Case selection
Ninety PDAC cases were examined. All patients were diagnosed and treated at Tokai University Hospital (Kanagawa, Japan) between March 2000 and October 2013. Patients who underwent preoperative chemotherapy were excluded from the study. Formalin-fixed and paraffin-embedded (FFPE) tissue samples were cut into 4-μm-thick sections and stained with H&E. The H&E-stained sections, pathology reports, and patient medical records were reviewed to confirm PDAC diagnosis and to establish the clinicopathological factors of the patients, including age, sex, tumor size, histological grade, lymph node metastasis, distant metastasis, tumor stage, perineural invasion, lymphatic involvement, venous involvement, and overall survival. Pathological tumor, node, and metastasis (pTNM) staging and histological grade were classified as outlined in the Union for International Cancer Control, 8th edition [17]. Overall survival was defined as the time interval between surgery and death or the date of the last patient visit. In addition, 30 normal pancreatic ducts, 30 low-grade PanINs, and 30 high-grade PanINs among the PDAC specimens were also examined in this study.
ISH of miR-4653-3p
ISH was performed on 4-μm-thick sections of FFPE tissues obtained from patients with PDAC. Sections were deparaffinized in xylene and rehydrated in decreasing concentrations of ethanol diluted in PBS. The slides were then incubated in Proteinase K solution (15 μg/mL) at 37 °C for 10 min and then washed with PBS. A hybridization mix containing digoxigenin-labeled LNA™ microRNA probe (5DigN/TCTCCAAGCAACCCTTAACTCCA/3DigN, final concentration: 5 nM, EXIQON, Woburn, MA, USA) was applied to the sections and hybridization was allowed to occur at 54 °C for 60 min. After this, slides were washed with SSC buffer and incubated with a blocking solution (2% normal sheep serum / PBS, 0.1% Tween20, 1% BSA) for 15 min in a humidified chamber. The blocking solution was removed, anti-DIG reagent, polyclonal sheep anti-DIG-AP diluted 1:800 with antibody diluent (Roche Diagnostics, Mannheim, Germany) were applied, and the sections incubated for 60 min at room temperature. After washing with PBS-T, the cells were incubated with AP substrate (NBT-BCIP (DAKO, Carpinteria, CA, USA) + 0.2 mM levamisole) for 2 h at 30 °C in a humidified chamber. Slides were incubated twice for 5 min in KTBT buffer to stop the reaction and then washed with water before applying Nuclear Fast Red™ (ScyTek, Logan, UT, USA) for 2 min for nuclear counterstaining. Finally, the slides were washed with water and dehydrated in an ethanol solution.
Cell culture
The pancreatic adenocarcinoma cell line, MIA PaCa-2, was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) containing 10% fetal bovine serum and then incubated at 37 °C in a humidified atmosphere containing 5% CO2.
Transfection of miRNA mimic and inhibitor
miRIDIAN miRNA mimic and hairpin inhibitor (Dharmacon, Lafayette, CO, USA) of miR-4653-3p were transfected into pancreatic MIA PaCa-2 cells using DharmaFECT 2 Transfection Reagent (Dharmacon) according to the manufacturer’s protocols. miRIDIAN miRNA Mimic Negative Control #1 (Dharmacon) and miRIDIAN miRNA Hairpin Inhibitor Negative Control #1 (Dharmacon) were used as miRNA mimic and inhibitor controls, respectively. The final concentration of each miRNA mimic, inhibitor, and negative control was 25 nM.
mRNA microarray
Total RNA was extracted from MIA PaCa-2 cells transfected with miR-4653-3p mimic or its negative control using the AllPrep DNA/RNA Mimi kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. RNA samples were sent to Macrogen (Macrogen Japan, Kyoto, Japan) for mRNA microarray analysis using SurePrint G3 Human Gene Expression 8x60K v3 (Agilent, Inc., Santa Clara, CA, USA). Comparative analysis between MIA PaCa-2 cells transfected with miR-4653-3p mimic (n = 4) and MIA PaCa-2 cells transfected with mimic negative control (n = 4) was carried out using an independent t-test. A |fold change| > 2.0 and p < 0.05 were set as the significance threshold. Data analysis was conducted using R 3.3.3 (www.r-project.org).
Screening for a miR-4653-3p target molecule
TargetScan v.7.2 [18] (http://www.targetscan.org/vert_72/) and the Human Protein Atlas v. 19.3 [19] (https://www.proteinatlas.org/) databases were screened to identify the miR-4653-3p target molecule.
RT-qPCR
Total RNA was extracted from MIA PaCa-2 cells 48 h after transfection with miR-4653-3p mimic, miR-4653-3p inhibitor, or each NC using the AllPrep DNA/RNA Mini kit (Qiagen) according to the manufacturer’s protocols. To obtain cDNA from total RNA, reverse transcription was performed using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA) and a thermal cycler (Veriti Thermal Cycler, Thermo Fisher Scientific) under the following conditions: 25 °C for 10 min, 37 °C for 120 min, 85 °C for 5 min, and a cooling step at 4 °C. To analyze HIPK2 expression, quantitative real-time PCR was performed using the TaqMan probe (Hs00179759_m1, Thermo Fisher Scientific), TaqMan Universal PCR Master Mix (Thermo Fisher Scientific), and the Step One Plus system (Thermo Fisher Scientific) under the following conditions: polymerase activation at 95 °C for 10 min, 40 cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min. All samples (n = 5 in each group) were run in triplicate and normalized to GAPDH (Hs02786624_g1, Thermo Fisher Scientific).
