The Effects From Oral Administration of Recombinant Interferon-alpha on Piglet Daily Care

doi:10.21203/rs.3.rs-165302/v1

Download PDF

Original Article

The Effects From Oral Administration of Recombinant Interferon-alpha on Piglet Daily Care

https://doi.org/10.21203/rs.3.rs-165302/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 31 Mar, 2022

Read the published version in Mobile Information Systems →

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

The administration of interferon has improved the antiviral and immunomodulatory abilities of piglets, which is conductive to the prevention and control of diseases, such as African swine fever. This study aimed to evaluate the effects from oral administration of interferon-alpha (IFN-α) on the daily care of piglets. The results were compared with compound Chinese herbal, which was proved to improve serum interferon level. Further, the administration routes were compared between oral administration and intramuscular injection. Forty (40) piglets with equal age and weight were randomly divided into four groups: Control group (Group C, without treatment), Group H (treated with compound Chinese herbal), Group K (administered orally with recombinant IFN-α, 1500 IU per day per piglet), and Group J (administered intramuscularly with IFN-α, 4× 10⁶ IU per day per piglet). After the treatment of 15 days, both oral and intramuscular treatment of recombinant IFN-α significantly improved the secretion of IFN-gamma (IFN-γ) (P<0.05), and the effects of intramuscular pathway were faster. In addition, the expression levels of IFN-stimulated genes (MX1 and ISG15) were significantly enhanced (P<0.01), independently of IFN-α treatment time and serum IFN-γ level. Different from other studies, compound Chinese herbal showed weaker effects on interferon stimulation in piglets. The results indicated that oral administration of recombinant IFN-α improved interferon-induced response of piglets at both serum and molecular levels, which may be applied for improving autoimmunity of piglets.

Veterinary Epidemiology

recombinant interferon-alpha

serum interferon-gamma

oral administration

piglets

interferon-induced response

Interferons (IFNs) have been known as a series of low molecular glycoproteins, which can interfere with viral infection and subsequent nucleic acid replication, thus suppressing viral proliferation. In addition, IFNs can also combat bacterial and parasitic infections. IFNs can be categorized into three distinct families according to its specific binding to the cell membrane receptors: type I (IFN-α and IFN-β), type II (IFN-γ) and type III (IFN-λ), and the endogenous IFNs are produced by leukocytes, fibroblasts and immune lymphocytes (Musella, Manic, De Maria, Vitale, & Sistigu, 2017; Renauld, 2003). Attributed to their activities in immunoregulation, IFNs have been applied in both human health care and poultry industry (Klotz, Baumgärtner, & Gerhauser, 2017).

Exogenous administration of IFNs can improve the level of IFNs, and initiate a series of reactions and signal transduction by binding to the corresponding receptors on the cell membrane. The expression of hundreds of interferon-stimulated genes (ISGs) will be induced, which eventually suppress the infection of various RNA and DNA viruses (Crosse, Monson, Beard, & Helbig, 2018). IFN-α has been the mostly applied exogenous IFNs for clinical antiviral treatment, whose effects have been extensively proved (Li et al., 2018).

Recent studies demonstrated that the intramuscular injection of recombinant IFNs could be applied for the treatment of human influenza viruses (Kroetz et al., 2015), hepatitis viruses (Hu, Ye, Ye, Wang, & Yu, 2019), and antigen-induced arthritis (Chalise, Narendra, Paudyal, & Magnusson, 2013) etc. Similar results can also be obtained in animals, such as rhesus monkey(Matzinger, Carroll, Fritts, McChesney, & Miller, 2011), pig (Brockmeier et al., 2017; Liu et al., 2019; Yu et al., 2019), and broilers(Anjum, Rahman, Aslam, & Qureshi, 2020). The administration of IFN-α can inhibit the replication of porcine reproductive and respiratory syndrome virus (PRRSV) and enhance immune response in pigs (Yu et al., 2019). Further, after combining with inactivated influenza virus, IFN-α could alleviate clinical signs in pigs during the early viral infection (Liu et al., 2019). In short, IFN-α has been regarded as effective agents for the prevention and control of animal diseases.

