Daunorubicin induces Cysteine‐rich protein 61 to decreases the Chemosensitivity through the ATM/NF-κB pathway in B-acute lymphoblastic leukemia

doi:10.21203/rs.3.rs-1632846/v1

Download PDF

Research Article

Daunorubicin induces Cysteine‐rich protein 61 to decreases the Chemosensitivity through the ATM/NF-κB pathway in B-acute lymphoblastic leukemia

https://doi.org/10.21203/rs.3.rs-1632846/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Acute lymphoblastic leukemia（ALL）is the second most common hematologic malignancy worldwide with B-acute lymphoblastic leukemia（B-ALL）accounting for 70%-80%. Cysteine‐rich protein 61 (Cyr61), a potential tumor-promoting factor, is increased in both serum and bone marrow of B-ALL patients in our previous study. We aimed to elucidate the role of Cyr61 in B-ALL as well as to explore the source of Cyr61 in the bone marrow of B-ALL patients.

Methods: The human B-ALL cell line Nalm-6 was used. Cyr61 expression levels were measured by using quantitative real-time PCR (qRT-PCR), enzyme-linked immunosorbent assay (ELISA) and western blot analysis. The biological functions of Cyr61 in regulating B-ALL cell chemosensitivity to DNR and VCR was detected by cell viability assay and flow cytometry analysis. The production mechanisms of Cyr61 in the bone marrow were measured by qRT-PCR and western blot analysis.

Results: Knockdown of Cyr61 increased the chemosensitivity of Nalm-6 cells to DNR and VCR, and overexpression of Cyr61 decreased the chemosensitivity of Nalm-6 cells to DNR and VCR. Mechanistically, we found that Cyr61 attenuated chemotherapeutic drug-induced apoptosis by the upregulation of Bcl-2. Importantly, Cyr61 can be up-regulated by the chemotherapeutic drug DNR through the ATM-dependent NF-κ B pathway, however, VCR has no effect on the expression of Cyr61 in B-All cells.

Conclusions: In conclusion, our study revealed that DNR can induce the production of Cyr61 in B-ALL cells; further, increasing Cyr61 decreased the chemosensitivity of B-ALL cells to chemotherapeutic drugs. Thus, targeting Cyr61 may be a promising therapeutic strategy to increase the chemotherapy sensitivity in patients with B-ALL.

Cyr61

chemosensitivity

DNA damage

apoptosis

Acute lymphoblastic leukemia(ALL), the second most common hematologic malignancy worldwide, originates from an uncontrolled clonal proliferations of immature lymphocytes in bone marrow with B-acute lymphoblastic leukemia༈B-ALL༉accounting for 70%-80%[1]. Despite, combination chemotherapy has achieved good clinical outcomes on B-ALL, there still remain some patients with chemotherapy insensitivity; moreover, currently available drugs have limited benefits for patients who relapse[2]. Therefore, there is an urgent need to clear the recurrence mechanism of the patients with B-ALL to improve the prognosis and long-term disease-free survival (DFS).

A large number of studies indicate that the bone marrow microenvironment plays an indispensable role in leukemia [3]. Abnormal bone marrow microenvironment favors the production of cytokines, chemokines and matrix proteins to maintain the malignant cloning of leukemia cells and decrease the sensitivity of chemotherapeutic drugs [4–8].

Cysteine-rich protein 61 (Cyr61/CCN1), one of the CCN (Cyr61/CTGF/NOV) family members, is highly expressed in a variety of tumors [9–13], moreover, patients with Cyr61 high expression are indicative of poor prognosis in the clinic [14–19]. Our previous study showed that the expression of Cyr61 is elevated in patients with ALL and its concentrations are positively correlated with the proportions of leukemia cells in bone marrow [20]. Interestingly, in a follow-up study, it was found that Cyr61 can decrease the chemosensitivity of ALL cells to cytarabine [21]. It is well known that DNR and VCR are first-line chemotherapy agents for ALL. However, the effects of Cyr61 on the chemosensitivity of DNR and VCR are unclear; moreover, the source of Cyr61 in bone marrow remains largely unknown.

Studies suggest that chemotherapy drugs can induce cells to produce soluble molecules (such as cytokines, growth factors, matrix proteins, etc.) to protect tumor cells from the cytotoxicity of chemotherapy drugs [22–24]. Gilbert et. find that doxorubicin can cause DNA damage, which activates the thymic epithelial cells to induce the production of IL-6 [23]. Zhong et. reveal that rituximab induce diffuse large B-cell lymphoma (DLBCL) cells to release IL-6, which protects DLBCL cells from drug-induced apoptosis [25]. However, whether chemotherapy can induce B-ALL cells to release Cyr61 remains largely unknown.

In this study, we found that Cyr61 can decrease the chemotherapeutic sensitivity of VCR and DNR through up-regulating the expression of Bcl-2. Furthermore, Cyr61 had been found to be elevated after DNR stimulation in B-ALL cells through the ATM-dependent NF-κB pathway, but VCR has no such effect. Collectively, our study further cleared the biological function of Cyr61 on B-ALL and elucidated the molecular mechanism of releasing Cyr61 by B-ALL cells in bone marrow, and targeting Cyr61 might be a promising therapeutic strategy to improve the chemosensitivity in patients with B-ALL.

