Experiment animals
Sprague-Dawley (SD) rats, male, weighing 120-160 g, were provided by the Center for Laboratory Animals of Wenzhou Medical University (License No. SCXK2015-0001). These rats were housed at room temperature, which was maintained within 23-25 °C, allowed free access to food and water, and placed under a 12-hour dark/light cycle. The study protocol was approved by the Animal Research Committee of Wenzhou Medical University. All animal experiments adhered to the Care and Use of Laboratory Animal published by the US National Institutes of Health, following the Animal Research: Reporting In Vivo Experiments (ARRIVE) guidelines.
Type 2 diabetes model and experimental group
T2DM models were established as previously described [15, 16]. After 3 days adaptation feeding, the rats were divided into 2 groups randomly: Normal group (CON, n = 16), the rats were fed with normal diet; type 2 DM group (DM, n = 50), the rats were fed with high‐fat and high‐sugar diet (67% normal diet, 20% saccharose, 10% lard, 2% cholesterol and 1% sodium cholate). At week 0 and 8 after feeding, fasting plasma glucose, fasting insulin were measured and the insulin sensitivity index was calculated in both groups. Then the DM group received a single intraperitoneal injection with streptozocin (STZ) (Sigma-Aldrich Co., St. Louis, MO, USA) of 35 mg/kg. After 3 days, rats had fasting blood glucose concentration of ≥16.7 mmol/L were considered as T2DM rats. Rats in CON group were received intraperitoneal injection with LIRA 0.2 mg/kg per day (CON+L, n=8) and DM group were also received LIRA 0.2 mg/kg per day (DM+L, n=8) for 4 weeks [17, 18]. The rats of CON and DM group received either saline.
Measure of Insulin and Calculate the Insulin Sensitivity Index
1 ml of tail vein blood was obtained after fasting for 12 h, and placed at room temperature for 30 min. The blood samples were centrifuged to obtain supernatants. Measured the insulin content of supernatants by ELISA kits (Haixi Tang Biotechnology Co., Ltd., Shanghai, China). The insulin sensitivity index was calculated according to the following formula: insulin sensitivity index = 1/ (fasting glucose × fasting insulin). Because the value was not normally distributed, the natural logarithm was used for the calculation[13].
Determination of blood pressure and cardiac function
Blood pressure and cardiac function were determined by invasive hemodynamic evaluation methods. A micro-catheter was inserted into the right carotid artery, the arterial blood pressure was measured using a blood pressure analyzer. mean arterial pressure (MAP) was calculated as follows: 1/3 systolic pressure + 2/3 diastolic pressure. The micro-catheter was inserted into the left ventricle via the right carotid artery to measure the left ventricular pressure (LVP). ECG and LVP were simultaneously recorded on a polygraph (RM-6200C; Chengdu, Instrument, Chengdu, China). Computer algorithms measured heart rate (HR), left ventricular systolic pressure (LVSP), left ventricular end-diastolic pressure (LVEDP), the first derivative of left ventricular pressure (±dP/dtmax).
Histological analysis
Heart tissues were immediately fixed in 4% neutral buffered formalin. Tissues were collected, embedded in paraffin, and sectioned. Sections (5 μm) were cut and mounted on positively charged glass slides. For immunohistochemistry staining, deparaffinized sections were incubated with Cav3 antibodies (BD Technology). Images were taken at a final magnification of 200 × and analyzed by Image-Pro Plus.
Measurement of NO production
Nitrite, a stable metabolite of NO with a biological reagent for NO (Nanjing Jiancheng Biological Co., China). Total nitric oxide production (NOx) in plasma was determined by measuring the concentration of Nitrite.
Quantitative real-time RT-PCR of left ventricle
Left ventricle tissues of rats were collected in RNAlater (Ambion, Austin, TX) and extracted total RNA using the miRNeasy kit (QIAGEN, Valencia, CA) according to the manufacturer’s instructions. cDNA was amplified by real-time PCR using the primers listed in Table 1. Each sample was run in triplicate in a 20 µl reaction with 250 nM forward and reverse primers and 10 µl of Advanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA). Reactions were performed in a BIO-RAD CFX96 real-time PCR system. The cycle parameters were set as follows: an initial 3 min incubation at 95 °C, followed by 40 cycles of 95°C for 10 s, 60°C for 30 s, and 72°C for 30 s. All data were normalized to Tubala (tubulin alpha 1A gene), which was demonstrated to be stable after STZ intraperitoneal injection in our pilot work.