The administration pathways of IFN-α have been investigated for years, including oral use (Cummins, Beilharz, & Krakowka, 1999; Tompkins, 1999), intramuscular injection, and nasal infusion as mucosal adjuvant (Liu et al., 2019). Different pathways exhibit various effects. The oral administration required only low dose for antiviral treatment, while intramuscular injection required high dose but significant immune responses. Nasal infusion of low-dose IFN-α was also effective in immune-stimulation. The administration pathways should be selected according to the specific applications.

Chinese herb is widely applied in the poultry industry, since several Chinese herb species have been proved to contain active compound for immune enhancement (Guo et al., 2012; C. M. Yang et al., 2019). The combination polysaccharide of astragalus polysaccharide and sulfated epimedium polysaccharide can significantly elevate serum antibody titers, IL-2 and IFN-γ levels (Guo et al., 2012). This study was conducted to evaluate the effects of recombinant IFN-α on immune performance in health piglets, with Chinese herb as comparison. The serum levels of IFN-γ and IFN-stimulated genes (MX1 and ISG15) were evaluated as indicators. The administration pathways were compared between oral intake and intramuscular injection. This study proposed that oral administration of IFN-α may be a facile, practical and economic way for improving the immunity of piglets in daily care, and it may be also in conjunction with vaccine immunization. It may provide information for making up beneficial plans for health pig farms.

Ethics statement

All animal care and handling were in accordance with the recommendations of the Animal Care and Use Committee (Permission No.: SYXK20170005) of the Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agriculture and Forestry Sciences (IAHVMBAAFS), Beijing, China, and conformed to the health plan (Permission No.: WJSY2019) of pig farm of Beijing Vica biotechnology co., LTD., Beijing, China.

Experimental animals

A total of 40 crossbred piglets (Landrace×Large White) with the same age (about 40 days old) and similar body weight were selected and labeled with ear number. All piglets were fed the same basal diet, which was formulated according to the nutrient requirements proposed by National Research Council (1998) (Table 1). Food and water were available ad libitum. All piglets were immunized with mycoplasma and porcine circovirus vaccine after weaning.

Materials

The compound Chinese herbal applied in this study was HLY provided by ShenYang Vica Animal Husbandry Technology Co., LTD., composed of astragalus, epimedium, fructus ligustris, etc. HLY was used by diluting in water (1:1000, w/w). Recombinant IFN-α was provided by Beijing Vica Industrial Technology Innovation Research Institute. The titer of this product was detected as 3.89 × 10⁹ U/mL with MDBK-VSV cell line. The endotoxin was tested as below 50 EU/10⁷ U with gel limit test.

Grouping and treatment

The 40 piglets were randomly divided into four groups (10 per group). The pigs in the same group were kept in one pen. The four groups were as follows: Group C (Control group without any treatment), Group H (treated with compound Chinese herbal 1:1000 diluted in water everyday), Group K (administered orally with recombinant IFN-α diluted in distilled water, 1500 IU per day per piglet), and Group J (administered intramuscularly with recombinant IFN-α diluted in saline, 4× 10⁶ IU per day per piglet). The treatment was lasted for 3 days and the piglets were monitored for 15 days (including the 3 days of treatment).

Table 1
Basic diet formula and nutrition level
Ingredients	Proportion (%)	Nutrition index **	Nutritional content
Corn	63	CP	17.50%
46% Soybean meal	10	Lys	1.35%
Puffed soybeans	7.5	Ca	0.62%
Fermented soybean meal	5	NE (Mcal)	2600
Steam fishmeal	2.5
Whey powder	4
sucrose	2
Soybean oil	2
Premix *	4
Sum	100
Note: * Premix provided multi-dimensional and multi-mineral, salt, acidulant, phytase, pharmaceutical additives, etc. ** Nutritional index was the calculated value.