Patients and specimens

The peripheral blood of B-ALL patients at initial diagnosis was collected from Fujian Medical University Union Hospital, Fuzhou, China. These studies were performed in accordance with the ethical guidelines under the protocols approved by the Institutional Medical Ethics Review Board of Fujian Medical University Union Hospital, Fuzhou, China. The human acute B-lymphocytic leukemia cell line Nalm-6 was cultured with RPMI 1640 medium (HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA, USA) and 1% penicillin/streptomycin (HyClone, Logan, UT, USA) in a 37°C incubator supplied with 5% CO₂. The cell line was routinely checked by mycoplasma contamination test, and was recently evaluated using short Tandem Repeat (STR) DNA profiling.

Drugs and antibodies

DNR and VCR (Selleckchem, Houston, TX, USA) were dissolved in dimethyl sulfoxide (DMSO) according to the supplier’s guidelines. Drugs were stored in aliquots at − 20°C. Cyr61 monoclonal antibody (093G9) was donated by Dr. Li Ningli (Medical College of Shanghai Jiaotong University, Shanghai, China). Other antibodies were all purchased from Cell signaling Technology.

Enzyme-linked immunosorbent assay (ELISA)

The concentration of Cyr61 in the culture supernatant of Nalm-6 cells was determined by using human Cyr61 ELISA Systems (R&D Systems, Minneapolis, MN, USA), according to the manufacturer's instructions.

Cell viability assay

To explore the effect of VCR and DNR on the growth of Nalm-6-shCyr61, Nalm-6-shNC, Nalm-6-LV-Cyr61 and Nalm-6-LV-NC cells, these cells were cultured in RPMI 1640 medium containing different concentration of VCR and DNR for 24h. Cell viability was measured by using Cell Counting Kit-8 (CCK8, Beyotime Biotechnology, Jiangsu, China) according to kit instructions. In brief, 5.0×10³ cells were seeded into 96-well plate for 24h, and 10 µL CCK8 reagents were added into each well for another 2h. Then, optical density (OD) of plates was determined at 450 nm using a microplate reader (BIO-TEK), and the 50% inhibitory concentration (IC50) values for VCR and DNR were obtained. Each sample was assayed in triplicate and the experiments were repeated three times.

Western blot analysis

Nalm-6 cells were collected and washed with ice-cold PBS. The cells were added to RIPA lysis buffer for 20 minutes. Western blotting (Protein immunoblotting) is described early[13, 26, 27]. The following antibodies were used in this study: anti-human cyr61 monoclonal antibody (093G9) was donated by Dr. Li Ningli (Medical College of Shanghai Jiao tong University, Shanghai, China). Anti-NF‐κBp65 (4764; Cell Signaling Technology, Danvers, MA, USA), anti-P- NF‐κBp65 (3033; Cell Signaling Technology, Danvers, MA, USA), anti-Bcl-2 (4233; Cell Signaling Technology, Danvers, MA, USA), anti-PI3K/AKT (9272; Cell Signaling Technology, Danvers, MA, USA), anti-p- PI3K/AKT (9271; Cell Signaling Technology, Danvers, MA, USA), anti-p38 MAPK (9212; Cell Signaling Technology, Danvers, MA, USA), anti-p-p38 MAPK (9211; Cell Signaling Technology, Danvers, MA, USA), anti-ERK(p44/42) (9202; Cell Signaling Technology, Danvers, MA, USA), anti-p-ERK(p44/42) (9201; Cell Signaling Technology, Danvers, MA, USA).

Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from specimens using RNAeasy™ Animal RNA Isolation Kit with Spin Column (Beyotime, Shanghai, China) according to the manufacturer's instructions. Total RNA (1 µg) was reverse-transcribed into first‐strand cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). Real‐time PCR was carried out using SYBR Green Master Mix (Roche Diagnostics, Basel, Switzerland) according to the manufacturer's instructions. The primers used in this study were as follows: Cyr61 forward: TCCAGCCCAACTGTAAACATCA reverse: GGACACAGAGGAATGCAGCC; GAPDH forward: CACATGGCCTCCAAGGAGTA revers: TGAGGGTCTCTCTCTTCCTCTTGT; Bcl-2 forward: CTGGTGGGAGCTTGCATCAC revers: ACAGCCTGCAGCTTTGTTTC; Bcl-xl forward: TCAGGCTGCTTGGGATAAAGAT revers: AGAGGCTTCTGGAGGACATTTG; Survivin forward: GGAAGAAGTAGCGTCACTC revers: TGACGACCCCATAGAGGAACA; XIAP forward: TTGAGGAGTGTCTGGTAAG revers: CCATTCGTATAGCTTCTTGT.

Apoptosis assay

Apoptotic Nalm-6 cells were detected by APC Annexin-V Apoptosis Detection Kit according to the manufacturers’ instructions (BD Biosciences, Franklin Lakes, NJ, USA). Briefly, 5.0 × 10⁵ cells were washed with ice-cold PBS, resuspended in 195 µL binding buffer, and stained for 10 minutes at room temperature with 5 µL APC conjugated anti‐Annexin-V antibody. Unbound Annexin-V antibody was removed by washing with binding buffer. Percentage of apoptotic Nalm-6 cells (Annexin-V positive) was determined by flow cytometry analysis. The cell apoptosis rate (Annexin-V positive) was determined by FACSCanto II cytometer (BD Biosciences, San Jose, CA).

