2.1 Sample collection
A total of 135 canine fecal samples were collected between 2019 and 2021 in South Korea. A total of 74, 29, and 32 fecal samples were collected in Yangpyeong, Anseong, and Seoul, respectively. Yangpyeong and Anseong samples were collected from animal shelters, and Seoul samples were collected from the Veterinary Medical Teaching Hospital, Konkuk University. All fecal samples were stored at -80°C until being used.
2.2 Viral DNA extraction
Viral DNA was extracted from fecal supernatants using the Patho Gene-spin™ DNA/RNA Extraction Kit (iNtRON Biotechnology, Seongnam, South Korea) according to the manufacturer’s instructions. The isolated DNA was eluted in 40 µL of distilled water and stored at -20°C for further experiments.
2.3 TTCaV detection
PCR was performed to detect the conserved region of TTCaV using primer set I (TTCaV-F1 and TTCaV-R1; Table 1). Each PCR reaction mixture contained 5 µL of template DNA and 1 µL of primers (20 µM each), 5U FastStart High Fidelity Enzyme Blend (Roche Diagnostic, Mannheim, Germany), 5 µL of reaction buffer, 1 µL of PCR grade nucleotide mix, 1 µL of DMSO, and 35 µL of distilled water to make up the volume to 50 µL. The amplification was initiated by preheating for 3 min at 95°C, followed by 34 cycles of 30 s at 95°C, 30 s at 45.4°C, and 1 min at 72°C, and a final extension for 5 min at 72°C. The PCR product was run on a 2% agarose gel and purified using the MEGAquick-spin Plus Total Fragment DNA Purification Kit (iNtRON Biotechnology). The purified DNA product was sequenced by Cosmo Genetech (Seoul, Korea).
Table 1
Primer sets used for the detection of partial and full genomic sequences of TTCaV.
Primer sets | Primer names | Sequences (5'→3') | Positions* | Product length (bp) |
I | TTCaV-F1 | CGCCATCTTGGATTGGAAATC | 169-1,015 | 847 |
TTCaV-R1 | TAGAAATGTATTGTCTTTTGGTG |
II | ORF1-F | AAGCAGCACTGTAGCTGGAG | 770-2,634 | 1,865 |
ORF1-R | CTTACGTCACAAAACAAGATGG |
III | TTCaV-F2 | ATGGTGGCCCATTACCAACCCCTAC | 1-273, 1,911-2,797 | 1,160 |
TTCaV-R2 | TATTCCGATGTCCGATTTGCATAATCG |
* Primer positions are indicated based on the genome of the prototype Japanese TTCaV (AB076002). |
2.4 PCR amplification of ORF1 and full genome of TTCaV
TTCaV-positive samples were used to amplify the ORF1 region using primer set II (ORF1-F and ORF1-R, Table 1). Each PCR reaction mixture consisted of 5 µL of template DNA, 1 µL of primers (20 µM each), 5U TaKaRa LA Taq (Takara Korea Biomedical, Seoul, Korea), 25 µL of 2X GC buffer I, 8 µL of dNTP mixture (2.5mM each), and 9 µL of distilled water to make up the volume to 50 µL. PCR amplification was initiated by preheating for 3 min at 95°C, followed by 34 cycles of 30 s at 95°C, 30 s at 49°C, and 2 min at 72°C, and a final extension for 5 min at 72°C.
Primer set III (TTCaV-F2, TTCaV-R2) (Table 1) was used to amplify the remaining TTCaV-containing GC-rich regions. The total volume and components of the PCR were the same as those used for the ORF1 amplification. PCR amplification was initiated by preheating for 3 min at 95°C, followed by 34 cycles of 30 s at 95°C, 30 s at 54.5°C, and 2 min at 72°C, and a final extension for 5 min at 72°C. The amplified DNA product was purified using a MEGAquick-spin Plus Total Fragment DNA Purification Kit (iNtRON Biotechnology, Seongnam, South Korea) and cloned into the RBC T&A cloning vector system (RBC Bioscience, Taipei, Taiwan) according to the manufacturer’s instructions. The selected clone containing the amplified DNA was sequenced by Cosmo Genetech (Seoul, Korea).
2.5 Sequence identity and phylogenetic analysis
The ORF1 sequences and full sequences of TTCaV were aligned using the ClustalW multiple alignment tool of the Bio-Edit software (v.7.2.5). Sequence identity and phylogenetic analyses were performed using the aligned sequences. Sequence identity analysis was performed using Bio-Edit software (v.7.2.5). Phylogenetic trees were generated by the Maximum Likelihood method with 500 bootstrap replicates using the MEGA-Ⅹ software (v.11). The representative sequences of TTV and TTCaV were obtained from GenBank (https://www.ncbi.nlm.nih.gov/genbank/).
2.6 Similarity plot and recombination analysis
The full genome alignment of TTCaV was used for similarity plot and recombination analyses. Similarity plot analysis was performed using SimPlot software (v.3.5.1) using the Kimura 2-parameter model. The Japanese TTCaV prototype (AB076002) was used as a query. The recombination detection program 4 (RDP4) was used to screen for potential recombination events. Seven methods in the RDP4 software, including RDP, GENECONV, BootScan, Maxchi, Chimaera, SiScan, and 3Seq, were used to detect recombination events and breakpoints. The highest acceptable p value cut-off was set to 0.05.