Sample collection and pretreatment

The whole blood was collected from the precaval vein of piglets at 8:00 a.m. on Days 1, 2, 3, 6, 9, 12, and 15. The blood samples with and without anticoagulation (EDTA) were obtained. Serum was separated from non-anticoagulated blood and stored frozen at -20℃ for test. The peripheral blood lymphocytes (PBMC) were separated from anticoagulated blood. The total RNA of PBMC was extracted with the TRlzol method, reverse-transcribed, and stored frozen at -80 ° C for following tests.

Detection of serum IFN-γ with ELISA

The IFN-γ level in serum samples was detected by American Cygnus mouse γ-interferon ELISA kit, according to the manufacture’s manual. The r² value of standard curve was 99.2%, and the IFN-γ level was calculated according to the standard curve.

Determination ofMX1andISG15expression in PBMC with real-time PCR

Primers were designed according to the gene sequences of MX1 and ISG15 in pigs and the primers of internal reference gene β-actin were published in NCBI (Table 2). The real-time PCR was performed with the cDNA template previously transcribed from extracted RNA. Real-time PCR was performed to detect the expression levels of MX1 and ISG15 with the SuperReal PreMix Plus (SYBR Green) kit (Tiangen, FP205). The optimized PCR conditions were: 95 ℃ for 15 min; 95 ℃ for 10 s, 60 ℃ for 20 s, 72 ℃ for 20 s, 40 cycles; 95 ℃ for 15 s, 60 ℃ for 1 min, 95 ℃ for 15 s to collect the fluorescence signals. Each sample was repeatedly tested three times. The PCR products were ligated into pGM-Simple-T vector and transformed into E. coli DH5α to obtain the recombinant plasmids pTpoMX1, pTpoISG15 and pTpoβ-actin. After being identified and verified by PCR and sequence, these plasmids were stored at -80 ℃.

Table 2
Primer sequence for IFN stimulation genes and internal reference gene
Gene	NCBI ref.	Primer	Sequence (5’ to 3’)	PCR Length
β-actin	U07786	β-actin F1	CTTCCTGGGCATGGAGTCC	201 bp
β-actin	U07786	β-actin R1	GGCGCGATGATCTTGATCTTC	201 bp
MX1	M65087	MX1 F1	CATCTGTAAAACTCTGCCCCTGT	115 bp
MX1	M65087	MX1 R1	CATCTTCCCGCTTTCATCCT	115 bp
ISG15	EU584557.1	ISG15 F2	TGGTGAGGAACGACAAGGGTC	128 bp
ISG15	EU584557.1	ISG15 R2	CTCGAAAGTCAGCCAGAAATGGT	128 bp

Data statistics and analysis

Statistical analysis was performed using SPSS17.0. One-way ANOVA and LSD method was used to analyze the significance of differences among groups. The general linear model GLM program was used to analyze the significance of the two factors (treatment time and administration pathways) on the evaluation indexes. Pearson correlation coefficient (PCC) of bilateral test was used to analyze the correlation between IFN-γ and IFN-stimulated genes. P < 0.05 indicated significant difference, and P < 0.01 indicated extremely significant difference. The test data were presented as mean ± standard deviation (SD).