Cyr61 knockdown

Cyr61 knockdown was done as described previously [26]. Briefly, Nalm-6 cells ( 5×10⁴ cells/mL) were infected by lentivirus carrying shNC or shCyr61 (Shanghai GeneChem Co., Ltd, Shanghai, China). The infection efficiency of cells was ensured to be > 95% before selection with 4 µg/mL puromycin (Sigma-Aldrich, St. Louis, MO) for 5 days. The knockdown efficiency of Cyr61 was measured by western blot analysis and the frequency of GFP⁺ cells was measured by flow cytometry.

Cyr61 overexpression

The lentivirus particles containing the Cyr61 sequence were purchased from Shanghai GeneChem Co., Ltd. (Shanghai, China). First, Nalm-6 cells ( 5×10⁴ cells/mL) were infected with the lentivirus particles containing the Cyr61 sequence for 18-24h according to the manufacturer’s protocol. The infection efficiency of Nalm-6 cells was confirmed to be > 95% before selection with 4 µg/mL puromycin (Sigma-Aldrich, St. Louis, MO) for 5 days. The knockdown efficiency of Cyr61 was measured by western blot analysis and the frequency of GFP⁺ cells was measured by flow cytometry.

Statistical analysis

SPSS 22.0 statistical software (Version 22.0 SPSS, Chicago, IL; USA) was used for statistical analysis. All data was expressed as mean ± standard errors of the mean (SEM). Student's test was used to compare the two groups, A value of P < 0.05 was statistically significant (*P < 0.05; **P < 0.01).

Cyr61 decreased the chemosensitivity of B-ALL cells to DNR and VCR

Since Cyr61 can decrease the chemosensitivity of ALL cells to cytarabine [21], moreover, DNR and VCR have limited benefits for patients with B-ALL who relapse [28–31]; therefore, there is a need to determine whether Cyr61 can decrease the chemosensitivity of DNR and VCR in B-ALL cells. The plasmids with Cyr61 overexpression and low expression were respectively constructed in Nalm-6 (acute B-lymphocytic leukemia cell line) cells via lentiviral infection and a CCK8 assay was used to measure the cell viability. Compared with the Nalm-6-shNC cell group (51.63 ± 4.438 ng/mL), the Nalm-6-shCyr61 cell group (33.50 ± 1.432 ng/mL) showed a lower IC50 value to DNR, which indicated that knockdown of Cyr61 increased the chemosensitivity of Nalm-6 cells to DNR (Fig. 1A). Furthermore, compared with the Nalm-6-shNC cell group (37.51 ± 3.780 ng/mL), the Nalm-6-LV-Cyr61 cell group (52.87 ± 4.280 ng/mL) showed a higher IC50 value to DNR, which indicated that overexpression of Cyr61 decreased the chemosensitivity of Nalm-6 cells to DNR (Fig. 1B). Additionally, we also observed that the IC50 of VCR in Nalm-6-shCyr61 cells group (1.12 ± 0.39 ng/mL) was significantly lower than the control group (7.14 ± 3.77 ng/mL) (Fig. 1C); Moreover, the IC50 of VCR in Nalm-6-LV-Cyr61 cells group (34.10 ± 13.29 ng/mL) was significantly higher than the control group (2.30 ± 1.25 ng/mL) (Fig. 1D). These results indicated that Cyr61 could reduce the chemosensitivity of B-ALL cells to DNR and VCR.

Cyr61 decreased the apoptosis of B-ALL cells induced by DNR and VCR

Accumulating evidence suggests that Cyr61, also known as potential tumor-promoting factor, has been involved in chemo-resistance and relapse in multiple cancers [14–19]. However, the mechanism of Cyr61 decreasing the chemosensitivity of B-ALL cells remain unclear. Since multiple factors are contributed to drug resistance, including decreasing drug-induced cell apoptosis, up-regulating drug resistance genes and activating drug efflux systems [32, 33]; therefore, we explored the apoptosis condition of B-ALL cells with stimulation of DNR and VCR, as well as examined the effect of Cyr61-antibody (093G9). The result showed that knockdown of Cyr61 in Nalm-6 cells increased DNR and VCR-induced apoptosis (Fig. 2A, 2D); conversely, overexpression of Cyr61 in Nalm-6 cells decreased DNR and VCR-induced apoptosis (Fig. 2B, 2E). Additionally, we also observed that anti-Cyr61 antibody (093G9) could increase the DNR and VCR-induced apoptosis (Fig. 2C, 2F). Together, these results indicated that Cyr61 was involved in decreasing the chemosensitivity of B-ALL cells through decreasing the apoptosis induced by DNR and VCR.

Cyr61 can regulate the expression of Bcl-2

As suggested by the above experiments, Cyr61 could decrease the apoptosis of B-ALL cells induced by DNR and VCR. However, its mechanism remains poorly characterized. As Bcl-2 family molecules are important regulators of cellular apoptosis [34–36]; therefore, we detected the mRNA expressions of Bcl-2, Bcl-xl, Survivin and XIPA in Cyr61-knockdown Nalm-6 cells and DNR-treated Nalm-6 cells. Fortunately, we observed that the mRNA expression of Bcl-2 was decreased in Cyr61-knockdown Nalm-6 cells and was increased in Cyr61-overexpression Nalm-6 cells with or without DNR-treated, however, the expressions of Bcl-xl, Survivin and XIPA mRNA were not significantly changed (Fig. 3A, 3C). In addition, we also observed that the expression of Bcl-2 protein was significantly decreased in Cyr61-knockdown Nalm-6 cells and increased in Cyr61-overexpression Nalm-6 cells with or without DNR-treated (Fig. 3B, 3D). Together, considering that Bcl-2 is an anti-apoptotic protein, these results suggested that Cyr61 impaired the apoptosis induced by DNR and VCR possibly through the upregulation of Bcl-2.