Western blot analysis
Western blot analysis was performed using a simple western blot assay (ProteinSimple, Santa Clara, CA, USA). Cultured cells were lysed in cell lysis buffer containing protease inhibitors before sonication. The cell lysates were then centrifuged at 10,000 rpm for 3 min to remove the soluble material. The protein concentration of cell lysates was measured using a DC protein assay (Bio-Rad, Hercules, CA, USA). For the simple western blot assay, cell lysates were diluted to 0.4 μg/μL using 0.1× sample buffer and 5× Fluorescent Master Mix. The primary antibodies used were: HIPK2 (Abcam, Cambridge, United Kingdom) at 1:100 dilution and GAPDH polyclonal antibody (Sigma-Aldrich, St. Louis, MO, USA) at 1:30 000 as the internal control. Secondary antibodies were prepared by the manufacturer. The assay was conducted according to the manufacturer’s instructions. The assay plate and capillary cartridge were placed into a simple western machine (WES; Protein Simple). All subsequent separation, immunodetection, and analysis steps were performed automatically on the WES. Compass software (ProteinSimple) was used to visualize the chemiluminescent image of the capillary, analyze the size or charge data, and process the results. The relative HIPK2 expression peak area was normalized to that of GAPDH (n = 5 in each experimental group).
Luciferase reporter assay
Approximately 500–700 bp fragments containing the miR-4653-3p target site were PCR-amplified in human HIPK2 mRNA 3′ UTR using the following primers: forward primer for target position 929–935 — 5′-catatggcagcaagtgatac-3′; reverse primer for target position 929–935 — 5′-attggttacatgcctatgttatatc-3′, forward primer for target position 5947–5953 — 5′-atgcaattctatttgtctttctc-3′; reverse primer for target position 5947–5953 — 5′-gctattatttacttgagagatattgc-3′, forward primer for target position 7620–7627 — 5′-ttgcttatagttaattctagaaagg-3′; reverse primer for target position 7620–7627 — 5′-tcacagtttgtgtaagataatgtatc-3′. A schematic of human HIPK2 mRNA sequences with three candidate target sites for miR-4653-3p on the 3′ UTR is shown in Supplementary Figure 1. The PCR products were subcloned into the PmeI site on the pMIR-REPORT luciferase plasmid (Invitrogen); insert orientation and nucleotide sequences were verified by sequencing. For the luciferase activity assay, MIA PaCa-2 cells were seeded in 24-well plates one day before transfection. The miR-4653-3p target site-containing pMIR-REPORT plasmid was co-transfected with miR mimics using the transfection reagent TransIT-X2 (Mirus, Madison, WI, USA). After 24 h, cells were lysed with 1× cell culture lysis reagent, as supplied in the Luciferase Assay System (Promega, Madison, WI, USA). Luciferase activity was measured using a GloMax 20/20 luminometer (Promega). Relative translational repression was normalized to the value of the empty pMIR-REPORT luciferase plasmid.
Immunohistochemistry
After the FFPE specimens were cut into 4-μm-thick sections, immunohistochemistry was performed to identify HIPK2 (ab28507, rabbit polyclonal; dilution, 1:200; Abcam) using BOND-MAX (Leica Microsystems, Tokyo, Japan), according to the manufacturer’s instructions. Antigen retrieval was performed by treatment with ER1 for 20 min.
Interpretation of immunohistochemistry and ISH data
Expression measured using immunohistochemistry and ISH was evaluated using the histochemical scoring system (H-score) [20]. H-score (0–300) was calculated as the sum of the staining intensity (0 = negative, 1+ = weak, 2+ = moderate, and 3+ = strong) multiplied by the percentage of cells (0–100) expressed at each intensity. The H-score formula was: 0 × (percentage of negative cells) + 1 × (percentage of 1+ cells) + 2 × (percentage of 2+ cells) + 3 × (percentage of 3+ cells). The optimal H-score cut-off point was determined as the score with the lowest p-value in the overall Kaplan–Meier survival analysis method and the log-rank test. For the miR4653-3p ISH assay, an H-score < 90 was considered low, while an H-score ≥ 90 was considered high. For the HIPK2 immunohistochemistry, an H-score < 180 was considered low, while an H-score ≥ 180 was considered high.
Statistical analyses
Statistical analyses were conducted using SPSS v26 (IBM Corp., Armonk, NY, USA). Fisher’s exact test and Pearson’s χ2 test were used to analyze the relationship between clinicopathological factors and miR-4653-3p or HIPK2 expression. Two-sample Student’s t-test or Welch’s t-test were used to compare the expression of HIPK2 or miR-4653-3p as determined by RT-qPCR, western blot, immunohistochemistry, and ISH. The correlation between miR-4653-3p and HIPK2 expression was evaluated using Spearman correlation analysis. Overall survival curves were plotted using the Kaplan–Meier method and compared using a log-rank test. Overall survival was also evaluated in univariate and multivariate analyses using Cox proportional hazard regression models to identify independent prognostic factors. First, a univariate analysis of overall survival was performed for each clinicopathological factor. Statistically significant factors in the univariate analysis were then included in the multivariable analysis using the forward selection method (likelihood ratio); p < 0.05 was considered statistically significant.