Table 1
Gene-specific primers used for qRT-PCR
species
|
Genes
|
Sequences
|
Rat
|
RyR2
|
Forward:5’-GAATCAGTGAGTTACTGGGCATGG -3’
Reverse:5’- CTGGTCTCTGAGTTCTCCAAAAGC-3’
|
Rat
|
CCL1
|
Forward: 5’- TGCCATGTGGCTACAGAATGT -3’
Reverse: 5’- CTGGGGCCGATCTCTTTGTA -3’
|
Rat
Rat
|
KCNK12
Cav-3
|
Forward:5’- TCCTGTTCTTCAACCTCTTTCT -3’
Reverse:5’-TGATACACCGAGGGCTT-3’
Forward:5’- CCA AGA ACA TCA ATG AGG ACA TTG TG-3’
Reverse:5’- GTG GCA GAA GGA GAT ACA G-3’
|
Western blot analysis
Left ventricle samples were lysed with lysis buffer. Protein concentrations in the supernatants were determined by Bradford Protein Assay Kit (Bio-Rad, CA, USA). The proteins were separated by electrophoresis on SDS-PAGE and then transferred onto PVDF (polyvinylidene difluoride)-Plus membrane (Micron Separations). After being blocked with 5% skim milk, incubation with primary antibodies: RyR2 antibodies (1:400), Cav-3 antibodies (1:2000), overnight at 4 °C. After that, the membrane was incubated with the corresponding secondary antibodies at room temperature for 2 h. Immunoblot was visualized with ChemiDocXRS (Bio-Rad Laboratory, Hercules, CA), and analyzed with LabImage software. Cav3 antibody was from BD Technology, RyR2 antibody was from Sigma Technology.
Immunoprecipitation
Immunoprecipitation was performed as previously describe[14]. Isolated cardiomyocytes or heart tissue were homogenized in lysis buffer. A total of 500 mg extract preparations was subjected to immunoprecipitation with 2 mg Cav3 primary antibody in the presence of 20 mL protein A/G plus-agarose. After extensive PBS washes, the immuno- precipitates were denatured and subjected to analysis for RyR2 expression by Western blot as described below.
Transfection with Small Interfering RNA in H9C2 Cells
H9C2 cells were cultured in DMEM containing 10% FBS in a humidified atmosphere (5% CO2) at 37°C and plated in 6-well plates to form a monolayer for 24 h. For mimic the increased glucose level in diabetes, normal concentration glucose, 5.5 mM glucose (in mM) (D-glucose, 5.5; mannitol, 14.5; NaCl, 81; KCl, 4.0; CaCl2, 1.6; pH 7.4), high concentration glucose, 33.3 mM glucose (in mM) (D-glucose, 33.3; NaCl, 81; KCl, 4.0; CaCl2, 1.6; pH 7.4; HG). The cells were bathed in Hepes-buffered solution for 24 h. Normal Hepes-buffered solution (in mM) (NaCl, 135; KCl, 5; MgCl2, 1; CaCl2, 1; Hepes, 10; pH 7.4). H9C2 cells were transfected with a scrambled siRNA or Cav-3 siRNA at a final concentration of 80 nM (100 nM; Santa Cruz Biotechnology, Santa Cruz, CA) for 6 h by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocols[15]. Cells were used for treatments LIRA 100 nM after 48 h of incubation[16].
Statistical analysis
Data were presented as mean ± SEM. The results were statistically analyzed using one-way analysis of variance (ANOVA), or paired or unpaired Student’s t-test. When the ANOVA results revealed a significant difference, pairwise comparisons between means were tested by the least significant difference method (LSD). All statistical tests were performed with GraphPad Prism software, version 8.0 (GraphPad Software, San Diego, CA). P < 0.05 was considered statistically significant