DNR up-regulated the production of Cyr61 in B-ALL cells

Studies reveal that chemotherapeutic drugs promote tumor cells or stromal cells to generate a stronger barrier against cytotoxic effects of these chemotherapeutic drugs via producing large amounts of growth factors, cytokines and antiapoptotic proteins [23, 37–40]. However, whether DNR and VCR can induce tumor cells to release Cyr61 remain unclear, thus, we treated Nalm-6 cells with different concentrations of DNR and VCR. As shown in Fig. 4A, the mRNA expression of Cyr61 was significantly increased with the stimulation of DNR, and peaked at 2.5µg/mL; however, VCR had no significant effect on it (Fig. 4B). Additionally, we also observed that DNR induced Nalm-6 cells to produce Cyr61 mRNA in a time-dependent manner (Fig. 4C). Moreover, the protein levels of Cyr61 were significantly increased in DNR-treated Nalm-6 cells (Fig. 4D, 4E). Importantly, we were glad to found that the Cyr61 mRNA expression was increased in DNR-treated peripheral blood lymphocytes from newly diagnosed B-ALL patients (Fig. 4F). Taken together, these results clearly demonstrated that DNR could up-regulate the production of Cyr61 in B-ALL cells.

DNR induced Cyr61 through the ATM/NF-κB signaling pathway

Unfortunately, there is a paucity of research on the mechanism of Cyr61 expression. However, since several studies show that PI3K/AKT, p38 MAPK, ERK(p44/p42), and NF-κB signaling pathways are associated with the production of anti-apoptotic proteins [41–44], therefore, we decided to test these several pathways treated with DNR. Delightfully, we found that the phosphorylation of NF-κB/p65 was markedly increased in DNR-treated Nalm-6 cells; however, the phosphorylation of PI3K/AKT, p38 MAPK and ERK (p44/p42) had no significant change (Fig. 5A). Additionally, we observed that the expression of Cyr61 in Nalm-6 cells pretreated with NF-κB/p65 inhibitor (PDTC) was decreased in respond to the stimulation of DNR (Fig. 5B). Together, these results indicated that the activation of NF-κB pathways is involved in DNR-induced Cyr61 production in B-ALL cells.

As an anthracycline antibiotic, DNR is known as non-specific cell cycle drug causing strong DNA damage response (DDR) [45]. Therefore, combining with studies about drug-resistance induced by chemotherapy drugs [22–24], we inferred that DNA damage response may be involved in DNR-induced Cyr61 production in B-ALL cells. As expected, the phosphorylation of ATM and H2A·X, the markers of DNA damage response, was significantly increased in DNR-treated Nalm-6 cells (Fig. 6A). Some studies indicate that DDR can activate NF-κB pathway [46]. Fortunately, we also observed that the phosphorylation of NF-κB was down-regulated accompanied with a marked reduction of Cyr61 in Nalm-6 cells were pretreated with KU55933 (an inhibitor of ATM phosphorylation) (Fig. 6B). Together, these results suggested that DNR-induced Cyr61 production depend on the ATM/NF-κB signaling pathway.

ALL is the second most common hematologic malignancy of which patients with B-ALL account for 80% [1]. Despite combination chemotherapy has achieved remarkable success on B-ALL; however, about 20 percent of patients with B-ALL still show insensitive to chemotherapy drugs [2]. As is well-know, the ultimate goal of clinical therapy is to overcome the drug-resistance and reduce the recurrence. In this study, we demonstrated for the first time that Cyr61 can decrease the chemosensitivity of B-ALL cells to both DNR and VCR; Simultaneously, we also found that DNR can induce the production of Cyr61 in B-ALL cells through the ATM-dependent NF-κB pathway.

Cyr61 is a matrix protein and a member of CCN (Cyr61/CTGF/NOV) family. Cy61 plays an important role in maintaining the normal physiological function of the body [47–54]. Recent studies have found that Cyr61 contributes to the occurrence and development of tumors [9–13]. Our previous study has shown that the level of Cyr61 in both serum and bone marrow of ALL patients is increased, and the increasing Cyr61 can promote ALL cell survival [21]. However, the role of Cyr61 in the chemosensitivity of B-ALL cells and the origin of Cyr61 in bone marrow remain unclear.

Although, DNR and VCR, common chemotherapy drugs for hematologic tumors, have good clinical response to B-ALL patients, however, there still remain some patients to develop drug resistance to therapy [29]. In this study, we were surprised to find that Cyr61 could decrease chemosensitivity of B-ALL cells to DNR and VCR through regulating the cell apoptosis. Combining with our previous study [20], we confirmed that Cyr61 would play an important role in inducing multidrug resistance by affecting chemotherapy-induced apoptosis in B-ALL cells as well as blocking the function of Cyr61 maybe an interesting target for B-ALL.

It is well known that the regulation of cellular apoptosis is determined by the balance of anti-apoptotic and pro-apoptotic factors of Bcl-2 family proteins [55, 56]; therefore, we evaluated the effect of Cyr61 on the expression of Bcl-2, Bcl‐xL, XIAP, and Survivin; Interestingly, our data indicated that Cyr61 can increase the expression of Bcl‐2 without affecting Bcl‐xL, XIAP, and Survivin levels. Our findings reported here were consistent with our previous results in which Cyr61 can promote the survival of chronic myeloid leukemia (CML) cells by upregulating Bcl‐2 expression [57]. Considering that Bcl-2 is the classical antiapoptotic protein of the Bcl-2 family [58], we propose that Cyr61 decrease the apoptosis of B-ALL cells through the Bcl‐2 pathway.

