2.1 Isolation of bacterial strains and sediment contamination
The strains of bacteria were isolated from a sample of the moist and sandy soil of the rhizosphere (10 to 20 cm), marginal to Guanabara Bay, located at S 22’’50’023 and W 43’’14’465, in the municipality of Rio de Janeiro. Another batch of bacterial strains was isolated from an aliquot of 25g of the sediment contaminated with 250μL of lubricating oil (Lubrax 25W50) in a 125mL Erlenmeyer and incubated for 15 days at 35ºC (Dantas, 2016). For isolation, both samples were suspended in 0.8% sterile saline solution, diluted in series, spread in nutrient agar (NA), and incubated at 35°C for 48 h (Atlas, 1993).
2.2 Triage of biosurfactant-producing bacteria
2.2.1 Emulsification test
The strains were tested for emulsification capacity to verify the production of biosurfactants. The microbial cells were stirred in a nutrient broth (10 g L-1 peptone, 5 g L-1 yeast extract and 1 g L-1 NaCl) at 150 rpm, pH 7 and 35ºC for 48 h. After centrifugation at 3000 rpm for 10 min, 2 mL of the supernatant were removed, added to 2 mL of lubricating oil and stirred for 2 min in a vortex. Then, the system was kept resting for 6 hours to verify the stability of the foam formed (Cooper and Goldenberg; 1987).
2.2.2 Oil displacement test
The strains were previously inoculated in 5 g L-1 glucose for 24 h at 35ºC and 150 rpm. A volume equal to 15mL of distilled water was added to Petri dishes of 5 cm diameter. To produce an apolar layer, 250 μL of lubricating oil were slowly added to the formation of the oil film. Then, 10 μL of the supernatant, from the inoculum of the microorganism in glucose were placed on the film formed. Oil spreading and formation of a halo was considered a positive and negative result for the drop dissolved in water, respectively. The negative control used was distilled water, whereas a 5% Extran solution, the positive one (Kreischer & Silva, 2017).
2.3 Biodegradability test using DCPIP redox indicator
Bacterial cells were inoculated in a nutrient broth at 150 rpm and 35ºC for 48 hours (Peixoto & Vieira, 2005). The standardization of the microorganisms concentration was determined for tube No. 3 using the Mac Farland scale. In 20 mL penicillin vials, the system consisted of 1.5mL of Bushnell-Hass medium (1 g L-1 K2HPO4, 1 g L-1 KH2PO4, 1 g L-1 NH4NO3, 200 mg L-1 MgSO4.7H2O, 50 mg L-1 FeCl3, 20 mg L-1 CaCl2.2 H2O) at pH 7, 480uL of inoculum and 20uL of used ship engine oil, under agitation at 150 rpm and 35 °C for 168 h. The negative control was also performed without adding the inoculum. After that period of time, the addition of 1.5 μL of 1 g L-1 2.6 dichlorindophenol (DCPIP) indicated the presence or absence of oxidation of the medium, and systems remaining colorless after the DCPIP were considered positive (Hanson et al., 1993).
2.4 Characterization of ship oil by Infrared Spectroscopy (IR)
Shimadzu’s infrared spectrophotometer equipment, RAffimty-1, produced the absorption spectra in the infrared region between 400 and 4000 cm-1 for used ship engine oil.
2.5 Determination of bacterial growth in the presence of hydrocarbons
Microorganisms grown in a nutrient broth for 48h and 35°C were centrifuged, suspended in an 0.8% saline solution, and standardized at an absorbance equal to 1,000 in a UV-Visible spectrophotometer (Bisector sp-22 manual). In Erlenmeyers, 2.5 mL standardized inoculum in a 22.25 mL of Bushnell Haas medium (BH) contaminated 250 µL of used ship engine oil (Mobil Delvac SAE 40) and applied a rotation of 150 rpm for seven days and 35°C. After the incubation period, taken a 2 mL aliquot was taken and measured at 600 nm to verify the growth of microorganisms. (Das & Mukherjee, 2007).
2.6 Hydrocarbon degradation in solid and liquid medium
Ship engine oil used as a carbon source evaluated the ability of microorganisms to access a carbon source in a solid medium (Arulazhagan, P. & Vasudevan, 2011; Almeida et al., 2017). The strain was inoculated by the technique of surface spreading in Petri dish with BH medium, agar 15 g L-1, at pH 7, supplemented with 1 % oil. Negative controls containing only BH and agar medium at pH seven were inoculated with the same microorganism and incubated for seven days at 35ºC.
