001000
Coppolino MG, Woodside MJ, Demaurex N, Grinstein S, St Arnaud R, Dedhar S (1997) Calreticulin is essential for integrin-mediated calcium signaling and cell adhesion. Nature 386:843–847
Diemert DJ, Bethony JM, Hotez PJ (2008) Hookworm vaccines. Clin Infect Dis 46(2):282–288
Espíndola S, Vilches-Flores A, Hernández-Echeagaray E (2012) 3-Nitropropionic acid modifies neurotrophin mRNA expression in the mouse striatum: 18S-rRNA is a reliable control gene for studies of the striatum. Neurosci Bull 28(5):517–531
Fairfax KA, Bolden JE, Robinson AJ, Lucas EC, Baldwin TM, Ramsay KA, Cole R, Hilton DJ, de Graaf CA (2018) Transcriptional profiling of eosinophil subsets in interleukin-5 transgenic mice. J Leukoc Biol 104(1):195–204
Ferreira V, Molina MC, Valck C, Rojas A, Aguilar L, Ramírez G, Schwaeble W, Ferreira A (2004) Role of calreticulin from parasites in its interaction with vertebrate hosts. Mol Immunol 40(17):1279–1291
Gao J, Luo J, Fan R, Fingerle V, Guan G, Liu Z, Li Y, Zhao H, Ma M, Liu J, Liu A, Ren Q, Dang Z, Sugimoto C, Yin H (2008) Cloning and characterization of a cDNA clone encoding calreticulin from Haemaphysalis qinghaiensis (Acari: Ixodidae). Parasitol Res 102(4):737–746
Gasque P (2004) Complement: a unique innate immune sensor for danger signals. Mol Immunol 41:1089–1098
Groux H, O’Garra A, Bigler M, Rouleau M, Antonenko S, de Vries JE, Roncarolo MG (1997) A CD4⁺ T-cell subset inhibits antigen-specific T-cell responses and prevents colitis. Nature 389:737
He L, Abuzeid AMI, Zhuang T, Zhao Q, Zhu S, Chen X, Liu J, Li X, Li GQ (2021) Expression and biological functions of Ancylostoma ceylanicum saposin-like protein. Parasitol Res 120:3805–3813
Huang J, Tan Q, Tai N, Pearson JA, Li Y, Chao C, Zhang L, Peng J, Xing Y, Zhang L, Hu Y, Zhou Z, Wong FS, Wen L (2021) IL-10 Deficiency accelerates Type 1 diabetes development via modulation of innate and adaptive immune cells and gut microbiota in BDC2.5 NOD mice. Front Immunol 12:702955
Johnson S, Marek M, Michal O, Eggleton P (2001) The ins and outs of calreticulin: from the ER lumen to the extracellular space. Trends Cell Biol 11(3):122–129
Kageyama M, Hagiya H, Ueda Y, Ohtani K, Fukumori Y, Inoue N, Wakamiya N, Yoneda N, Kimura K, Nagasawa M, Nakagami F, Nishi I, Sugimoto K, Rakugi H (2021) Disseminated gonococcal infection in a Japanese man with complement 7 deficiency with compound heterozygous variants: A case report. Medicine 13:e25265–e
Kasper G, Brown A, Eberl M, Vallar L, Kieffer N, Berry C, Girdwood K, Eggleton P, Quinnell R, Pritchard DI (2001) A calreticulin-like molecule from the human hookworm Necator americanus interacts with C1q and the cytoplasmic signalling domains of some integrins. Parasite Immunol 23(3):141–152
Krause KH, Michalak M (1997) Calreticulin Cell 88:439–443
Kurata K, Iwata A, Masuda K, Sakaguchi M, Ohno K, Tsujimoto H (2004) Identification of CpG oligodeoxynucleotide sequences that induce IFN-gamma production in canine peripheral blood mononuclear cells. Vet Immunol Immunopathol 102(4):441–450
Li S, Wang L, Zhang Y, Ma L, Zhang J, Zu J, Wu X (2021) Role of interleukin-4 (IL-4) in respiratory infection and allergy caused by early-life Chlamydia infection. J Microbiol Biotechnol 31(8):1109–1114
Liu Q, Liu Z, Rozo CT, Hamed HA, Alem F, Urban JF Jr, Gause WC (2007) The role of B cells in the development of CD4 effector T cells during a polarized Th2 immune response. J Immunol 179(6):3821
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402–408
Logan J (2020) Comprehensive analysis of the secreted proteome of adult Necator americanus hookworms. PLoS Negl Trop Dis 14(5):e0008237
Loukas A, Prociv P (2001) Immune responses in hookworm infections. Clin Microbiol Rev 14(4):689–703
Mendlovic F (2017) Orally administered Taenia solium Calreticulin prevents experimental intestinal inflammation and is associated with a type 2 immune response. PLoS ONE 12(10):e0186510