There is no doubt that Cyr61 plays an important role in decreasing the chemosensitivity of DNR and VCR in B-ALL; however, how this protein is produced in bone marrow remains enigmatic. Many studies have indicated that chemotherapy can induce drug resistance via producing a variety of cytokines, which can shelter the tumor cells from chemotherapy drugs [29, 37, 59]; Delightfully, as expected, our study showed that DNR, known as common first-line chemotherapy drug for B-ALL, could up-regulate the expression of Cyr61 in Nalm-6 cells through ATM/ NF-κB pathway. We speculated that inducing B-ALL cells to release Cyr61 by DNR might be a self-protective mechanism by tumor cells for survival; moreover, the increased Cyr61 could protect B-ALL cells from the drugs killing effects, which explained the high recurrence rate in later clinical treatment as well as the mechanism of minimal residual leukemia (MRL). In summary, our study has indicated that up-regulation of Cyr61 expression in Nalm-6 cells by DNR may proceed via ATM/NF-κB pathway and this may provide a target for us to clear the chemo-resistant remnant B-ALL cells.

DNR is one of anthracycline antibiotics and also belongs to cell cycle non-specific drug which can cause strong DNA damage respond (DDR). ATM, also known as a central molecule for DDR, can lead to a cell-cycle delay, which facilitates DNA repair prior to replication [55–57]. ATM downstream molecule NF-κB mediates the abnormal expression of anti-apoptotic genes in leukemic cells [58]. Based on the studies presented above, we speculated that DNR may up-regulate the expression of Cyr61 in Nalm-6 cells through ATM/ NF-κB pathway. In this study, our data confirmed this assumption, and it was found that Nalm-6 cells had obvious DDR under the stimulation of DNR, the phosphorylation of ATM had been significantly increased and the expression of Cyr61 had been up-regulated after NF-κB activating

Taken together, our data showed that the Cyr61 can reduce the chemosensitivity of DNR and VCR in B-ALL cells via activating Bcl-2; moreover, DNR can induce the production of Cyr61 in B-ALL cells via an ATM-dependent NF-κB pathway. Blocking the Cyr61 expression in B-ALL cells may overcome the protection effect of therapy-induced BM niche and potentially prevent the occurrence of B-ALL relapse, which thereby significantly improve the efficacy of chemotherapeutics.

ALL

Acute lymphoblastic leukemia

B-ALL

B-acute lymphoblastic leukemia

Cyr61

Cysteine-rich protein 61

DNR

daunorubicin

VCR

vincristine

DFS

disease-free survival

qRT-PCR

Quantitative real-time PCR

ELISA

Enzyme-linked immunosorbent assay

IL-6

interleukin-6

DLBCL

diffuse large B-cell lymphoma

DMSO

Dimethyl sulfoxide

XIAP

X-linked inhibitor of apoptosis

NF‐κB

Nuclear factor kappa B

PI3K/AKT

Phosphatidylinositol-3-kinase

ERK

extracellular signal-regulated kinase

SEM

standard errors of the mean

CCK-8

Cell Counting Kit-8

Optical density

IC50

50% inhibitory concentration

ATM

Axia-telangiectasia mutated

DDR

DNA damage respond

CML

chronic myeloid leukemia

MRL

minimal residual leukemia.

Ethics approval and consent to participate

These studies were performed in accordance with the ethical guidelines under the protocols approved by the Institutional Medical Ethics Review Board of Fujian Medical University Union Hospital, Fuzhou, China. Informed consent was obtained from all individual participants included in the study.

Consent for publication

Not applicable.

Availability of data and materials

All data generated or analyzed during this study are included in this article.

Competing interests

The authors declare that they have no competing interests.

Funding

This work was supported by Natural Science Foundation of Fujian Province (2019J01151), and Fujian province Joint Funds for the innovation of science and Technology (2019Y9060).

Authors’ contributions

ZX and CY had a supervision and designed this study; SP and LZ performed the experiments, analyzed the data and wrote the manuscript. All authors have read and approved the final manuscript.

Acknowledgements

Not applicable.

Author details

1 Department of Clinical Laboratory, Fujian Medical University Union Hospital, 29 Xinquan Road, Fuzhou, Fujian 350001, China.

2 Department of Clinical Laboratory, Affiliated People Hospital of Fujian University of Traditional Chinese Medicine, 602 Bayiqi Road, Fuzhou, Fujian 350001, China.