The strain previously grown in nutrient broth for 48h, 35ºC, 150 rpm, and standardized to OD equal to 1,000 was inoculated in 20mL penicillin vials, containing 1,780 mL BH medium, 200uL inoculum and 20uL of ship engine oil, kept under 150 rpm and 35°C for 7 days. The negative control was also performed without adding the inoculum.
After that period, 5mL of chloroform were added to each vial, left under agitation for 15 min, and the supernatant removed. Then, the organic solution was analyzed by UV-Visible spectroscopy (UV-2600 SHIMADZU). Next, the quantification of the oil occurred at 239 nm following a scanning between 200 and 800 nm (APHA 1985; Henderson et al., 1999). The difference between oil concentration in negative controls and samples inoculated with bacterial strains determined the oil degradation.
Equation 1 calculates the oil biodegradation percentage as follows:
Where,
CCN: Initial oil concentration, performed by the negative control.
Cf : Final oil concentration.
2.7 Bacterial growth time
The bacterial growth time test contributes to the optimization of the biodegradation process, in which it is possible to monitor the viability time of microbial cells still alive, as well the time of each generation (Kereel et al., 2017).
Microorganisms grown in nutrient broth for 24 h at 35°C were centrifuged, suspended in a 0.8% (m/v) saline solution, and standardized at 600 nm to 1.000 nm optical density (OD) in a spectrophotometer UV-Visible. In Erlenmeyer flasks (500 mL), 10 mL of a standardized inoculum were inoculated in 89 mL of BH medium and 1 g of ship engine oil, rotated at 110 rpm, and 35°C for ten days, all in triplicate. The serial dilution technique counted the colony-forming units (CFU) taken from aliquots of 1 mL every 24 h (Das; Mukherjee, 2007; Kereel et al., 2017).
The total aliquots volume removed was less than 20% from the entire system. According to statistical sampling methods, the value found for the difference between initial and end system concentrations is not statistically significant when the variation in volume is less than ± 20% (Skoog, 2020).
The growth rate (μ) calculation for the bacterial strain was calculated according to equation 2 for each microorganism specific stationary phase (Schmidell et al., 2001).
Where,
N: number of microorganism cells at the end of the stationary phase.
N0: number of microorganism cells at the beginning of the experiment.
t: time at the end of the stationary phase (h).
t0: initial time (h).
The generation number (n) was calculated according to equation 3 (Schmidell et al., 2001).
The generation time (g) given by equation 4 (Schmidell et al., 2001).
2.8 Reinoculation test
The microorganisms were grown in nutrient broth for 24 hours at 35°C, centrifuged, resuspended in a 0.8% (m/v) saline solution, and standardized to an OD equal to 1.000 of absorbance at 600 nm in a UV-Visible spectrophotometer. In 20 mL penicillin vials, the system consisted of 2.67 mL of BH medium, 300 µL of standardized inoculum, and 30 µL of used ship engine oil, under agitation at 150 rpm for 10 days at 35° C (Hanson et al., 1993). The composition of the system was the same for negative controls but with no addition of inoculum.
The UV-visible spectrophotometry performed the oil quantification using extraction in chloroform in six replicas. From three of them, 2 ml aliquots were taken and added to 20 ml penicillin vials containing 2 ml of BH medium and 40 µl oil, agitated (150 rpm) at 35ºC for another ten days. Then, the resulting oil underwent extraction and analysis. Negative controls with no inoculum were also prepared in triplicate. The percentage of oil biodegradation was calculated by equation 1.
2.9 Phenotypic and molecular characterization
The strain was inoculated in Petri dishes containing nutrient Agar medium for 20h at 35ºC. After observing the macroscopic characteristics of the colonies formed, the Gram staining allowed us to verify the microscopic structural features.
For sequencing of the gene encoding 16S rRNA and phylogenetic analysis, DNA was extracted and purified according to the ZR Fungal/Bacterial DNA MiniPrep system (Zymo Research, Irvine, CA, USA) commercial kit. PCR amplified the sequence of the gene encoding 16S rRNA with the primers pA (5’ AGAGTTTGATCCTGGCTCAG 3’- forward) and pH (5’ AAGGAGGTGATCCAGCCGCA 3’- reverse) (Massol-Deya et al., 1995). The PCR products were purified with the “WizardTM Rapid PCR Purification System” (Promega®) commercial kit and sequenced by the DNA Sequencing Platform - RPT01A – Fiocruz. The resulting gene sequence encoding 16S rRNA was compared to reference strains with validly published names, using the GenBank database and the BLAST-N tool (www.ncbi.Nlm.nih.gov/blast) to confirm the identity of the PVGOC-3 strain. Then, the sequences were aligned in the BioEdit Sequence Alignment Editor and imported for the construction of a phylogenetic tree by the Neighbor-Joining method in the MEGA X program (Tamura et al., 2013).