Mosmann TR, Schumacher JH, Fiorentino DF, Leverah J, Moore KW, Bond MW (1990) Isolation of monoclonal antibodies specific for IL-4, IL-5, IL-6, and a new Th2-specific cytokine (IL-10), cytokine synthesis inhibitory factor, by using a solid phase radioimmunoadsorbent assay. J Immunol 145:2938
Oladiran A, Belosevic M (2010) Trypanosoma carassii calreticulin binds host complement component C1q and inhibits classical complement pathway-mediated lysis. Dev Comp Immunol 34:396–405
Pritchard DI, Girod N, Brown R, Caddick R, Eggleton P (2003) The hookworm calreticulin conundrum, in Calreticulin, 2nd edn. Springer US
Pritchard DI, Alan B, Grit K, McElroy P, Loukas A, Hewitt C, Berry C, Füllkrug R, Beck E (1999) A hookworm allergen which strongly resembles calreticulin. Parasite Immunol 21(9):439–450
Ramakrishnan A, Althoff KN, Lopez JA, Coles CL, Bream JH (2012) Differential serum cytokine responses to inactivated and live attenuated seasonal influenza vaccines. Cytokine 60(3):661–666
Ramírez-Toloza G, Aguilar GL, Valck C, Ferreira VP, Ferreira A (2020) The interactions of parasite calreticulin with initial complement components: consequences in immunity and virulence. Front Immunol 11:1561
Rose NR, deMacario EC, Folds JD (1997) Manual of Clinical Laboratory Immunology, fifth edn. American Society for Microbiology, Washington, DC
Rzepecka J, Rausch S, Klotz C, Schnöller C, Kornprobst T, Hagen J, Ignatius R, Lucius R, Hartmann S (2009) Calreticulin from the intestinal nematode Heligmosomoides polygyrus is a Th2-skewing protein and interacts with murine scavenger receptor-A. Mol Immunol 46(6):1109–1119
Soukhathammavong PA, Sayasone S, Phongluxa K, Xayaseng V, Utzinger J, Vounatsou P, Hatz C, Akkhavong K, Keiser J, Odermatt P (2012) Low efficacy of single-dose albendazole and mebendazole against hookworm and effect on concomitant helminth infection in Lao PDR. PLoS Negl Trop Dis 6(1):e1417
Suchitra S, Joshi P (2005) Characterization of Haemonchus contortus calreticulin suggests its role in feeding and immune evasion by the parasite. Biochim Biophys Acta 1722(3):293–303
Sungkar S, Putri KQ, Taufik MI, Gozali MN, Sudarmono P (2019) The effectiveness of triple dose Albendazole in treating soil-transmitted helminths infection. J Parasitol Res 2(4):1–4
Traub RJ (2013) Ancylostoma ceylanicum, a re-emerging but neglected parasitic zoonosis. Int J Parasitol 43(12–13):1009–1015
van Meerloo J, Kaspers GJL, Cloos J (2011) Cell sensitivity assays: The MTT assay. In: Cree I (ed) Cancer Cell Culture. Methods in Molecular Biology (Methods and Protocols), vol 731. Humana Press
Winter JA, Davies OR, Brown AP, Garnett MC, Stolnik S, Pritchard DI (2005) The assessment of hookworm calreticulin as a potential vaccine for necatoriasis. Parasite Immunol 27:139–146
World Health Organization (2002) Prevention and control of schistosomiasis and soil-transmitted helminthiases. Vol. Technical Report Series 912. Geneva: World Health Organization
Yadav S, Gupta S, Saxena JK (2017) Monitoring thermal and chemical unfolding of Brugia malayi calreticulin using fluorescence and Circular Dichroism spectroscopy. Int J Biol Macromol 102:986–995
Yadav S, Gupta S, Selvaraj C, Doharey PK, Verma A, Singh SK, Saxena JK (2014) In silico and in vitro studies on the protein-protein interactions between Brugia malayi immunomodulatory protein calreticulin and human C1q. PLoS ONE 9(9):e106413
Zhao L, Shao S, Chen Y, Sun X, Sun R, Jingjing Huang J, Zhan B, Zhu X (2017) Trichinella spiralis calreticulin binds human complement C1q as an immune evasion strategy. Front Immunol 8:636

Download PDF

Version 1

posted

You are reading this latest preprint version

Prokaryotic expression and in vitro activity of Ancylostoma ceylanicum calreticulin

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Data analysis

Results

Discussion

Declarations

References

Status:

Version 1