Growth hormone inhibits adipogenic differentiation and induces browning in bovine subcutaneous adipocytes

doi:10.21203/rs.3.rs-1640988/v1

Download PDF

Research Article

Growth hormone inhibits adipogenic differentiation and induces browning in bovine subcutaneous adipocytes

https://doi.org/10.21203/rs.3.rs-1640988/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 01 Oct, 2022

Read the published version in Growth Hormone & IGF Research →

Version 1

posted

You are reading this latest preprint version

It is well established that growth hormone (GH) has the ability to stimulate lipolysis. The effects of GH on adipocyte differentiation and browning have not been clearly described. Therefore, the present study aimed to elucidate the role of GH in the differentiation and browning of bovine subcutaneous adipocytes as well as its underlying molecular mechanisms. In this study, we demonstrated that GH inhibited lipid accumulation and decreased the expression levels of adipogenic key genes (SCD1, SREBP1, PPARγ, and CEBPα) during adipocyte differentiation. Moreover, we observed that the inhibitory effect of GH on the early stage of adipocyte differentiation (0–2 days) was stronger than that on the later stage of adipocyte differentiation (2–8 days). We also found that GH promoted the expression levels of browning-related genes such as uncoupling protein 1 (UCP1) in mature adipocytes. Concurrently, GH promoted mitochondrial biogenesis and increased the expression levels of mitochondrial biogenesis-related genes. In addition, GH promoted phosphorylation of signal transducers and activator of transcription 5 b (STAT5B) and contributed to translocation of STAT5B to nucleus. After blocking the expression of STAT5B protein, GH weakened the inhibition of adipogenic key genes and reduced the promotion of browning-related genes in bovine subcutaneous adipocytes. To sum up, our findings indicate that GH inhibits adipocyte differentiation and promotes adipocyte browning by regulating STAT5B in bovine subcutaneous adipocytes.

Growth hormone

Adipocyte

Bovine

STAT5B

As an important endocrine organ, adipose tissue can regulate energy balance and maintain metabolic homeostasis in the body [1]. Traditionally, there are two colors of adipose tissues in humans and animals, white and brown. Recent studies have found that the white adipocytes from white adipose tissue (WAT) can be converted into beige or brite adipocytes in response to external stimuli such as cold or drugs [2, 3]. Adipocytes with different colors have different functions, white adipocytes store energy, while brown and beige adipocytes consume energy to produce heat [4]. The main reason for the different metabolic types of adipocytes is the difference in mitochondrial content [5]. Compared with white adipocytes, brown and beige adipocytes have more mitochondria to produce heat through the uncoupling protein 1 (UCP1) rather than catalyzing ATP synthesis [6]. Since the process of browning can consume excess energy and reduce fat deposition, thus combating obesity and related metabolic diseases, more and more studies attempt to identify regulatory factors that can promote the browning of white adipocytes.

The differentiation of adipocytes is the key process for adipogenesis in adipose tissue and is regulated by many transcription factors. Peroxisome proliferator-activated receptor gamma (PPARγ) has been reported to significantly promote adipocyte differentiation, and the differentiation is inhibited by the knockout of PPARγ [7, 8]. Moreover, CCAAT enhancer binding protein alpha (CEBPα) is also a key transcription factor regulating adipogenic differentiation, which promotes differentiation combined with PPARγ [9]. In adipocytes cultured in vitro, the differentiation of adipocytes is often induced by a medium containing MDI (insulin + IBMX + dexamethasone). Notably, increasing evidence reveals that adding triiodothyronine, CL316243, and rosiglitazone to the medium during the induction stage of differentiation can induce white adipocytes to become beige adipocytes [10–12]. This provides a new insight for the study on inducing the browning of adipocytes in vitro.

Growth hormone (GH) is a kind of polypeptide hormone, which participates in the regulation of body growth and development. GH possesses multiple biological functions, especially regulating fat deposition in adipose tissue. Previous studies have shown that GH treatment can significantly reduce the fat mass of mice [13, 14]. A study on human subcutaneous adipose tissue has also reported that GH supplementation markedly reduced the size of adipocytes [15]. These studies indicate that GH level is negatively correlated with adipose tissue content. In addition, research has disclosed that GH has a significant impact on fat distribution, and the content of subcutaneous WAT in GH knockout mice is quite higher than that in perigonadal WAT [16]. Previous evidence also identified that the extra-/intraperitoneal WAT ratio was upregulated in GH receptor antagonist (GHA) mice [17]. Although the inhibitory effect of GH on fat deposition has been widely confirmed, the effect of GH on adipocytes is still controversial. Accumulating evidences have reported that GH can promote the adipocyte differentiation of 3T3-L1 and 3T3-F442A, the cell lines from mice [18–20]. Inversely, the adipogenic differentiation of preadipocytes in primary cultures has been significantly inhibited during GH treatment [21, 22]. Furthermore, GH is also important in inducing WAT browning. For example, GH remarkably increases the expression level of UCP1 gene in subcutaneous WAT from mice [23]. To date, the ability of GH to induce the browning of adipocytes, especially subcutaneous adipocytes, has not been extensively studied.

Signal transducers and activator of transcription 5 (STAT5) protein plays a pivotal role in the regulation of fat deposition by GH. Study has shown that STAT5 is activated in GH-treated mouse adipose tissue [24]. After STAT5 knockout, GH could not continue to stimulate lipolysis in mouse adipocytes and the fat mass was also increased in mice [25, 26]. STAT5 is divided into two subtypes, STAT5A and STAT5B. STAT5A mainly acts on mammary tissue, and researchers have found that STAT5A-deficient mice could not lactate normally [27]. It has been reported that STAT5A plays a role in promoting adipogenesis [28]. In contrast, STAT5B has been reported to inhibit adipocyte differentiation [29]. Therefore, the regulation of GH on STAT5B may be the key for GH to inhibit the differentiation of preadipocytes in primary cultures.

