2.1 Cell culture
The human ESCC cells (TE-1) were purchased from GeneChem (Shanghai, China). The culture of the cells used RPMI‑1640(Gibco, Carlsbad, CA, USA) medium mixture with 10% fetal bovine serum (FBS). All the cells were incubated in humidified environment with 5% CO2 at 37°C. The follow-up experiments were performed when the cells were cultured to 70-80%confluence.
2.2 Lentiviral -vector transduction
pGCSIL-GFP vector was used to load siRNA of EIF3C and negative control siRNA, which encode green fluorescent protein that could be detected under fluorescence microscope. The sequence of siRNA-EIF3C was CAGTCACTAAAGGTCTGTTTA and a random siRNA sequence was used as a negative control. All the lentiviral vector used in this experiment was obtained from GeneChem (Shanghai, China) and stored at -80 °C until use. To construct lentiviral vector transfected cells, harvested and plated the TE-1 cells in six-well plate with 2000cells/well. After attachment, the viral plasmid was added according to MOI of 10 plaque-forming units (PFU) per cell, and the negative control plasmid was selected as the control group. The medium was changed after 24 hours of culture, and the fluorescence intensity of the cells was observed under the fluorescence microscope to determine whether the transfection was successful when the cell was culture to 3 days. Then the mRNA of TE-1 cell was extracted according to the protocol of manufacturer’s instruction. The efficiency of EIF3C knockdown in ESCC cells was measured using qPCR and western blot assay. Finally, the Lentiviral vector- transfected cells was used in subsequent experiment.
2.3 Cell Proliferation Analysis
Colony formation assay was used to evaluate the effect of EIF3C on proliferation of TE-1cell. Briefly, the Lentiviral vector- transfected cells were harvested and collected in 1.5ml centrifuge tube. After washing with PBS twice, the cells were plated in six-well plates with 1000 cell/ well. The cells were further cultured for 14 days follow up with discarding culture medium and washing the cells in situ twice with PBS. Subsequently, fixed the cells with paraformaldehyde for 20 minutes, and then stained the cell with Giemsa stain (Solarbio Science & Technology, Beijing, china) for 10 minutes and washed the cells with distilled water twice. Finally, after dry of plate, the number of cell colonies were counted under the microscope and the photograph were captured with digital camera.
The cell viability of TE-1 was accessed using Cell counting kit-8 assay (CCK-8) assay (dojindo laboratories, Kumamoto, Japan) after transfection with lentiviral vector. In brief, harvested and seeded 5000 cells in 96 well plate and cultured the cells to appointed time(1-5days). Then, CCK-8 reagent (10µL) was added into each well and further cultured for 2h in dark at 37°C. Finally, the absorbance was detected using microplate reader at 450 nm.
To measure the proliferation of TE-1 cell after silencing EIF3C, Cellomics ArrayScan system was used. Briefly, plated the Lentiviral vector- transfected TE-1 cells in 96-well plate with 2000cell/well. After culture overnight, the number of fluorescent cells were quantified once a day for five consecutive days by Cellomics arrayScan VTI system (Thermo Fisher Scientific, Waltham, MA, USA).
2.4 RNA extraction and quantitative real-time PCR
To measure the mRNA expression of EIF3C after transfection with Lentiviral plasmid, the Quantitative real-time assay was performed. Briefly, total RNA was isolated from TE-1 cells transfected with Lentiviral plasmid using AxyPrep Multisource Total RNA Miniprep Kit (Axygen, Corning, NY, USA). The generation of cDNA used TransScript II All -in-One First-Strant cDNA Synthesis SuperMix for PCR kit (Transgen, Beijing, China) according to the manufacturer's instructions. Then, the TransStart Top Green qPCR SuperMix kit (Transgen, Beijing, China) was used to performed qRT-PCR assay. The Primers used in our study were obtained from Sangon Biotech (Shanghai, China). GAPDH were taken as control and the relative expression of EIF3C was normalized to GAPDH. The primer sequences are as follows: EIF3C , forward:5′ CCATCCTCTGCCACATCTACC 3′, Reverse: 5′ CCACCTTCTCCTGCTCCTG 3′; GAPDH, forward: 5′ TGACTTCAACAGCGACACCCA 3′, Reverse: 5′ CACCCTGTTGCTGTAGCCAAA 3′.