Effects from different treatments on serum IFN-γ level

Effects from different treatments on IFN-γ level in piglet serums were shown (Fig. 1). The administration of IFN-α showed significant enhancement of serum IFN-γ compared to that of Chinese herb and control. On Day 1, 2 and 3 of treatment, the level of serum IFN-γ in piglets of Group J was significantly higher than that of other groups (all P<0.05). Compared to Group C, the IFN-γ level in Group J was increased by 118% and 84% on Day 1 and Day 2, respectively. On Day 6, 9, 12 and 15, the IFN-γ level of Group K was gradually increased, which was much higher than that of other groups. Compared to Group H, the IFN-γ level in Group K was significantly increased by 231% and 308% on Day 6 and Day 9, respectively(P<0.05). On Day 15, the IFN-γ level in Group K was increased by 345%, 531%, and 173%, respectively, compared to that of in Group C, Group H, and Group J (all P<0.05). The intramuscular injection of IFN-α showed significant increase of serum IFN-γ at the first 3 days, and oral administration showed gradual increase of serum IFN-γ during 6-15 days after the treatment.

Effects from different treatments on the expression level of MX1and ISG15 mRNA in PBMC

Effects from different treatments on the expression level of MX1 mRNA in PBMC of piglets were shown (Fig. 2). The administration of IFN-α elevated the level of MX1 mRNA compared to that of Chinese herb and control. On Day 9, the MX1 mRNA in piglets of Group J was significantly increased by 64% than that of Group C (P <0.05), while no significant difference was observed at other treatment time points. The MX1 mRNA in piglets of Group K was increased by 89% compared to that of Group H on Day 2 (P <0.05), and it was increased by 47% than that of Group J on Day 3 (P <0.05).

Effects from different treatments on the expression level of ISG15 mRNA in PBMC of piglets were shown (Fig.3). Both the administration of IFN-α and Chinese herb elevated the level of ISG15 mRNA. On Day 3, the level of ISG15 mRNA in Group K and Group H was increased by 13% and 28%, respectively, compared to that of Group C (P <0.05). No significant difference was observed in other treatment time points.

Correlation of treatment on the serum IFN-γ and IFN stimulated genes in PBMC

Correlation between treatments and evaluation indexes was explored in all samples, including serum IFN-γ, expression level of MX1 and ISG15 mRNA. The different treatments had significant effects on serum IFN-γ and relative mRNA expression abundance of MX1 and ISG15 (P <0.01). However, the treatment duration had no significant effects (P > 0.05).

Correlation of serum IFN-γ and IFN stimulated genes in PBMC

Correlation between serum level of IFN-γ and the expression level of IFN-stimulated genes in PBMC was explored in all samples (n = 280, Table 3). No significant correlation was observed between serum IFN-γ with MX1 or ISG15 mRNA level in PBMC (P>0.05). Good correlation was observed between the expression of MX1 and ISG15 mRNA, with PCC of 0.771. The result was extremely significant (P <0.01).

Table 3. Correlation of serum IFN-γ and IFN stimulated genes in PBMC

Index	serum IFN-γ	*MX1* mRNA	*ISG15* mRNA
serum IFN-γ	1	0.006	-0.01
MX1 mRNA		1	0.771**
ISG15 mRNA			1

Note: ** Indicated extreme significance, P<0.01.

The supplementation of IFN-α has been widely applied in livestock and poultry industry. In recent years, the effects of IFN-α have been investigated, as immunoregulator, antivirals, vaccine adjuvant and immunopotentiator etc. (Li et al., 2018) The oral administration of IFN-α in pig showed better adaptive immune response (Brockmeier et al., 2017; Razzuoli, Dotti, Archetti, & Amadori, 2010). It was resulted from the regulatory effect on IFN-γ gene and the increase of IFN-γ-secreting lymphocytes. Thus, the serum IFN-γ can be applied as an indicator for the effects of IFN-α (Razzuoli et al., 2010). Further, antiviral activity of IFN-α was also reported. The recombinant, replication-defective human adenovirus type 5 vectors containing porcine IFN-α (Ad5-pIFNα) was constructed. The pigs inoculated with 10⁹ PFU of Ad5-pIFNα were completely protected when challenged 24 h later with foot-and-mouth disease virus (FMDV). The animals showed no clinical signs, no viremia, and did not develop antibodies against viral nonstructural proteins, achieving complete protection from FMDV infection (Chinsangaram, Moraes, Koster, & Grubman, 2003; Moraes et al., 2007). After the administration of a nonreplicating human adenovirus type 5 vector expressing porcine IFN-α, innate and adaptive immune responses of pigs to PRRSV can be improved. Viremia was delayed, and viral load was decreased in the sera of pigs. Further, the number of virus-specific IFN-γ-secreting cells was increased (Brockmeier et al., 2012). In another study, IFN-α was administered via an adenovirus vector as an adjuvant with live-attenuated PRRSV vaccine for enhancing immune response to the vaccine. However, the assumed adjuvant effect was not observed and IFN-α inhibited replication of the vaccine virus (Brockmeier et al., 2017). IFN-α was also applied as mucosal adjuvant for influenza vaccine in pigs. The combination of low-dose IFN-α and inactivated influenza virus via nasal infusion could significantly up-regulate the expression of immunoregulatory cytokines and induce a strong mucosal innate immune response (Liu et al., 2019).