Although the lipolysis of GH on adipose tissue has been established, the effect of GH on the differentiation and browning of bovine subcutaneous adipocytes remains unclear. In this study, we treated bovine subcutaneous preadipocytes with GH to detect the indicators related to differentiation and browning, and measured the expression of STAT5B protein during GH treatment. These results provide a theoretical basis for future studies into the mechanism of GH on fat metabolism of bovine subcutaneous adipocytes.

Materials and reagents

GH was purchased from Prospec (Ness-Ziona, Israeli). Phosphate buffer saline (PBS), penicillin and streptomycin, and Dulbecco’s modified Eagle’s medium/nutrient mixture F12 (DMEM/F12) were obtained from Hyclone (Logan, UT, USA). Fetal bovine serum (FBS) was purchased from Sciencell (Carlsbad, CA, USA). Type I collagenase, insulin, rosiglitazone, dexamethasone, 3-isobutyl-1-methylxanthine (IBMX), and oil red O were purchased from Sigma-Aldrich (St. Louis, MO, USA). MitoTracker Red was purchased from Warbio (Nanjing, Jiangsu, China). Cell counting kit 8 (CCK-8), BCA assay kit, and ECL kit were purchased from Vazyme (Nanjing, Jiangsu, China). Bovine serum albumin (BSA), DAPI, RIPA buffer, and protease inhibitor were purchased from Beyotime (Shanghai, China). Genomic DNA Extraction Kit, Trizol, PrimeScript™ RT Master Mix, and SYBR Premix were purchased from TaKaRa (Tokyo, Japan). STAT5-IN-1 was purchased from Selleck (Houston, Texas, USA).

Cell culture and adipogenic differentiation

Bovine subcutaneous primary adipocytes were isolated from the subcutaneous adipose tissue in Simmental cattle. Firstly, the isolated adipose tissue samples were washed with PBS, minced with scissors, and digested with type I collagenase at 37 °C for 1 h. Next, the digested cell suspensions were filtered through the cell strainer, then centrifuged, re-suspended in a standard medium. The standard medium was DMEM/F12 supplemented with 10% FBS and 100 U/mL penicillin and streptomycin. Finally, the preadipocytes were incubated in a humidified atmosphere of 5% CO₂at 37°C. The culture medium was changed every 2 days. To induce adipogenic differentiation, the fully confluent preadipocytes were cultured in a standard medium for 2 days (day 0), then cultured in a differentiation medium for 6 days and finally cultured in a standard medium containing 1 μg/mL insulin for 2 days. The differentiation medium comprised of standard medium supplemented with 1 μg/mL insulin, 2 μM rosiglitazone, 1 μM dexamethasone, and 0.5 mM IBMX.

Cell viability assay

Bovine subcutaneous preadipocytes were seeded in a 96-well plate and incubated at 37℃ for 24 h. Next, the preadipocytes were treated with GH of various concentrations (0, 10, 100, 500 ng/mL) for 48 h. Afterward, 10 μL of CCK8 solution was added to each well and incubated at 37℃ for 4 h. The absorbance value was measured at 450 nm by using a microplate reader (Tecan, Switzerland).

Oil red O staining

After 8 days of adipogenic differentiation, adipocytes were washed with PBS and fixed in 4% paraformaldehyde for 30 min. Adipocytes were then washed with PBS three times and stained with oil red O working solution for 1 h at room temperature in dark. After washing with doubly distilled water 3-6 times, adipocytes were observed and photographed with a light microscope (CKX41, Olympus, Japan). Lipid contents in adipocytes were extracted with 100% isopropanol and the absorbance value at 510 nm was read by a microplate reader (Tecan, Switzerland).

Real-time quantitative PCR (RT-qPCR) analysis

Total RNA was extracted from adipocytes by using Trizol. After that, total RNA was used as a template for cDNA synthesis by using PrimeScript™ RT Master Mix. RT-qPCR was performed with the mixture of SYBR Premix, primers, and cDNA on a QuantStudio 5 system (ABI, Carlsbad, CA, USA). Details of the primer sequences for acetyl-CoA carboxylase (ACC), stearoyl-Coenzyme A desaturase 1 (SCD1), sterol regulatory element binding protein 1 (SREBP1), PPARγ, CEBPα, UCP1, peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PGC-1α), PR domain containing 16 (PRDM16), cluster of differentiation 137 (CD137), T-box transcription factor 1 (TBX1), cell death inducing DFFA like effector A (CIDEA), deiodinase-2 (DIO2), mitochondrial transcription factors A (TFAM), nuclear respiratory factor 1 (NRF1), nuclear respiratory factor 2 (NRF2), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) are shown in Table 1. The expression level of relative genes was calculated using 2^−∆∆Ct method and normalized to GAPDH [30].

Table 1

Primers sequences for target and reference genes.

