Animal experiments
Twenty 6-week-old male Dahl/SS rats (Charles River, China) were fed adaptively for one week. They were randomly divided into two groups. The heart failure group (HF) was fed with 8% NaCl high salt for 7 weeks, and the control group (C) was fed with 0.3% NaCl low salt for 7 weeks, with 4 rats in each group. The animals are kept in the Laboratory Animal Center of Shanghai Jiao Tong University and housed at 21–25 ℃, with 40–50% humidity, a 12 h light: 12 h dark cycle, and free access to drinking water and eating standard feed. After feeding, ultrasonic testing was performed, and the body weight (BW) was weighed. The rat was euthanized by cervical dislocation after inhalation anesthesia with isoflurane gas (concentration 5%, gas flow 500 ml/min). The rat heart was taken and the weight of heart and LV were weighed after termination. All experiments were performed in accordance with Chinese National and Shanghai Jiao Tong University ethical guidelines regarding the use of animals in research, consistent with the NIH guidelines (Guide for the care and use of laboratory animals) on the protection of animals used for scientific purposes. The experimental protocol was approved by the Animal Care and Use Committee of Shanghai Jiao Tong University, China.
PINK1 was specifically overexpressed by AAV in vivo
The cDNA encoding PINK1 was cloned into the myocardial specific overexpression plasmid pLV [Exp] - cTnT (myocardial specific promoter, vectorbuilder, China), and packaged with adeno-associated virus (AAV). The serotype is AAV9. After a week of adaptive feeding of 6-week-old male Dahl/SS rats, AAV was slowly injected into rats through the caudal vein, 1 × 1012 vg, followed by 7 weeks of high salt feeding. This resulted in PINK1 myocardial specific overexpression heart failure rats (HP); Control rats (C) and heart failure rats (HF) were injected with empty AAV, with 4 rats in each group.
Echocardiography
Cardiac structure and function were determined using the VEVO 3100 high-resolution micro ultrasound system. After animals were anesthetized with isoflurane (concentration 5%, gas flow 500 ml/min), they were placed on the heating table in a supine position. Left ventricular end systolic internal diameter (LVIDs), LV end diastolic internal diameter (LVIDd), interventricular septal end systolic thickness (IVSs), interventricular septal end diastolic thickness (IVSd), LV end systolic volume (ESV) and LV end diastolic volume (EDV) were measured by the M-mode ultrasound, based on which ejection fraction (EF) and fraction of shorten (FS) were calculated; The ratio of early diastolic maximum velocity of mitral valve to systolic maximum velocity of atrium (E/A) was measured by the blood flow Doppler mode; The ratio of the maximum velocity of blood flow in the early diastolic phase of mitral valve to the motion velocity of mitral annulus (E/E') was measured by the tissue Doppler mode.
Transmission electron microscope
The LV apical tissue was taken and fixed with 2.5% glutaraldehyde overnight. The heart was removed and post fixed in a mixture of 0.8% potassium ferrocyanide and 2% osmium tetroxide in 0.1 M sodium cacodylate buffer for 2 h. The area and number of mitochondria were observed by transmission electron microscope (Talo L120C G2). The decrease of mitochondrial number and the increase of mitochondrial area denoted the decrease of mitochondrial fission. The shooting times are 4300 X and 13500 X. Each sample is photographed and analyzed with more than 5 visual fields and more than 100 mitochondria. The mitochondrial area is computed by ImageJ software.
H&E and Picro Sirius Red Staining
The isolated LV was fixed with 4% paraformaldehyde (China National Pharmaceutical Group Corporation), embedded in paraffin, and sectioned to a thickness of 4 um with a microtome (Leica RM2265, Germany). After dewaxing, sections were stained with hematoxylin-eosin or Picro Sirius Red. Cell area and collagen fiber area were analyzed by ImageJ software.
Culture of H9C2 cardiomyocyte line and lentivirus transfection
H9C2 cardiomyocyte line was purchased from the National Collection of Authenticated Cell Cultures, China. The cells were cultured in DMEM medium (Gibco) supplemented with 10% fetal bovine serum and in an environment of 37°C, 5% CO2 and 95% air.
PINK1KO cells were generated by CRISPR/Cas9 system. PINK1 gRNA sequence: 5'- CCCGCACCACGAACTGCCGC-3', which was cloned into knockout plasmid pLV [CRISPR] (vectorbuilder, China), and then packaged with lentivirus. In normal medium, lentivirus was transfected into H9C2 cardiomyocytes for 24 hours to obtain PINK1KO cells. Control cells (C) were transfected with empty lentivirus.
Production of Drp1WT cells: the cDNA encoding Drp1 was cloned into the overexpression plasmid pLV [Exp] (vectorbuilder, China), and then packaged with lentivirus. In normal medium, lentivirus was transfected into PINK1KO cells for 24 hours to obtain Drp1WT cells. Primer sequence of Drp1 cDNA: Drp1-F: 5'- CGCGGATCCGCCACCATGGAGGCGCTGATCC-3'; Drp1-R: 5'-CCGCTCGAGTCACCAAAGATGAGTCTCTCG-3'.