Most of previous studies focused on the effects of IFN-α against virus, in our study, the health piglets were administrated with IFN-α. The effects on serum IFN-γ were explored. The results proved that the IFN-α was able to elevate the serum IFN-γ level, as well as the expression levels of IFN-stimulated genes, in the subsequent days after the treatment. The result may help in controlling viral diseases during daily care of piglets, especially for the farms at the threaten of African swine fever virus.

The administration pathways have been another important factor for affecting the effects of IFN-α, which should be selected according to the specific applications. One study compared the therapeutic effect of natural chicken IFN-α administered via oral and intramuscular (i.m.) routes against Newcastle Disease (ND) in broiler chicken. The protection effects were better in chicken treated with IFN-α via the oral route than in those treated via the i.m. route (Anjum et al., 2020). Similarly, broilers were administrated with recombinant IFN-α via intravenous, intramuscular, and subcutaneous injections. The results showed that the half-life of IFN was faster, reaching a peak in about 3 ~ 4 hours (Zhao et al., 2017). In previous study, after the intramuscular injection of 24.5 × 10⁶ IU IFN-α2b and IFN-γ complex, serum IFN-α and IFN-γ began to rise at several hours after the treatment, and then declined after reaching the peak in the human body (García-García et al., 2016). In our study, the oral administration (1500 IU per day per piglet) and intramuscular injection (4× 10⁶ IU per day per piglet) was compared. The oral administration exhibited a gradually increased efficacy lasted for 10 days, while the intramuscular injection presented a rapid but quickly weakened efficacy lasted for only a few days. The oral administration was economic and effective, in addition, much facile than that of other pathways, such as the construction and injection of IFN-α loading vectors.

The active ingredients in traditional Chinese herb have been reported to regulate the IFN secretion. Studies found that the content of serum IFN-γ was significantly increased after 21 days of applying astragalus polysaccharides in piglet diets, but it had no significant effect on IgG, IL-4 and IL-10 (Yuan et al., 2006). A similar result found that a compound traditional Chinese herb based on astragalus polysaccharide, epimedium polysaccharide, propolis flavonoids and saponins significantly increased the mRNA relative expression levels of IFN-γ and IL-10 (L. Yang et al., 2008). However, in our study, it found that compound traditional Chinese herb, involving astragalus, epimedium, privet, etc., made no significant effect on piglet serum IFN-γ. The reason may be the improper compatibility, insufficient amount, or slow efficacy. Compared to traditional Chinese herb, the administration of IFN-α may provide a more controllable efficacy.