Gene	Gene ID	Primer sequences (5' to 3')	Product size (bp)
ACC	NM_174224.2	F: GCTATGGAAGTCGGCTGTGGAAG R: GGAAGAGGCGGATGGGAATTGC	102
SCD1	NM_173959.4	F: CTACACAACCACCACCACCATCAC R: CTCTCATTTCAGGGCGGATGTCTTC	116
SREBP1	NM_001113302.1	F: CTCCGACACCACCAGCATCAAC R: GCAGCCCATTCATCAGCCAGAC	122
PPARγ	NM_181024.2	F: TTGACCCAGAGAGTGAGCCCTTC R: CCACGGAGCTGATCCCAAAGTTG	117
CEBPα	NM_176784. 2	F: TGGACAAGAACAGCAACGAGTACC R: GGCGGTCATTGTCACTGGTCAG	138
UCP1	NM_001166528.1	F: TGCGTGGCTGACATAATCACCTTC R: GGCACTGGAGATCAGGCATTCG	96
PGC-1α	XM_024993058.1	F: AGGCAGAGGCAGAAGGCAATTAAC R: CCTCAGTTCTGTCCGTGTTGTGTC	117
PRDM16	XM_024976786.1	F: CTTGGAGCAGCACATGGTCGTC R: TCTGGTGGCGGATGAGGTTGG	101
CD137	NM_001035336.2	F: TGGCGTCCTTCCTGGTTCTCC R: CCTCTTGGGCTGTTTGTACTGGTC	108
TBX1	XM_024977887.1	F: GCAGTCACCGCCTATCAGAATCAC R: GTCACAGTCTCGGAAGCCTTTGG	84
CIDEA	NM_001083449.1	F: CCTTCCGTGTCTCCAACCATGAC R: GCGACCACCAGTGCATCCAAG	100
DIO2	NM_001010992.7	F: CATCCGTGGCTGACTTCCTGTTG R: CTTCCTGGTTCCGGTGCTTCTTC	117
TFAM	NM_001034016.2	F: AAACCGAAAAGACCTCGCTCAGC R: TACCTGTGATGTGCCATCCCTAGC	81
NRF1	NM_001098002.2	F: AATTATTCGGCGGTGGCTGATGG R: GCGTTGTCTGGATGGTCATCTCAC	82
NRF2	NM_001011678.2	F: TCAGCCAGCACAACACATACCATC R: ACGGGAATGTCTCTGCCAAAAGC	128
ND1	NC_006853.1	F: CGTAGAATATGCAGCAGGACCA R: GTTCTGGTATGTGTGGATTGTGG	125
GAPDH	NM_001034034.2	F: CGGCACAGTCAAGGCAGAGAAC R: CCACATACTCAGCACCAGCATCAC	116

ACC, acetyl-CoA carboxylase; SCD1, stearoyl-Coenzyme A desaturase 1; SREBP1, sterol regulatory element binding protein 1; PPARγ, peroxisome proliferator-activated receptor gamma; CEBPα, CCAAT enhancer binding protein alpha; UCP1, uncoupling protein 1; PGC-1α, peroxisome proliferator-activated receptor gamma coactivator 1 alpha; PRDM16, PR domain containing 16; CD137, cluster of differentiation 137; TBX1, T-box transcription factor 1; CIDEA, cell death inducing DFFA like effector A; DIO2, deiodinase-2; TFAM, mitochondrial transcription factors A; NRF1, nuclear respiratory factor 1; NRF2, nuclear respiratory factor 2; ND1, NADH dehydrogenase subunit 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Western blot analysis

The lysates of adipocytes were harvested using the mixture of RIPA buffer and protease inhibitor. After centrifugation, the supernatant was quantified by a BCA assay kit and boiled with sodium dodecyl sulfate sample buffer. Then, the isolated protein was loaded and run on a sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto PVDF membranes. The membranes were blocked with fat-free milk followed by incubation with primary antibodies against PPARγ (SC-7196, Santa Cruz, 1:1000), GAPDH (10494-1-AP, Proteintech, 1:1000), STAT5B (bs-1142R, Bioss, 1:1000), and phosphor-STAT5B (bs-5703R, Bioss, 1:1000). The membranes were incubated with secondary antibody (7074P2, CST, 1:4000) and visualized using an ECL kit on the ChemiDocTM imaging system (BIO-RAD, Hercules, CA, USA).

Mitochondrial DNA (mtDNA) quantification

Adipocytes were treated with GH and performed for DNA extraction using the genomic DNA extraction kit. The mtDNA content was quantitatively analyzed by normalizing the NADH dehydrogenase subunit 1 (ND1) gene to GAPDH using RT-qPCR. The primer sequences are available in Table 1. The mtDNA content was calculated by using the 2^−∆∆Ct method [30].

MitoTracker red staining

Bovine subcutaneous adipocytes were differentiated into mature adipocytes in 6-well plates with coverslips on the bottom. Mature adipocytes were treated with 500 ng/mL GH for 6 h and stained with 200 nM MitoTracker red at 37℃ for 30 min. After fixing with 4% paraformaldehyde and washing with PBS, adipocytes were stained with DAPI for 10 min. Finally, coverslips containing labeled adipocytes were mounted on microscopic slides and the images were obtained with a laser scanning confocal microscope (LSM900, Zeiss, Germany).

Immunofluorescent staining

Adipocytes were differentiated in culture plates with coverslips and then treated with GH for 1 h. Next, adipocytes were fixed with 4% paraformaldehyde for 15 min and permeabilized with 0.5% Triton X-100 for 30min. After blocking with 5% BSA for 1 h, adipocytes were incubated with STAT5B antibody (bs-1142R, Bioss, 1:200) overnight at 4 °C followed by staining with the florescent secondary antibody for 50 min. Then, the nuclei of adipocytes were counterstained with DAPI for 5 min. Fluorescence images were taken with laser scanning confocal microscope (LSM900, Zeiss, Germany).

Statistical analysis

All data were analyzed by the independent sample t-test using SPSS 22.0 software (IBM, Chicago, IL, USA). Data were shown as mean ± standard error of the mean (SEM). The p-values less than 0.05 were considered statistically significant.