Terwilliger T, Abdul-Hay M: Acute lymphoblastic leukemia: a comprehensive review and 2017 update. Blood Cancer Journal 2017, 7(6):e577-e577.
Jabbour E, O'Brien S, Konopleva M, Kantarjian H: New insights into the pathophysiology and therapy of adult acute lymphoblastic leukemia. Cancer 2015, 121(15):2517–2528.
Houshmand M, Blanco TM, Circosta P, Yazdi N, Kazemi A, Saglio G, Zarif MN: Bone marrow microenvironment: The guardian of leukemia stem cells. World journal of stem cells 2019, 11(8):476–490.
Bi L, Wu J, Ye A, Wu J, Yu K, Zhang S, Han Y: Increased Th17 cells and IL-17A exist in patients with B cell acute lymphoblastic leukemia and promote proliferation and resistance to daunorubicin through activation of Akt signaling. Journal of translational medicine 2016, 14(1):132.
Zeng Z, Samudio IJ, Munsell M, An J, Huang Z, Estey E, Andreeff M, Konopleva M: Inhibition of CXCR4 with the novel RCP168 peptide overcomes stroma-mediated chemoresistance in chronic and acute leukemias. Mol Cancer Ther 2006, 5(12):3113–3121.
Nervi B, Ramirez P, Rettig MP, Uy GL, Holt MS, Ritchey JK, Prior JL, Piwnica-Worms D, Bridger G, Ley TJ et al: Chemosensitization of acute myeloid leukemia (AML) following mobilization by the CXCR4 antagonist AMD3100. Blood 2009, 113(24):6206–6214.
Kuhne MR, Mulvey T, Belanger B, Chen S, Pan C, Chong C, Cao F, Niekro W, Kempe T, Henning KA et al: BMS-936564/MDX-1338: A Fully Human Anti-CXCR4 Antibody Induces Apoptosis In Vitro and Shows Antitumor Activity In Vivo in Hematologic Malignancies. Clinical Cancer Research 2013, 19(2):357–366.
Williams K, Motiani K, Giridhar PV, Kasper S: CD44 integrates signaling in normal stem cell, cancer stem cell and (pre)metastatic niches. Exp Biol Med (Maywood) 2013, 238(3):324–338.
Xie D, Miller CW, O'Kelly J, Nakachi K, Sakashita A, Said JW, Gornbein J, Koeffler HP: Breast cancer. Cyr61 is overexpressed, estrogen-inducible, and associated with more advanced disease. The Journal of biological chemistry 2001, 276(17):14187–14194.
Lin MT, Zuon CY, Chang CC, Chen ST, Chen CP, Lin BR, Wang MY, Jeng YM, Chang KJ, Lee PH et al: Cyr61 induces gastric cancer cell motility/invasion via activation of the integrin/nuclear factor-kappaB/cyclooxygenase-2 signaling pathway. Clin Cancer Res 2005, 11(16):5809–5820.
Gery S, Xie D, Yin D, Gabra H, Miller C, Wang H, Scott D, Yi WS, Popoviciu ML, Said JW et al: Ovarian carcinomas: CCN genes are aberrantly expressed and CCN1 promotes proliferation of these cells. Clin Cancer Res 2005, 11(20):7243–7254.
Xie D, Yin D, Wang HJ, Liu GT, Elashoff R, Black K, Koeffler HP: Levels of expression of CYR61 and CTGF are prognostic for tumor progression and survival of individuals with gliomas. Clin Cancer Res 2004, 10(6):2072–2081.
Zhu X, Song Y, Wu C, Pan C, Lu P, Wang M, Zheng P, Huo R, Zhang C, Li W et al: Cyr61 participates in the pathogenesis of acute lymphoblastic leukemia by enhancing cellular survival via the AKT/NF-kappaB signaling pathway. Sci Rep 2016, 6:34018.
Terada N, Kulkarni P, Getzenberg RH: Cyr61 is a potential prognostic marker for prostate cancer. Asian J Androl 2012, 14(3):405–408.
Sabile AA, Arlt MJ, Muff R, Bode B, Langsam B, Bertz J, Jentzsch T, Puskas GJ, Born W, Fuchs B: Cyr61 expression in osteosarcoma indicates poor prognosis and promotes intratibial growth and lung metastasis in mice. J Bone Miner Res 2012, 27(1):58–67.
Kok S-H, Chang H-H, Tsai J-Y, Hung H-C, Lin C-Y, Chiang C-P, Liu C-M, Kuo MY-P: Expression of Cyr61 (CCN1) in human oral squamous cell carcinoma: An independent marker for poor prognosis. Head & neck 2010, 32(12):1665–1673.
Jiang WG, Watkins G, Fodstad O, Douglas-Jones A, Mokbel K, Mansel RE: Differential expression of the CCN family members Cyr61, CTGF and Nov in human breast cancer. Endocr Relat Cancer 2004, 11(4):781–791.
Jeong D, Heo S, Sung Ahn T, Lee S, Park S, Kim H, Park D, Byung Bae S, Lee SS, Soo Lee M et al: Cyr61 expression is associated with prognosis in patients with colorectal cancer. BMC Cancer 2014, 14:164.
D'Antonio KB, Schultz L, Albadine R, Mondul AM, Platz EA, Netto GJ, Getzenberg RH: Decreased expression of Cyr61 is associated with prostate cancer recurrence after surgical treatment. Clin Cancer Res 2010, 16(23):5908–5913.
Zhu X, Song Y, Wu C, Pan C, Lu P, Wang M, Zheng P, Huo R, Zhang C, Li W et al: Cyr61 participates in the pathogenesis of acute lymphoblastic leukemia by enhancing cellular survival via the AKT/NF-κB signaling pathway. Scientific reports 2016, 6:34018.