Antiviral proteins MX1 and ISG15 are secreted by JAK/STAT signaling in an unconventional secretion pathway (Novakova et al., 2010; Toyokawa, Carling, & Ott, 2007). In this study, the relative mRNA expression levels of IFN-stimulated genes MX1 and ISG15 were significantly correlated, indicating that MX1 and ISG15 were expression-related genes. The determination of MX1 and ISG15 may assist in exploring the mechanism of IFN-stimulated responses. From the results of our study, it found that the treatment method significantly affected the mRNA expression levels of MX1 and ISG15. For MX1, the oral administration of recombinant IFN-α can significantly elevate its mRNA expression level on Day 2 of treatment, while the intramuscular administration can significantly increase the mRNA expression level on Day 9. For ISG15, the oral administration of recombinant IFN-α can increase its mRNA expression level on Day 3. No significant difference was observed in other treatment time points. Further analysis revealed no correlation between serum IFN-γ and IFN-stimulated genes. It indicated that exogenous treatment can regulate the serum IFN-γ and IFN-stimulated genes independently. Due to the complexity of immune-regulation, the mechanism of IFN-α treatment remained to be explored.

The administration of IFN-α made positive effects on the antiviral and immunomodulatory abilities of piglets, exhibited as improved serum level of IFN-γ and mRNA of IFN-stimulated genes (MX1 and ISG15) in PBMC. Compared to that of the intramuscular administration, the oral pathway presented gradually elevated level of serum IFN-γ and lasted for 15 days. It provided an economic and facile pathway to improve the autoimmunity of piglets, which can be applied in daily care in swine farm.

ACKNOWLEDGEMENTS

This work was supported by the Research Start-up Foundation of Leshan Normal University (No.801/204200001).

Funding

This work was supported by the Research Start-up Foundation of Leshan Normal University (No.801/204200001).

Conflicts of interest/Competing interests

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work. All results were strictly in accordance with the experimental data.

Availability of data and material

We declare that the experimental data is strictly in accordance with the experimental design and method in the manuscript. The datasets used or analysed during the current study are available from the corresponding author on reasonable request.

Code availability

The software SPSS17.0 was used to analyze the significance of differences among groups. These target plasmids sequences were blast in the NCBI website.

Authors' contributions

Fawen Dai and Baokai Zhao initiated the idea, finished the experiment design. Fawen Fawen Dai, Yanting Liu, Meimei Zhang and Ruixue Gong conducted the animal trial and Laboratory index determination. Lin Tao and Chu Huashuo prepared the initial manuscript in English. Fawen Dai made the final revision. All authors read and approved the final manuscript.

Ethics approval

Consent to participate

We declare that all authors have seen and approved the content of the submitted manuscript.

Consent for publication

We declare that all authors are willing to publish the submitted manuscript in VSC if it is accept.