GH inhibited the differentiation of bovine subcutaneous preadipocytes

Firstly, we detected the cytotoxicity of GH on bovine subcutaneous preadipocytes by CCK8 assay. After GH treatment for 48 h, the cell viability of preadipocytes was unchanged at concentrations as high as 500 ng/mL (Fig. 1a). To investigate the effect on the differentiation of preadipocytes to mature adipocytes by GH treatment, we treated preadipocytes with different concentrations (0, 10, 100, and 500 ng/mL) of GH for 8 days during adipocyte differentiation (Fig. 1b). Oil red O staining showed clear lipid droplets in differentiated adipocytes without GH treatment (Fig. 1c). However, treatment with GH for 8 days inhibited the accumulation of lipid droplets in differentiated adipocytes (Fig. 1c). Lipid extraction of adipocytes after staining with oil red O showed that 100 and 500 ng/mL GH treatments significantly reduced the lipid content of differentiated adipocytes (Fig. 1d). To further demonstrate the inhibitory effect of GH on adipogenesis, we examined the expression levels of adipogenesis-related genes (ACC, SCD1, SREBP1, PPARγ, and CEBPα) in differentiated adipocytes after 8 days of GH treatment. Compared with those in the 0 ng/mL GH treatment group, 10 ng/mL GH treatment significantly inhibited the expression level of SREBP1 gene, 100 ng/mL GH treatment significantly decreased the expression level of PPARγ gene, and the expression levels of SCD1, SREBP1, PPARγ, and CEBPα genes were significantly decreased in 500 ng/mL GH treatment group (Fig. 1e). These results suggested that GH inhibited the differentiation of bovine subcutaneous preadipocytes.

GH strongly suppressed the differentiation of bovine subcutaneous adipocytes at the early stage of differentiation

To further understand the inhibitory mechanism of GH on the differentiation of adipocytes, we treated adipocytes with GH at different stages of adipogenic differentiation (Fig. 2a). Adipogenesis of adipocytes was detected by oil red O staining. Compared with untreated adipocytes, the lipid content was significantly decreased in adipocytes treated with 500 ng/mL GH at different stages (Fig. 2b-c). Interestingly, we observed that the inhibitory effect of GH on the early stage of adipocyte differentiation (0-2 days) was stronger compared to the later stage of adipocyte differentiation (2-8 days). Therefore, adipocytes were collected for analysis of adipogenic key genes and proteins after treatment with differentiation medium and GH for 1 and 2 days. RT-qPCR results showed that the expression levels of SCD1, SREBP1, PPARγ, and CEBPα were significantly reduced after GH treatment for 1 day, and the expression levels of ACC, SCD1, SREBP1, PPARγ, and CEBPα were significantly decreased after GH treatment for 2 days (Fig. 2d-e). Western blot analysis showed that the expression level of PPARγ protein decreased significantly after GH treatment for both 1 and 2 days (Fig. 2f).

GH promoted the browning and mitochondrial biogenesis of bovine subcutaneous adipocytes

To study the effect of GH on the browning of mature adipocytes, we cultured adipocytes in a differentiation medium for 8 days and then treated the differentiated adipocytes with GH. The expression level of the browning key gene UCP1 was analyzed by RT-qPCR. As shown in Fig. 3a, the expression level of UCP1 gene was significantly increased in fully differentiated adipocytes treated with 500 ng/mL GH for 2 h and 6 h. Then, we examined the expression levels of browning-related genes (PGC-1α, PRDM16, CD137, TBX1, CIDEA, and DIO2) in mature adipocytes treated with 500 ng/mL GH for 6 h, and found that GH treatment significantly increased the expression levels of PGC-1α, PRDM16, TBX1, and CIDEA genes (Fig. 3b). Mitochondrial biogenesis is one of the key characteristics of browning. We observed that 6 h of GH treatment significantly increased the content of mtDNA in mature adipocytes, suggesting the increased mitochondrial number (Fig. 3c). MitoTracker red staining in mature adipocytes further demonstrated that GH treatment enhanced mitochondrial red fluorescence signal (Fig. 3d). In addition, mitochondrial biogenesis-specific markers NRF1 and NRF2 were up-regulated in GH-treated mature adipocytes (Fig. 3e). Together, the above results showed that GH promoted the browning and mitochondrial biogenesis of bovine subcutaneous adipocytes.

GH increased the phosphorylation of STAT5B in bovine subcutaneous adipocytes

STAT5 is widely involved in growth and development processes including cell proliferation, differentiation, etc. As a subtype of STAT5, STAT5B can participate in the GH-regulated lipolysis process [31, 32]. Therefore, to clarify whether GH can activate the expression of STAT5B in bovine subcutaneous adipocytes, we first treated preadipocytes (day 0) with a differentiation medium and 500 ng/mL GH for indicated time to detect the phosphorylation level of STAT5B. Although incubation with GH for 10 min and 30 min had no significant effect on the phosphorylation level of STAT5B, 60 min and 180 min of GH treatment significantly increased the phosphorylation level of STAT5B (Fig. 4a). Then we treated fully differentiated adipocytes with 500 ng/mL GH for 1 h and 6 h and found that both 1 h and 6 h of GH treatment markedly promoted STAT5B activation (Fig. 4b). Furthermore, immunofluorescence staining of STAT5B showed that STAT5B protein could be translocated to the nucleus to regulate gene transcription (Fig. 4c).

GH-induced differentiation and browning of bovine subcutaneous adipocytes were mediated by STAT5B

To further determine the activation mechanism of GH on STAT5B, we treated adipocytes in the differentiation stage (day 0) with GH for 1 h, with or without pretreatment with 100 μM STAT5-IN-1 (STAT5 inhibitor) for 1 h. Western blot analysis showed that 100 µM STAT5-IN-1 treatment significantly inhibited the phosphorylation of STAT5B initiated by GH (Fig. 5a). Moreover, we treated adipocytes with 100 μM STAT5-IN-1 for 1 h followed by GH for 24 h during the differentiated process (day 0). We found that pretreatment with STAT5-IN-1 significantly alleviated the downregulation of PPARγ and SREBP1 genes after GH treatment (Fig. 5b). In addition, treatment on fully differentiated adipocytes with STAT5-IN-1 and GH for 1 h and 6 h, respectively, significantly inhibited GH-induced the upregulation of UCP1 and PGC-1α genes. These results indicated that GH may inhibit adipogenic differentiation and promote the browning of adipocytes by activating STAT5B.

