2.1 Patients and clinical specimens
This study was approved by the University of Southern Medical University-Nanfang Hospital Ethics Board and in accordance with the Declaration of Helsinki. Inform content was obtained from participants. Blood sample (3-5mL) from 34 AML patients and 5 healthy donors were collected.
2.2 Cell cultures
Human acute myeloid leukemia cell line (HL-60) and HEK293 cell line were obtained from the Chinese Academy of Sciences Cell Bank. Cells were cultured in Dulbecco's modified Eagle's medium (DMEM) media containing 10% fetal bovine serum and antibiotics (100 units /ml penicillin G and 100 mg/ml streptomycin) at 5% CO2 and 37℃. Cells were then sub-cultured and treated with 9s-HODE (≥ 98.0% by HPLC; Larodan Fine Chemicals AB, Solna, Sweden) dissolved in ethanol.
2.3 miRNA expression profiling
HL-60 cells with or without 9s-HODE treatment were lysed in Trizol (Invitrogen, Carksbad, CA) for total RNA extraction. DNA was removed by using RNase-free DNase I (Life Technologies, Carlsbad, CA, USA). The RNA yield was measured using a UV absorbance spectroscopy (Kaiao, Beijing, China), and the RNA quality was checked by gel electrophoresis. miRNA expression profiling was done using the Agilent miRNA expression platform.
2.4 Selection of gene targets for miR-361-3p
Available literature, online databases such as miRBase (http://www.mirbase.org/) and starbase (http://starbase.sysu.edu.cn) were surveyed to select the target genes for miR-361-3p. To validate the folding affinity between the miRNAs and their target genes, secondary structure was predicted using RNAfold web server (http://rna.tbi.univie.ac.at/cgi-bin/ RNAWebSuite/RNAfold.cgi).
2.5 Quantitative RT-PCR (qRT-PCR)
Total RNA from lung cancer cell lines was prepared as above. mRNA and miRNA levels were measured by qRT-PCR using an ABI PRISM 7500 Sequence Detection System using miRNA Expression Assay primer and probe sets (Applied Biosystems). miRNA expression levels were normalized using the RNU6B small nuclear RNA (U6) as an endogenous control using theΔΔCt method. The expression of corresponding miRNA target genes was quantitated using DBI Bestar® SybrGreen qPCR MasterMix with beta-actin and GAPDH as internal controls. The primers used for qRT-PCR analysis were as follow (Table 1). All procedures were run in triplicates in at least 3 independent experiments.
Table 1
The primers used for qRT-PCR analysis.
Gene | Primer sequence(5’- 3’) |
U6 | F:CTCGCTTCGGCAGCACA |
| R:AACGCTTCACGAATTTGCGT |
hsa-miR-361-3p | F:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAATCAGA |
| R:ACACTCCAGCTGGGTCCCCCAGGTGTGATTCTG |
GAPDH | F:TGTTCGTCATGGGTGTGAAC |
| R:ATGGCATGGACTGTGGTCAT |
BTG2 | F:ACGGGAAGGGAACCGACAT |
| R:CAGTGGTGTTTGTAGTGCTCTG |
2.6 Transfection
MiR-361-3p mimic (miR-361-3p), mimic negative control (miR-NC), miR-361-3p-specific inhibitor (miR-361-3p-in), miRNA inhibitor control (miR-in NC), siRNA for BTG2 (si-BTG2), and siRNA negative control (si-NC) were purchased from RiboBio (Guangzhou, China). For transient transfection, the cells were seeded in six- well plates, and 50 nM mimic/miRNA-inhibitor/siRNA were transfected into the cells using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA). After cell transfection for 12 h, cells were treated to 25 µM of 9s-HODE and then grouped the cells into control group, 9s-HODE group, mimic NC group, 9s-HODE + miR-361 mimic group, inhibitor NC group, 9s-HODE + miR-361 inhibitor group, si-NC group and 9s-HODE + si-BTG2 group. The efficiency of all transfection was evaluated by qRT-PCR and/or western blot.
2.7 Duel luciferase reporter assay
The wild-type (WT 3’-UTR) or mutant (Mut 3’-UTR) miR-361-3p binding site in the 3’-UTR of BTG2, CPEB1 and MYT1 were synthesized and inserted into the psiCHECK-2 reporter vector (Sango, Shanghai, China). For the duel luciferase reporter assay, HEK293 cells were transfected with 200 ng mL− 1luciferase reporter plasmid containing wild-type (WT) or mutant CPEB1 or MYT1 3′ UTR or empty vector (Vector) together with 20 nM pre-miR-361-3p or pre-miR-control according to the manufacturer’s protocol. The cells were harvested 48 h after transfection, and the luciferase activity was measured using a Dual- Luciferase Reporter Assay System (Promega, Madison, WI, USA). Normalized luciferase activity was reported as Renilla Luciferase activity.
2.8 Cell viability assay
Cells were plated in 96-well format and transfected with oligos, and/or with drug added, followed by incubation for additional 24–72 h. Cell viability was assayed by using Cell Counting Kit-8 (CCK-8), (Dojindo, Kumamoto, Japan) according to the manufacturer’s instructions. All experiments were performed in triplicate and three independent experiments were performed.
2.9 EdU incorporation assay
Cell proliferation was assessed by a 5-ethynyl-2′-deoxyuridine (EdU) assay ((RiboBio, Guangzhou, China) following the manufacturer’s instructions. HL-60 Cells were plated into 96-well plates (4 × 104 cells/well) and cultured in triplicated with DMEM (10% FBS) for 24 h. 48h after transfection, cells were incubated in EdU (50 µM) for 2 h at 37°C and fixed with 4% formaldehyde for 30 min. After permeabilization with 0.5% TritonX-100 for 10 min, 100uL Apollo reaction cocktail was added to each well for 30min. Subsequently, the nuclei were stained with Hoechst 33342 for 30 min and visualized under a fluorescent microscope ((10×, Olympus Co., Tokyo, Japan).
2.10 Flow cytometric analysis
For flow cytometry analysis, cells were transfected with pcDNA-BTG2, the mimics or inhibitor of miR- 361-3p, and/or with drug added, and maintained for 48h. Cells were collected after washing twice with PBS, staining with the Annexin V-FITC/PI Apoptosis Detection Kit (BD Biosciences) and they were then evaluated by flow cytometry (BD Biosciences, Bedford, MD, USA). The percentage of apoptosis cells was analyzed using Cell Quest v.3.1 Software (Becton Dickinson, USA).
2.11 Western blot analysis
Cells were transfected with mimics and inhibitor of miR-361-3p and pcDNA-BTG2, and/or with drug added for 48 h, and then split with lysis buffer. The protein was separated in parallel lanes of 10% SDS-gels. Western blot analyses were performed as previously described. GAPDH was used as a loading control.
2.12 Statistical analysis
The data are presented as the mean ± standard deviation (SD) of at least three independent experiments. Student’s t-test were used for evaluate the statistical significant differences in groups. GraphPad Prism (version 5.0; GraphPad Software, La Jolla, CA, USA) was used and p value of < 0.05 was considered statistically significant differences.