Production of Drp1S616A cells: Drp1S616A mutates TCT at Drp1 S616 site into GCT (alanine). The cDNA encoding Drp1S616A was cloned into the overexpression plasmid pLV [Exp] (vectorbuilder, China), and then packaged with lentivirus. In normal medium, lentivirus was transfected into pink1ko cells for 24 hours to obtain Drp1S616A cells. The method of obtaining Drp1S616A cDNA is as follows: using common cDNA as template, the first half of the target gene is obtained by using primers Drp1-1F: 5'-CGCGGATCCGCCACCATGGAGGCGCTGATCC-3', Drp1-1R: 5'-GGCAGCCAGTTTTCGTG-3'. The second half of the target gene was obtained by primers Drp1-2F: 5'-CTGGCTGCCCGAGAAC-3', Drp1-2R: 5'-CCGCTCGAGTCACCAAAGA-TGAGTCTCTCG-3'. Using the above product as the template, the cDNA of Drp1S616A was obtained by using primers Drp1-F: 5'-CGCGGATCCGCCACCATGGAGGCGCTGATCC-3', Drp1-R: 5'- CCGCTCGAGTCACCAAAGATGAGTCTCTCG − 3'.
Real-time PCR
The LV was weighed (40 mg), cut, and placed in a 2 ml centrifuge tube, and 1 ml Trizol (Invitrogen) was added to extract RNA (if the sample was 6-well plate cells, use 500 ul Trizol to extract RNA). cDNA synthesis was performed according to the instruction of the RevertAid™ First-Strand cDNA Synthesis Kit. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd (Tables S1). Amplification was performed using a real-time PCR instrument (ABI StepOnePlus Real Time PCR System 7500, USA). The reaction conditions were as follows: 95°C for 10 min then 40 cycles of denaturation at 95°C for 15 s and 60°C for 1 min.
Separation of mitochondrial protein and cytoplasmic protein
Take 50 mg LV tissue, and separate mitochondrial protein and cytoplasmic protein according to the process of mitochondrial separation Kit (Beyotime Biotechnology). After the sample was washed with the precooled PBS, mitochondrial separation reagent was added and homogenized; 1000 g of supernatant was centrifuged for 5 min to remove the precipitation, 11000 g of supernatant was centrifuged for 10 min to obtain mitochondrial precipitation, and the remaining supernatant was cytoplasmic protein.
Western blot
LV tissue (20 mg) was lysed with Ripa lysate (Beyotime Biotechnology) and the total protein was extracted. SDS-PAGE electrophoresis and membrane transfer were performed. Primary antibodies: Drp1 (1:1000, Abcam, UK), Drp1S616 (1:1000, CST, USA), PINK1 (1:1000, CST, USA), β-actin (1:1000, protein, USA), voltage dependent anion channel protein 1 (VDAC1, 1:1000, Immunoway, China). The strips were exposed with Fusion FX automatic chemiluminescence/fluorescence image analysis system, and the gray value of the strips was measured by ImageJ analysis software.
Immunofluorescence
The paraffin section was dewaxed and heated in a 95°C water bath for 20 min in sodium citrate antigen repair solution (Beyotime Biotechnology) and naturally cooled to room temperature (cell samples were fixed with 4% paraformaldehyde for 15 min). Sections or cells were blocked for 2 h at room temperature and incubated at 4°C for 20 h with primary antibodies against Drp1 (1:200, Abcam, UK) and mitochondrial preprotein translocases of the outer membrane (Tom20, 1:100, Santa Cruz, USA). After washing, they were incubated with Alexa Fluor 568 (1:1000, Jackson, USA) and Alexa Fluor 488 (1:1000, Jackson, USA) secondary antibodies for 1 hour at room temperature in the dark. After washing, they were incubated with DAPI (Beyotime Biotechnology) for 5 min. Sections or cells were imaged with a confocal microscope (Olympus Fluoview FV1000). Take more than 5 pictures for each sample. Cell samples were taken with more than 30 cells in each group. In each image, the ImageJ plug-in Coloc 2 was used to detect the Manders co-localization Coefficient (MCC) and to evaluate the co-localization of mitochondria and Drp1.
Morphological analysis of mitochondria
The cells were inoculated into the culture dish for overnight culture and washed twice with PBS. The culture containing 100 nM Mito-Tracker Red (Beyotime Biotechnology) was added. The cells were incubated at 37°C for 20 min and washed with PBS for 3 times. After replacing the culture medium, fluorescence images were obtained with the confocal microscope (Olympus Fluoview FV1000). More than 30 cells were photographed in each group. The mitochondrial aspect ratio was analyzed by ImageJ software to evaluate mitochondrial fission. The increase of aspect ratio indicates the prolongation of mitochondria, which is a sign of the decrease of mitochondrial fission.
Mitochondrial membrane potential
Mitochondrial membrane potential was detected by tetramethylrhodamine ethyl ester (TMRE) kit (Beyotime Biotechnology). The cells were inoculated into the Petri dish for overnight culture, washed twice with PBS, and incubated at 37°C with TMRE working solution for 15 min. The preheated medium was washed twice. After replacing the new medium, the fluorescence image was taken with the confocal microscope. More than 30 cells were photographed in each group. The fluorescence intensity of mitochondrial membrane potential was analyzed by ImageJ software.
ATP content detection
Take 20 mg of LV tissue or an equal amount of 6-well plate cells to detect the ATP content according to the process of ATP detection kit (Beyotime Biotechnology). The sample was homogenized after adding 200 ul lysate and centrifuged at 12000 g for 5min to obtain ATP. After adding ATP detection reagent, the sample luminous intensity was analyzed by chemiluminescence instrument to detect the ATP content. The protein concentration was detected. The ATP content of each sample was standardized through the protein concentration to obtain the relative content of ATP.
Statistical analysis
The two groups of data were analyzed by the independent sample t-test. One-way ANOVA test was used for the data of 3 groups and above, and Bonferroni or Dunnett's T3 was used for pairwise comparison. P < 0.05 indicated the significant difference. All data were analyzed using SPSS Statistics V21.0 software and the results were expressed as the mean ± standard deviation (SD).