GH is an important cytokine in regulating the growth and development of the body, and accumulating evidences have shown that GH has a significant impact on adipose tissue metabolism [33, 34]. In particular, GH can suppress the differentiation of primary cell cultures [35]. Indeed, although GH has been found to promote the expression of UCP1 in mouse model, the specific regulation mechanisms need further research [23]. STAT5B is a key transcription factor in cell development regulated by GH, which can transmit extracellular signals to the nucleus and regulate cell metabolic activities [36]. Therefore, in this research, we investigated the effects of GH on the differentiation and browning of bovine subcutaneous adipocytes by culturing bovine subcutaneous adipocytes in vitro, and explored the role of STAT5B protein in the regulation of GH on bovine subcutaneous adipocytes.

It has been well accepted that GH can promote lipolysis and reduce WAT weight in the body [37]. Research on primary human mesenchymal stromal cells (MSCs) has confirmed that GH inhibited adipocyte differentiation [21]. In the present study, we found that GH treatment for 8 days significantly inhibited the lipid content of bovine subcutaneous adipocytes, which is consistent with the results of Zhao et al. [38]. Olarescu et al. [35] also found that bovine GH (bGH) cells from mice subcutaneous WAT displayed a decreased lipid accumulation compared to wild-type (WT) cells. Adipocyte differentiation is promoted by many key transcription factors, among which PPARγ is the core regulator of entire terminal differentiation [39]. In addition, CEBPα promotes adipogenic differentiation through reciprocal positive feedback regulation with PPARγ [39]. SREBP1 can promote the expression of PPARγ and SCD1, and both SREBP1 and SCD1 play an important role in regulating de novo lipogenesis [40, 41]. Our results suggested that GH inhibited adipogenesis of bovine subcutaneous adipocytes by down-regulating the expression levels of PPARγ, CEBPα, SREBP1, and SCD1 genes. This is contrary to the results in 3T3-L1 adipocytes, in which GH can significantly elevate the expression level of PPARγ protein [18, 42]. This may further confirm the opposite effects of GH on cell lines and primary adipocytes. The early phase of differentiation is the most crucial phase to initiate and ensure the normal differentiation process. Our study revealed that GH treatment had a stronger inhibitory effect on lipid accumulation in the early stage (0–2 days) than that in the later stage (2–8 days). Additionally, we identified the inhibitory effect of GH on the expression of key genes and proteins during adipogenic differentiation. These findings suggested that GH exerted the ability to inhibit adipogenic differentiation, especially in the early stage of differentiation, through inhibiting lipid accumulation and the expression of adipogenic-related genes.

The browning of WAT is essential for the body to combat obesity, resist cold and increase heat production. Accordingly, researches related to inducing browning by using in vitro and in vivo models have attracted increasing attention. Recent work showed that compared with WT mice, the expression of UCP1 protein in bGH transgenic mice was increased [43]. As a marker of beige adipocytes, UCP1 leads protons to leak through the inner membrane of mitochondria and thus converting electrochemical energy into heat, which plays a central role in heat production [44]. Our study demonstrated that GH treatment could significantly increase the expression levels of UCP1 and browning-related key genes (PGC-1α, PRDM16, TBX1, and CIDEA) in bovine subcutaneous adipocytes, indicating a potential role of GH in inducing beige fat-like characteristic. Moreover, Hayashi et al. [45] also proposed that GH induced the expression of UCP1 protein in 3T3-L1 cells, which was coincident with our results. Due to beige adipocytes requiring more mitochondria for metabolism and thermogenesis, mitochondrial biogenesis has become a marker process of browning. Research has shown that mitochondrial biogenesis is dominant in the process of beige adipocytes formation [46]. The mtDNA replication is the main feature of mitochondrial biogenesis, which reflects the increase of mitochondrial number. In this study, GH treatment can increase mtDNA contents in bovine subcutaneous adipocytes. In addition, MitoTracker staining further demonstrated that GH treatment promoted mitochondrial biogenesis in bovine subcutaneous adipocytes. TFAM, NRF1, and NRF2 are key regulatory factors controlling mitochondrial biogenesis, and PGC-1α can activate the expression of these key transcription factors, led to an increase in mtDNA content, thus promoting mitochondrial biogenesis [47, 48]. In this work, we demonstrated that the expression levels of PGC-1α, NRF1, and NRF2 genes were increased in GH-treated adipocytes. Overall, these findings indicated that GH can induce the browning of bovine subcutaneous adipocytes and promote the mitochondrial biogenesis.

There is increasing evidence that GH has the potential to activate STAT5B both in vivo and in vitro [18, 49]. Previous data have suggested that the expression of STAT5B protein was increased during adipocyte differentiation, and STAT5B knockdown up-regulated the expression of PPARγ and CEBPα [29, 50]. Moreover, several studies also confirmed that STAT5 promoted transcription by binding to the UCP1 promoter and cold exposure could not promote UCP1 protein increase in STAT5-deficient mice [45, 51]. Therefore, we hypothesized that GH could activate STAT5B expression to regulate the differentiation and browning of bovine subcutaneous adipocytes. As expected, our results showed that GH can activate STAT5B in differentiating as well as full differentiated adipocytes, suggesting that STAT5B plays an important role in GH-regulated differentiation and browning processes. STAT5B is widely present in the cytoplasm as a monomer when cells are not stimulated by cytokines and hormones. In response to GH stimulation, phosphorylated STAT5B separates from its receptor and forms different polymeric forms, which are transferred to the nucleus and activate or inhibit transcription by binding to specific DNA sequences [52]. This transcriptional regulation of nuclear translocation is the key for STAT5B to fulfill its function. In this study, STAT5B protein was translocated to the nucleus after GH treatment in bovine subcutaneous adipocytes. Consistent with our findings, it has been reported that GH promotes mitochondrial biogenesis by activating STAT5, which is then transported to the nucleus and interacts synergistically with other growth factors [53]. Next, we used STAT5-IN-1 to block the activity of STAT5B and found that the expression level of key genes involved in adipocyte differentiation and browning decreased significantly, indicating that GH inhibits adipocyte differentiation and promotes adipocyte browning in vitro by activating the expression of STAT5B protein.