Anjum, F. R., Rahman, S. U., Aslam, M. A., & Qureshi, A. S. (2020). Comparative Study of Protection against Newcastle Disease in Young Broilers Administered Natural Chicken Alpha Interferon via Oral and Intramuscular Routes. mSphere, 5(4). doi:10.1128/mSphere.00585-20
Brockmeier, S. L., Loving, C. L., Eberle, K. C., Hau, S. J., Buckley, A., Van Geelen, A., . . . Lager, K. M. (2017). Interferon alpha inhibits replication of a live-attenuated porcine reproductive and respiratory syndrome virus vaccine preventing development of an adaptive immune response in swine. Vet Microbiol, 212, 48-51. doi:10.1016/j.vetmic.2017.11.004
Brockmeier, S. L., Loving, C. L., Nelson, E. A., Miller, L. C., Nicholson, T. L., Register, K. B., . . . Kehrli, M. E., Jr. (2012). The presence of alpha interferon at the time of infection alters the innate and adaptive immune responses to porcine reproductive and respiratory syndrome virus. Clin Vaccine Immunol, 19(4), 508-514. doi:10.1128/cvi.05490-11
Chalise, J., Narendra, S., Paudyal, B., & Magnusson, M. (2013). Interferon alpha inhibits antigen-specific production of proinflammatory cytokines and enhances antigen-specific transforming growth factor beta production in antigen-induced arthritis. Arthritis Res Ther, 15(5), R143. doi:10.1186/ar4326
Chinsangaram, J., Moraes, M. P., Koster, M., & Grubman, M. J. (2003). Novel Viral Disease Control Strategy: Adenovirus Expressing Alpha Interferon Rapidly Protects Swine from Foot-and-Mouth Disease. Journal of Virology, 77(2), 1621-1625. doi:10.1128/jvi.77.2.1621-1625.2003
Crosse, K. M., Monson, E. A., Beard, M. R., & Helbig, K. J. (2018). Interferon-Stimulated Genes as Enhancers of Antiviral Innate Immune Signaling. J Innate Immun, 10(2), 85-93. doi:10.1159/000484258
Cummins, J. M., Beilharz, M. W., & Krakowka, S. (1999). Oral use of interferon. J Interferon Cytokine Res, 19(8), 853-857. doi:10.1089/107999099313352
García-García, I., Hernández-González, I., Díaz-Machado, A., González-Delgado, C. A., Pérez-Rodríguez, S., García-Vega, Y., . . . Bello-Rivero, I. (2016). Pharmacokinetic and pharmacodynamic characterization of a novel formulation containing co-formulated interferons alpha-2b and gamma in healthy male volunteers. BMC Pharmacol Toxicol, 17(1), 58. doi:10.1186/s40360-016-0103-8
Guo, L., Liu, J., Hu, Y., Wang, D., Li, Z., Zhang, J., . . . Nguyen, T. L. (2012). Astragalus polysaccharide and sulfated epimedium polysaccharide synergistically resist the immunosuppression. Carbohydr Polym, 90(2), 1055-1060. doi:10.1016/j.carbpol.2012.06.042
Hu, Y., Ye, Y., Ye, L., Wang, X., & Yu, H. (2019). Efficacy and safety of interferon alpha therapy in children with chronic hepatitis B: A long-term follow-up cohort study from China. Medicine (Baltimore), 98(32), e16683. doi:10.1097/md.0000000000016683
Klotz, D., Baumgärtner, W., & Gerhauser, I. (2017). Type I interferons in the pathogenesis and treatment of canine diseases. Vet Immunol Immunopathol, 191, 80-93. doi:10.1016/j.vetimm.2017.08.006
Kroetz, D. N., Allen, R. M., Schaller, M. A., Cavallaro, C., Ito, T., & Kunkel, S. L. (2015). Type I Interferon Induced Epigenetic Regulation of Macrophages Suppresses Innate and Adaptive Immunity in Acute Respiratory Viral Infection. PLoS Pathog, 11(12), e1005338. doi:10.1371/journal.ppat.1005338
Li, S. F., Gong, M. J., Zhao, F. R., Shao, J. J., Xie, Y. L., Zhang, Y. G., & Chang, H. Y. (2018). Type I Interferons: Distinct Biological Activities and Current Applications for Viral Infection. Cell Physiol Biochem, 51(5), 2377-2396. doi:10.1159/000495897
Liu, L., Fan, W., Zhang, H., Zhang, S., Cui, L., Wang, M., . . . Liu, W. (2019). Interferon as a Mucosal Adjuvant for an Influenza Vaccine in Pigs. 34(3), 324-333. doi:10.1007/s12250-019-00102-7