2.5 Apoptosis assay
The effect of EIF3C on apoptosis induction in TE-1 cells was evaluated by flow cytometry. In brief, lentiviral vector transfected TE-1 cells were harvested and collected into a 1.5ml centrifuge tube, after washing with pbs twice, stained the cells with annexin V-APC (ebioscience 88-8007) for 10 minutes at 37.0°C in dark. Finally, the cell sample was analyzed using flow cytometry. The positive annexin V-APC staining cell was thought as apoptotic cell.
2.6 Cell cycle phase assay
The effect of EIF3C on cell cycle phase was detected by flow cytometry. The Lentiviral vector- transfected cells were harvested and collected into the 1.5ml centrifuge tube. After fix with 70% cold ethanol at 4˚C for 4 h, washed the cells with PBS twice, and then incubated the cells with 10 µl RNase and 25 µl PI staining solution (Beyotime Biotechnology, Shanghai, China) in dark at 37˚C for 30 min. Finally, the cell cycle was detected using flow cytometry. The proportion of each stage between the EIF3C silencing group and the control group was calculated.
2.7 western blot assay
The western blot assay was performed to detect the protein expression. In brief, The Lentiviral vector- transfected cells were harvested and collected into the 1.5ml centrifuge tube. Added RIPA protein lysis containing protease inhibitor (Beyotime Biotechnology, Shanghai, China) in the tube and lysed the cell pellets for 30min. then supernatant was collected by centrifugation at 12,000×g for 10min. BCA protein quantitative kit (genstar company,Beijing, China) was used to quantify protein concentration. The equal protein samples of each group were separated by SDS gel electrophoresis, and then the protein was transferred to PVDF membrane (EMD Millipore, Billerica, MA, USA). Subsequently, PVDF membrane was sealed with 5% skim milk for 1h and incubated with primary antibody at 4 °C overnight. The primary antibodies against β-actin, cleaved caspase-3, and cleaved PARP were purchased from cell signaling technology (Danvers, MA). The PVDF membrane was incubated with horseradish peroxide labeled secondary antibody (Santa Cruz, CA, USA) at room temperature for 1 hour. After washing with PBST twice, the band was detected using ECL luminescent solution (Thermo Fisher, Waltham, USA).
2.8 Data Mining of TCGA Database
The MRNA expression data of ESCC and the clinical information of ESCC patients obtained from TCGA were downloaded from the website “https://xenabrowser.net/datapages/”. The RSEM value, the transformed data format of mRNA expression, was used for data analysis. The mRNA expression of EIF3C between ESCC and normal tissue was analyzed using T-test, and the results were displayed with box chart. The correlation between EIF3C expression value and clinical information was tested by chi-square test, and the median of EIF3C expression value was selected as the cut-off value to divide it into high expression group and low expression group. The relationship between the expression of EIF3C and prognosis was analyzed using survival analysis package, and the statistic difference was analyzed by log rank test. The above statistics analysis and plot drawing were performed using R.
2.9 Microarray Assay and Ingenuity Pathway Analysis
To profile the gene and physiological processes effected by EIF3C in ESCC cell, the Microarray Assay and the follow up bioinformatics analysis were performed after silencing of EIF3C in TE-1 cell. Briefly, the MRNA of the lentiviral vector- transfected TE-1 cells was extracted according to the mRNA extraction instructions, the RNA was quantified by nano2000(Thermo Fisher Scientific, Waltham, MA, USA) and the RNA quality was measured by Agilent Bioanalyzer 2100(Agilent Technologies, Santa Clara,CA, USA). After measure of EIF3C knockout efficiency by qPCR, the mRNA sample were used for follow-up chip hybridization. The chip hybridization and follow-up data analysis by GeneChipScanner 3000 (Affymetrix) were conducted by GeneChem (Shanghai, China). The fold change of MRNA expression >2 and P value <0.05 were defined as threshold to screen differential expression gene. Finally, Ingenuity Pathway Analysis (IPA) was used to subsequent bioinformatics analysis, including canonical pathways analysis, disease function analysis, etc.
2.10 Statistical analysis
SPSS19.0 software (IBM, Chicago, IL, USA) was applied in statistical analysis. The mean ± standard deviation was used as expression of statistical data. Student’s t-test was used in statistical comparisons between 2 groups. p < 0.05 was defined as statistically significant difference.