In conclusion, our data prove that GH can inhibit the adipogenic differentiation of bovine subcutaneous preadipocytes, and the inhibitory effect of GH is more obvious in the early stage of differentiation than that in the later stage. GH can also promote the browning of bovine subcutaneous adipocytes, accompanied by mitochondrial biogenesis. In addition, studies on STAT5B, a key factor in transcriptional regulation, found that GH regulated the differentiation and browning process of bovine subcutaneous adipocytes through activating STAT5B. Collectively, our results suggest the inhibitory effect of GH on the differentiation of preadipocytes and the feasibility of GH to induce the browning of adipocytes in vitro.

Author contributions

TL performed the main experiments and drafted the manuscript. TL and HB designed this study. TL and HF carried out the data collection and analysis. TL and LY performed the material preparation. PY supervised the research and revised the manuscript. All authors reviewed and approved the final manuscript.

Funding

This study was supported by the National Key Research and Development Plan of China (2016YFD0500508).

Data availability

The data that support the findings of the current study are available from the corresponding author on reasonable request.

Conflict of interest

The authors declare that they have no conflict of interest.

Ethical approval

The collection of adipose tissue samples were approved by the Institutional Animal Care and Use Committee at Nanjing Agricultural University (Permission number: SYXK-2017-0027).

Kershaw EE, Flier JS (2004) Adipose tissue as an endocrine organ. J Clin Endocrinol Metab 89(6):2548-2556. https://doi.org/10.1210/jc.2004-0395
Rosenwald M, Perdikari A, Rülicke T, Wolfrum C (2013) Bi-directional interconversion of brite and white adipocytes. Nat Cell Biol 15(6):659-667. https://doi.org/10.1038/ncb2740
Vargas-Castillo A, Fuentes-Romero R, Rodriguez-Lopez LA, Torres N, Tovar AR (2017) Understanding the biology of thermogenic fat: Is browning a new approach to the treatment of obesity? Arch Med Res 48(5):401-413. https://doi.org/10.1016/j.arcmed.2017.10.002
Giralt M, Villarroya F (2013) White, brown, beige/brite: Different adipose cells for different functions? Endocrinology 154(9):2992-3000. https://doi.org/10.1210/en.2013-1403
Sell H, Deshaies Y, Richard D (2004) The brown adipocyte: update on its metabolic role. Int J Biochem Cell Biol 36(11):2098-2104. https://doi.org/10.1016/j.biocel.2004.04.003
Cohen P, Spiegelman BM (2015) Brown and beige fat: molecular parts of a thermogenic machine. Diabetes 64(7):2346-2351. https://doi.org/10.2337/db15-0318
Rosen ED, Sarraf P, Troy AE, Bradwin G, Moore K, Milstone DS, Spiegelman BM, Mortensen RM (1999) PPARγ is required for the differentiation of adipose tissue in vivo and in vitro. Molecular Cell 4(4):611-617. https://doi.org/10.1016/S1097-2765(00)80211-7
Kubota N, Terauchi Y, Miki H, Tamemoto H, Yamauchi T, Komeda K, Satoh S, Nakano R, Ishii C, Sugiyama T, Eto K, Tsubamoto Y, Okuno A, Murakami K, Sekihara H, Hasegawa G, Naito M, Toyoshima Y, Tanaka S, Shiota K, Kitamur T, Fujita T, Ezaki O, Aizawa S, Nagai R, Tobe K, Kimura S, Kadowaki T (1999) PPARγ mediates high-fat diet–induced adipocyte hypertrophy and insulin resistance. Molecular Cell 4(4):597-609. https://doi.org/10.1016/s1097-2765(00)80210-5
Rosen ED, Hsu CH, Wang X, Sakai S, Freeman MW, Gonzalez FJ, Spiegelman BM (2002) C/EBPα induces adipogenesis through PPARγ: a unified pathway. Genes Dev 16(1):22-26. https://doi.org/10.1101/gad.948702
Wang J, Zhang L, Dong L, Hu X, Feng F, Chen F (2019) 6-gingerol, a functional polyphenol of ginger, promotes browning through an AMPK-dependent pathway in 3T3-L1 adipocytes. J Agric Food Chem 67(51):14056-14065. https://doi.org/10.1021/acs.jafc.9b05072
Danysz W, Han Y, Li F, Nicoll J, Buch P, Hengl T, Ruitenberg M, Parsons C (2018) Browning of white adipose tissue induced by the β3 agonist CL-316,243 after local and systemic treatment - PK-PD relationship. Biochim Biophys Acta Mol Basis Dis 1864(9):2972-2982. https://doi.org/10.1016/j.bbadis.2018.06.007
Xie S, Li Y, Teng W, Du M, Li Y, Sun B (2019) Liensinine inhibits beige adipocytes recovering to white adipocytes through blocking mitophagy flux in vitro and in vivo. Nutrients 11(7):1640-1654. https://doi.org/10.3390/nu11071640
List EO, Palmer AJ, Berryman DE, Bower B, Kelder B, Kopchick JJ (2009) Growth hormone improves body composition, fasting blood glucose, glucose tolerance and liver triacylglycerol in a mouse model of diet-induced obesity and type 2 diabetes. Diabetologia 52(8):1647-1655. https://doi.org/10.1007/s00125-009-1402-z
Berryman DE, List EO, Kohn DT, Coschigano KT, Seeley RJ, Kopchick JJ (2006) Effect of growth hormone on susceptibility to diet-induced obesity. Endocrinology 147(6):2801-2808. https://doi.org/10.1210/en.2006-0086