Cao Y, Wu C, Song Y, Lin Z, Kang Y, Lu P, Zhang C, Huang Q, Hao T, Zhu X et al: Cyr61 decreases Cytarabine chemosensitivity in acute lymphoblastic leukemia cells via NF-κB pathway activation. International journal of molecular medicine 2019, 43(2):1011–1020.
Straussman R, Morikawa T, Shee K, Barzily-Rokni M, Qian ZR, Du J, Davis A, Mongare MM, Gould J, Frederick DT et al: Tumour micro-environment elicits innate resistance to RAF inhibitors through HGF secretion. Nature 2012, 487(7408):500–504.
Gilbert LA, Hemann MT: DNA damage-mediated induction of a chemoresistant niche. Cell 2010, 143(3):355–366.
Sun Y, Campisi J, Higano C, Beer TM, Porter P, Coleman I, True L, Nelson PS: Treatment-induced damage to the tumor microenvironment promotes prostate cancer therapy resistance through WNT16B. Nat Med 2012, 18(9):1359–1368.
Zhong W, Xu X, Zhu Z, Yang L, Du H, Xia Z, Yuan Z, Xiong H, Du Q, Wei Y et al: Increased interleukin-17A levels promote rituximab resistance by suppressing p53 expression and predict an unfavorable prognosis in patients with diffuse large B cell lymphoma. Int J Oncol 2018.
Song Y, Lin Q, Cai Z, Hao T, Zhang Y, Zhu X: Cysteine-rich protein 61 regulates the chemosensitivity of chronic myeloid leukemia to imatinib mesylate through the nuclear factor kappa B/Bcl-2 pathway. Cancer science 2019, 110(8):2421–2430.
Cao Y, Wu C, Song Y, Lin Z, Kang Y, Lu P, Zhang C, Huang Q, Hao T, Zhu X et al: Cyr61 decreases Cytarabine chemosensitivity in acute lymphoblastic leukemia cells via NF-kappaB pathway activation. Int J Mol Med 2019, 43(2):1011–1020.
Gewirtz DA: A critical evaluation of the mechanisms of action proposed for the antitumor effects of the anthracycline antibiotics adriamycin and daunorubicin. Biochemical pharmacology 1999, 57(7):727–741.
Duan CW, Shi J, Chen J, Wang B, Yu YH, Qin X, Zhou XC, Cai YJ, Li ZQ, Zhang F et al: Leukemia propagating cells rebuild an evolving niche in response to therapy. Cancer Cell 2014, 25(6):778–793.
Kim SY, Park JH, Yoon SY, Cho YH, Lee MH: A pilot study of daunorubicin-augmented hyper-CVAD induction chemotherapy for adults with acute lymphoblastic leukemia. Cancer chemotherapy and pharmacology 2018, 81(2):393–398.
[A Chinese expert panel consensus on diagnosis and treatment of adult acute lymphoblastic leukemia]. Zhonghua xue ye xue za zhi = Zhonghua xueyexue zazhi 2012, 33(9):789–792.
Lum BL, Gosland MP, Kaubisch S, Sikic BI: Molecular targets in oncology: implications of the multidrug resistance gene. Pharmacotherapy 1993, 13(2):88–109.
Hazlehurst LA, Landowski TH, Dalton WS: Role of the tumor microenvironment in mediating de novo resistance to drugs and physiological mediators of cell death. Oncogene 2003, 22(47):7396–7402.
Holcik M, Korneluk RG: XIAP, the guardian angel. Nature reviews Molecular cell biology 2001, 2(7):550–556.
Garg H, Suri P, Gupta JC, Talwar GP, Dubey S: Survivin: a unique target for tumor therapy. Cancer cell international 2016, 16:49.
Kale J, Osterlund EJ, Andrews DW: BCL-2 family proteins: changing partners in the dance towards death. Cell death and differentiation 2018, 25(1):65–80.
Chen YL, Tang C, Zhang MY, Huang WL, Xu Y, Sun HY, Yang F, Song LL, Wang H, Mu LL et al: Blocking ATM-dependent NF-κB pathway overcomes niche protection and improves chemotherapy response in acute lymphoblastic leukemia. Leukemia 2019, 33(10):2365–2378.
Huber RM, Lucas JM, Gomez-Sarosi LA, Coleman I, Zhao S, Coleman R, Nelson PS: DNA damage induces GDNF secretion in the tumor microenvironment with paracrine effects promoting prostate cancer treatment resistance. Oncotarget 2015, 6(4):2134–2147.
Gomez-Sarosi L, Sun Y, Coleman I, Bianchi-Frias D, Nelson PS: DNA Damage Induces a Secretory Program in the Quiescent TME that Fosters Adverse Cancer Phenotypes. Mol Cancer Res 2017, 15(7):842–851.
Guo B, Li L, Guo J, Liu A, Wu J, Wang H, Shi J, Pang D, Cao Q: M2 tumor-associated macrophages produce interleukin-17 to suppress oxaliplatin-induced apoptosis in hepatocellular carcinoma. Oncotarget 2017, 8(27):44465–44476.
Leu SJ, Liu Y, Chen N, Chen CC, Lam SC, Lau LF: Identification of a novel integrin alpha 6 beta 1 binding site in the angiogenic inducer CCN1 (CYR61). The Journal of biological chemistry 2003, 278(36):33801–33808.
Castells M, Milhas D, Gandy C, Thibault B, Rafii A, Delord JP, Couderc B: Microenvironment mesenchymal cells protect ovarian cancer cell lines from apoptosis by inhibiting XIAP inactivation. Cell Death Dis 2013, 4(10):e887.
Israel LP, Benharoch D, Gopas J, Goldbart AD: A pro-inflammatory role for nuclear factor kappa B in childhood obstructive sleep apnea syndrome. Sleep 2013, 36(12):1947–1955.