Matzinger, S. R., Carroll, T. D., Fritts, L., McChesney, M. B., & Miller, C. J. (2011). Exogenous IFN-alpha administration reduces influenza A virus replication in the lower respiratory tract of rhesus macaques. PLoS One, 6(12), e29255. doi:10.1371/journal.pone.0029255
Moraes, M. P., de Los Santos, T., Koster, M., Turecek, T., Wang, H., Andreyev, V. G., & Grubman, M. J. (2007). Enhanced antiviral activity against foot-and-mouth disease virus by a combination of type I and II porcine interferons. J Virol, 81(13), 7124-7135. doi:10.1128/jvi.02775-06
Musella, M., Manic, G., De Maria, R., Vitale, I., & Sistigu, A. (2017). Type-I-interferons in infection and cancer: Unanticipated dynamics with therapeutic implications. Oncoimmunology, 6(5), e1314424. doi:10.1080/2162402x.2017.1314424
Novakova, Z., Hubackova, S., Kosar, M., Janderova-Rossmeislova, L., Dobrovolna, J., Vasicova, P., . . . Hodny, Z. (2010). Cytokine expression and signaling in drug-induced cellular senescence. Oncogene, 29(2), 273-284. doi:10.1038/onc.2009.318
Razzuoli, E., Dotti, S., Archetti, I. L., & Amadori, M. (2010). Clinical chemistry parameters of piglets at weaning are modulated by an oral, low-dose interferon-alpha treatment. Vet Res Commun, 34 Suppl 1, S189-192. doi:10.1007/s11259-010-9402-5
Renauld, J. C. (2003). Class II cytokine receptors and their ligands: key antiviral and inflammatory modulators. Nat Rev Immunol, 3(8), 667-676. doi:10.1038/nri1153
Tompkins, W. A. (1999). Immunomodulation and therapeutic effects of the oral use of interferon-alpha: mechanism of action. J Interferon Cytokine Res, 19(8), 817-828. doi:10.1089/107999099313325
Toyokawa, K., Carling, S. J., & Ott, T. L. (2007). Cellular localization and function of the antiviral protein, ovine Mx1 (oMx1): I. Ovine Mx1 is secreted by endometrial epithelial cells via an 'unconventional' secretory pathway. Am J Reprod Immunol, 57(1), 13-22. doi:10.1111/j.1600-0897.2006.00444.x
Yang, C. M., Han, Q. J., Wang, K. L., Xu, Y. L., Lan, J. H., & Cao, G. T. (2019). Astragalus and Ginseng Polysaccharides Improve Developmental, Intestinal Morphological, and Immune Functional Characters of Weaned Piglets. Front Physiol, 10, 418. doi:10.3389/fphys.2019.00418
Yang, L., Hu, Y., Xue, J., Wang, F., Wang, D., Kong, X., . . . Xu, W. (2008). Compound Chinese herbal medicinal ingredients can enhance immune response and efficacy of RHD vaccine in rabbit. Vaccine, 26(35), 4451-4455. doi:10.1016/j.vaccine.2008.06.075
Yu, H. Y., Qu, M. S., Zhang, J. L., Gan, L., Zhao, Y., Shan, X. Q., . . . Zhao, J. (2019). Recombinant Porcine Interferon Alpha Enhances Immune Responses to Killed Porcine Reproductive and Respiratory Syndrome Virus Vaccine in Pigs. Viral Immunol, 32(9), 383-392. doi:10.1089/vim.2019.0092
Yuan, S., Piao, X., Li, D., Kim, S., Lee, H., & Guo, P. (2006). Effects of dietary Astragalus polysaccharide on growth performance and immune function in weaned pigs. Animal Science, 82(4), 501-507.
Zhao, J., Yu, H. Y., Zhang, J. L., Wang, X. M., Li, J. P., Hu, T., . . . Chen, J. (2017). Pharmacokinetic studies of the recombinant chicken interferon-α in broiler chickens. J Vet Med Sci, 79(2), 314-319. doi:10.1292/jvms.15-0681

Download PDF

Journal Publication

published 31 Mar, 2022

Read the published version in Mobile Information Systems →

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

The Effects From Oral Administration of Recombinant Interferon-alpha on Piglet Daily Care

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Ethics statement

Experimental animals

Materials

Grouping and treatment

Sample collection and pretreatment

Detection of serum IFN-γ with ELISA

Data statistics and analysis

Results And Analysis

Discussion

Conclusion

Declarations

References

Status:

Journal Publication

Version 1