Bredella MA, Karastergiou K, Bos SA, Gerweck AV, Torriani M, Fried SK, Miller KK (2017) GH administration decreases subcutaneous abdominal adipocyte size in men with abdominal obesity. Growth Horm IGF Res 35:17-20. https://doi.org/10.1016/j.ghir.2017.06.001
List EO, Berryman DE, Buchman M, Jensen EA, Funk K, Duran-Ortiz S, Qian Y, Young JA, Slyby J, McKenna S, Kopchick JJ (2019) GH knockout mice have increased subcutaneous adipose tissue with decreased fibrosis and enhanced insulin sensitivity. Endocrinology 160(7):1743-1756. https://doi.org/10.1210/en.2019-00167
Comisford R, Lubbers ER, Householder LA, Suer O, Tchkonia T, Kirkland JL, List EO, Kopchick JJ, Berryman DE (2016) Growth hormone receptor antagonist transgenic mice have increased subcutaneous adipose tissue mass, altered glucose homeostasis and no change in white adipose tissue cellular senescence. Gerontology 62(2):163-172. https://doi.org/10.1159/000439050
Kawai M, Namba N, Mushiake S, Etani Y, Nishimura R, Makishima M, Ozono K (2007) Growth hormone stimulates adipogenesis of 3T3-L1 cells through activation of the Stat5A/5B-PPARγ pathway. J Mol Endocrinol 38(1-2):19-34. https://doi.org/10.1677/jme.1.02154
Xu A, Wong LC, Wang Y, Xu JY, Cooper GJS, Lam KSL (2004) Chronic treatment with growth hormone stimulates adiponectin gene expression in 3T3-L1 adipocytes. FEBS Lett 572(1-3):129-134. https://doi.org/10.1016/j.febslet.2004.07.020
Shang CA, Waters MJ (2003) Constitutively active signal transducer and activator of transcription 5 can replace the requirement for growth hormone in adipogenesis of 3T3-F442A preadipocytes. Mol Endocrinol 17(12):2494-2508. https://doi.org/10.1210/me.2003-0139
Bolamperti S, Signo M, Spinello A, Moro G, Fraschini G, Guidobono F, Rubinacci A, Villa I (2018) GH prevents adipogenic differentiation of mesenchymal stromal stem cells derived from human trabecular bone via canonical Wnt signaling. Bone 112:136-144. https://doi.org/10.1016/j.bone.2018.04.014
Sharma VM, Vestergaard ET, Jessen N, Kolind-Thomsen P, Nellemann B, Nielsen TS, Vendelbo MH, Møller N, Sharma R, Lee KY, Kopchick JJ, Jørgensen JOL, Puri V (2019) Growth hormone acts along the PPARγ-FSP27 axis to stimulate lipolysis in human adipocytes. Am J Physiol Endocrinol Metab 316(1):E34-E42. https://doi.org/10.1152/ajpendo.00129.2018
Hioki C, Yoshida T, Kogure A, Takakura Y, Umekawa T, Yoshioka K, Shimatsu A, Yoshikawa T (2004) Effects of growth hormone (GH) on mRNA levels of uncoupling proteins 1, 2, and 3 in brown and white adipose tissues and skeletal muscle in obese mice. Horm Metab Res 36(9):607-613. https://doi.org/10.1055/s-2004-825905
Zvonic S, Story DJ, Stephens JM, Mynatt RL (2003) Growth hormone, but not insulin, activates STAT5 proteins in adipocytes in vitro and in vivo. Biochem Biophys Res Commun 302(2):359-362. https://doi.org/10.1016/s0006-291x(03)00179-7
Fain JN, Ihle JH, Bahouth SW (1999) Stimulation of lipolysis but not of leptin release by growth hormone is abolished in adipose tissue from Stat5a and b knockout mice. Biochem Biophys Res Commun 263(1):201-205. https://doi.org/10.1006/bbrc.1999.1302
Kaltenecker D, Mueller KM, Benedikt P, Feiler U, Themanns M, Schlederer M, Kenner L, Schweiger M, Haemmerle G, Moriggl R (2017) Adipocyte STAT5 deficiency promotes adiposity and impairs lipid mobilisation in mice. Diabetologia 60(2):296-305. https://doi.org/10.1007/s00125-016-4152-8
Liu X, Robinson GW, Wagner KU, Garrett L, Wynshaw-Boris A, Hennighausen L (1997) Stat5a is mandatory for adult mammary gland development and lactogenesis. Genes Dev 11(2):179-186. https://doi.org/10.1101/gad.11.2.179
Floyd ZE, Stephens JM (2003) STAT5A promotes adipogenesis in nonprecursor cells and associates with the glucocorticoid receptor during adipocyte differentiation. Diabetes 52(2):308-314. https://doi.org/10.2337/diabetes.52.2.308
Gao P, Zhang Y, Liu Y, Chen J, Zong C, Yu C, Cui S, Gao W, Qin D, Sun W, Li X, Wang X (2015) Signal transducer and activator of transcription 5B (STAT5B) modulates adipocyte differentiation via MOF. Cell Signal 27(12):2434-2443. https://doi.org/10.1016/j.cellsig.2015.09.010
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4):402-408. https://doi.org/10.1006/meth.2001.1262
Barclay JL, Nelson CN, Ishikawa M, Murray LA, Kerr LM, McPhee TR, Powell EE, Waters MJ (2011) GH-dependent STAT5 signaling plays an important role in hepatic lipid metabolism. Endocrinology 152(1):181-192. https://doi.org/10.1210/en.2010-0537
Sharma R, Luong Q, Sharma VM, Harberson M, Harper B, Colborn A, Berryman DE, Jessen N, Jørgensen JOL, Kopchick JJ, Puri V, Lee KY (2018) Growth hormone controls lipolysis by regulation of FSP27 expression. J Endocrinol 239(3):289-301. https://doi.org/10.1530/JOE-18-0282
Flint DJ, Binart N, Kopchick J, Kelly P (2003) Effects of growth hormone and prolactin on adipose tissue development and function. Pituitary 6(2):97-102. https://doi.org/10.1023/b:pitu.0000004800.57449.67