Jones GG, Del Río IB, Sari S, Sekerim A, Young LC, Hartig N, Areso Zubiaur I, El-Bahrawy MA, Hynds RE, Lei W et al: SHOC2 phosphatase-dependent RAF dimerization mediates resistance to MEK inhibition in RAS-mutant cancers. Nat Commun 2019, 10(1):2532.
Minotti G, Menna P, Salvatorelli E, Cairo G, Gianni L: Anthracyclines: molecular advances and pharmacologic developments in antitumor activity and cardiotoxicity. Pharmacol Rev 2004, 56(2):185–229.
Piret B, Schoonbroodt S, Piette J: The ATM protein is required for sustained activation of NF-kappaB following DNA damage. Oncogene 1999, 18(13):2261–2271.
Zhang Q, Wu J, Cao Q, Xiao L, Wang L, He D, Ouyang G, Lin J, Shen B, Shi Y et al: A critical role of Cyr61 in interleukin-17-dependent proliferation of fibroblast-like synoviocytes in rheumatoid arthritis. Arthritis Rheum 2009, 60(12):3602–3612.
Yu Y, Gao Y, Wang H, Huang L, Qin J, Guo R, Song M, Yu S, Chen J, Cui B et al: The matrix protein CCN1 (CYR61) promotes proliferation, migration and tube formation of endothelial progenitor cells. Exp Cell Res 2008, 314(17):3198–3208.
Parisi MS, Gazzerro E, Rydziel S, Canalis E: Expression and regulation of CCN genes in murine osteoblasts. Bone 2006, 38(5):671–677.
Moritani NH, Kubota S, Sugahara T, Takigawa M: Comparable response of ccn1 with ccn2 genes upon arthritis: An in vitro evaluation with a human chondrocytic cell line stimulated by a set of cytokines. Cell Communication and Signaling 2005, 3(1):6.
Löbel M, Bauer S, Meisel C, Eisenreich A, Kudernatsch R, Tank J, Rauch U, Kühl U, Schultheiss H-P, Volk H-D et al: CCN1: a novel inflammation-regulated biphasic immune cell migration modulator. Cellular and Molecular Life Sciences 2012, 69(18):3101–3113.
Jin Y, Kim HP, Ifedigbo E, Lau LF, Choi AM: Cyr61 protects against hyperoxia-induced cell death via Akt pathway in pulmonary epithelial cells. American journal of respiratory cell and molecular biology 2005, 33(3):297–302.
Hilfiker-Kleiner D, Kaminski K, Kaminska A, Fuchs M, Klein G, Podewski E, Grote K, Kiian I, Wollert KC, Hilfiker A et al: Regulation of proangiogenic factor CCN1 in cardiac muscle: impact of ischemia, pressure overload, and neurohumoral activation. Circulation 2004, 109(18):2227–2233.
Adachi M, Okamoto S, Chujyo S, Arakawa T, Yokoyama M, Yamada K, Hayashi A, Akita K, Takeno M, Itoh S et al: Cigarette smoke condensate extracts induce IL-1-beta production from rheumatoid arthritis patient-derived synoviocytes, but not osteoarthritis patient-derived synoviocytes, through aryl hydrocarbon receptor-dependent NF-kappa-B activation and novel NF-kappa-B sites. Journal of interferon & cytokine research: the official journal of the International Society for Interferon and Cytokine Research 2013, 33(6):297–307.
Zhao Q, Jiang D, Sun X, Mo Q, Chen S, Chen W, Gui R, Ma X: Biomimetic nanotherapy: core-shell structured nanocomplexes based on the neutrophil membrane for targeted therapy of lymphoma. Journal of nanobiotechnology 2021, 19(1):179.
Ismail MB, Rajendran P, AbuZahra HM, Veeraraghavan VP: Mangiferin Inhibits Apoptosis in Doxorubicin-Induced Vascular Endothelial Cells via the Nrf2 Signaling Pathway. Int J Mol Sci 2021, 22(8).
Song Y, Lin Q, Cai Z, Hao T, Zhang Y, Zhu X: Cysteine-rich protein 61 regulates the chemosensitivity of chronic myeloid leukemia to imatinib mesylate through the nuclear factor kappa B/Bcl‐2 pathway. Cancer science 2019, 110(8):2421–2430.
Bagci EZ, Vodovotz Y, Billiar TR, Ermentrout GB, Bahar I: Bistability in apoptosis: roles of bax, bcl-2, and mitochondrial permeability transition pores. Biophysical journal 2006, 90(5):1546–1559.
Anthony BA, Link DC: Regulation of hematopoietic stem cells by bone marrow stromal cells. Trends Immunol 2014, 35(1):32–37.

No competing interests reported.

Supplementarymeterial.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

Daunorubicin induces Cysteine‐rich protein 61 to decreases the Chemosensitivity through the ATM/NF-κB pathway in B-acute lymphoblastic leukemia

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Patients and specimens

Drugs and antibodies

Enzyme-linked immunosorbent assay (ELISA)

Cell viability assay

Western blot analysis

Quantitative real-time PCR (qRT-PCR)

Apoptosis assay

Cyr61 knockdown

Cyr61 overexpression

Statistical analysis

Results

Cyr61 decreased the chemosensitivity of B-ALL cells to DNR and VCR

Cyr61 decreased the apoptosis of B-ALL cells induced by DNR and VCR

Cyr61 can regulate the expression of Bcl-2

DNR up-regulated the production of Cyr61 in B-ALL cells

DNR induced Cyr61 through the ATM/NF-κB signaling pathway

Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1