Kopchick JJ, Berryman DE, Puri V, Lee KY, Jorgensen JOL (2020) The effects of growth hormone on adipose tissue: old observations, new mechanisms. Nat Rev Endocrinol 16(3):135-146. https://doi.org/10.1038/s41574-019-0280-9
Olarescu NC, Berryman DE, Householder LA, Lubbers ER, List EO, Benencia F, Kopchick JJ, Bollerslev J (2015) GH action influences adipogenesis of mouse adipose tissue-derived mesenchymal stem cells. J Endocrinol 226(1):13-23. https://doi.org/10.1530/JOE-15-0012
Able AA, Burrell JA, Stephens JM (2017) STAT5-interacting proteins: a synopsis of proteins that regulate STAT5 activity. Biology (Basel) 6(1):20. https://doi.org/10.3390/biology6010020
Møller N, Jørgensen JOL (2009) Effects of growth hormone on glucose, lipid, and protein metabolism in human subjects. Endocr Rev 30(2):152-177. https://doi.org/10.1210/er.2008-0027
Zhao L, Wang A, Corl BA, Jiang H (2014) Effect of growth hormone on the differentiation of bovine preadipocytes into adipocytes and the role of the signal transducer and activator of transcription 5b. J Anim Sci 92(5):1958-1967. https://doi.org/10.2527/jas.2013-7113
Tontonoz P, Spiegelman BM (2008) Fat and beyond: the diverse biology of PPARγ. Annu Rev Biochem 77:289-312. https://doi.org/10.1146/annurev.biochem.77.061307.091829
Hagen RM, Rodriguez-Cuenca S, Vidal-Puig A (2010) An allostatic control of membrane lipid composition by SREBP1. FEBS Lett 584(12):2689-2698. https://doi.org/10.1016/j.febslet.2010.04.004
Paton CM, Ntambi JM (2009) Biochemical and physiological function of stearoyl-CoA desaturase. Am J Physiol Endocrinol Metab 297(1):E28-E37. https://doi.org/10.1152/ajpendo.90897.2008
Stewart WC, Baugh Jr. JE, Floyd ZE, Stephens JM (2004) STAT 5 activators can replace the requirement of FBS in the adipogenesis of 3T3-L1 cells. Biochem Biophys Res Commun 324(1):355-359. https://doi.org/10.1016/j.bbrc.2004.09.053
Nelson CN, List EO, Ieremia M, Constantin L, Chhabra Y, Kopchick JJ, Waters MJ (2018) Growth hormone activated STAT5 is required for induction of beige fat in vivo. Growth Horm IGF Res 42-43:40-51. https://doi.org/10.1016/j.ghir.2018.08.004
Keipert S, Jastroch M (2014) Brite/beige fat and UCP1 - is it thermogenesis? Biochim Biophys Acta 1837(7):1075-1082. https://doi.org/10.1016/j.bbabio.2014.02.008
Hayashi M, Futawaka K, Koyama R, Fan Y, Matsushita M, Hirao A, Fukuda Y, Nushida A, Nezu S, Tagami T, Moriyama K (2017) Effects of growth hormone on uncoupling protein 1 in white adipose tissues in obese mice. Growth Horm IGF Res 37:31-39. https://doi.org/10.1016/j.ghir.2017.10.006
Mooli RGR, Mukhi D, Watt M, Edmunds L, Xie B, Capooci J, Reslink M, Eze C, Mills A, Stolz DB, Jurczak M, Ramakrishnan SK (2020) Sustained mitochondrial biogenesis is essential to maintain caloric restriction-induced beige adipocytes. Metabolism 107:154225. https://doi.org/10.1016/j.metabol.2020.154225
Wood Dos Santos T, Cristina Pereira Q, Teixeira L, Gambero A, Villena JA, Lima Ribeiro M (2018) Effects of polyphenols on thermogenesis and mitochondrial biogenesis. Int J Mol Sci 19(9):2757. https://doi.org/10.3390/ijms19092757
Cardanho-Ramos C, Morais VA (2021) Mitochondrial biogenesis in neurons: how and where. Int J Mol Sci 22(23):13059. https://doi.org/10.3390/ijms222313059
Clasen BF, Poulsen MM, Escande C, Pedersen SB, Møller N, Chini EN, Jessen N, Jørgensen JOL (2014) Growth hormone signaling in muscle and adipose tissue of obese human subjects: associations with measures of body composition and interaction with resveratrol treatment. J Clin Endocrinol Metab 99(12):E2565-E2573. https://doi.org/10.1210/jc.2014-2215
Richard AJ, Stephens JM (2014) The role of JAK-STAT signaling in adipose tissue function. Biochim Biophys Acta 1842(3):431-439. https://doi.org/10.1016/j.bbadis.2013.05.030
Kaltenecker D, Spirk K, Ruge F, Grebien F, Herling M, Rupprecht A, Kenner L, Pohl EE, Mueller KM, Moriggl R (2020) STAT5 is required for lipid breakdown and beta-adrenergic responsiveness of brown adipose tissue. Mol Metab 40:101026. https://doi.org/10.1016/j.molmet.2020.101026
Farrar MA, Heltemes-Harris LM (2011) Turning transcription on or off with STAT5: when more is less. Nat Immunol 12(12):1139-1140. https://doi.org/10.1038/ni.2163
Poudel SB, Dixit M, Neginskaya M, Nagaraj K, Pavlov E, Werner H, Yakar S (2020) Effects of GH/IGF on the aging mitochondria. Cells 9(6):1384. https://doi.org/10.3390/cells9061384

No competing interests reported.

Download PDF

Journal Publication

published 01 Oct, 2022

Read the published version in Growth Hormone & IGF Research →

Version 1

posted

You are reading this latest preprint version

Growth hormone inhibits adipogenic differentiation and induces browning in bovine subcutaneous adipocytes

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1