Introduction of OCT4 into human bone-marrow derived mesenchymal stromal cells generates putative iPS cells with the potential to differentiate into CD34+ hematopoietic progenitor cells ex vivo

doi:10.21203/rs.3.rs-1702966/v1

Background

Mesenchymal stromal cells, which can be obtained in a large quantity from bone marrow easily, are non-hematopoietic multipotent stem cells that cannot differentiate into hematopoietic components in physiological condition. Induced pluripotent hematopoietic stem cells (iP-HSCs) may be an alternative graft source for autologous hematopoietic stem cell transplantation (HSCT) without malignant cell contamination and provide a disease-specific model for studying the underlying pathogenesis. This study aimed to generate putative induced pluripotent stem cells (iPSCs) from bone marrow-derived MSCs (BM-MSCs) using the plasmid pcDNA3.1, only containing OCT4.

Methods

BM-MSCs with stable ectopic OCT4 expression were established using a conventional plasmid vector, and then cultured in ES medium to form ESC-like clones. The obtained putative iPSCs were divided into two groups and treated with two different growth factor cocktails to induce differentiation into hematopoietic progenitor cells. Furthermore, putative iPSCs were injected subcutaneously into nude mice and the resulting cells were analyzed.

Results

The generated putative iPSCs were similar to human embryonic stem cells (ESCs) in terms of morphology, surface marker expression, telomerase activity and in vitro differentiation. CD34 + progenitor cells were obtained from the putative iPSCs following treatment with specific factors. The proportion of CD34 + progenitor cells were higher in differentiated cells (16.16 ± 1.27% and 25.40 ± 3.08% at days 14 and 21, respectively) compared to that of untransfected parental BM-MSCs (0.93 ± 0.46%) or undifferentiated cells (1.58 ± 1.29%) (P < 0.05) as determined using flow cytometry. After induction using the second growth factor cocktail and induction process,, the proportion of CD34 + cells reached 31.39 ± 3.60% and 73.68 ± 6.63% at days 14 and 21, respectively. These differentiated cells expressed the mesodermal hematopoietic transcription factor Brachyury.

Conclusions

This cell induction system developed in this study may provide a possible source of grafts-enriched CD34 + progenitor cells without malignant cell contamination for clinical use and to generate patient-specific cell models for studying of the mechanisms of hematopoiesis and related diseases.

Induced pluripotent stem cells (iPSCs)

bone marrow derived mesenchymal stromal cells (BM-MSCs)

Transcription factor

OCT4

hematopoietic differentiation

Reprogramming

CD34+ progenitor cells

Bone marrow-derived mesenchymal stromal cells (BM-MSCs) represent a source of pluripotent cells with the capacity of differentiation into several lineages, including osteoblasts, adipocytes, and chondrocytes. BM-MSCs are non-hematopoietic multipotent stem cells, although they are closely related to hematopoiesis. BM-MSCs have immunosuppressive properties that render them attractive candidates for cell-based therapies in regenerative medicine. BM-MSCs can be easily expanded in vitro, but have a limited lifespan and differentiation potential in culture. Thus it is important to establish a method for converting BM-MSCs into a state with the potential of hematopoietic differentiation for further clinical application. The emergence of induced pluripotent stem cells (iPSCs) is a breakthrough. Somatic reprogramming is a suitable technique for achieving the afore-mentioned transformation.

Autologous hematopoietic stem/progenitor cell transplantation （HSCT）for patients with a variety of malignancies, such as leukemia, lymphoma, solid tumors, can offer the following advantages: (1) increase tolerance to more intensive chemotherapy to kill more tumor cells; (2) increase the possibility of the relapse free-survival due to the residual malignant cells contaminating the bone marrow or peripheral blood; and (3) avoid the possibility of graft-versus-host disease, which almost always occurs during allogeneic HSCT so that the side effects can be reduced to the greatest extent possible. However, regular autologous HSCT can only be performedin in a limited number of cases for patients with bone marrow involved malignancies, such as leukemia，which are derived from hematopoietic stem or progenitor cells, whereas malignancies derived from MSCs are left unaffected. Therefore, iPS-like cell induction from BM-MSCs and switching to CD34+ hematopoietic stem cell commitment may provide autologous hematopoietic stem/progenitor cell grafts without leukemia cell contamination. Since 2006, iPSCs have been established from mouse and human fibroblasts by the transduction of four Yamanaka factors, OCT4, SOX2, KLF4 and C-MYC [1, 2]. The generated iPSCs exhibit similar properties to those of human embryonic stem cells (hESCs) in morphology, ESC marker expression, and differentiation ability. Since then, a new era of somatic cell reprogramming for the generation of patient-specific or disease-specific iPSCs has begun, contributing to the understanding of disease pathogenesis and development of novel disease modeling [3-5]. Human iPSCs have been successfully generated from a variety of somatic cell types, such as skin fibroblasts, peripheral blood or bone marrow cells, hepatocytes and adipose stem cells, using various transfection methods like retroviral transduction or liposome transfection.

In recent years, MSCs have emerged as promising reprogramming candidates because of their multipotency and high proliferative capacity [6, 7]. MSCs can be isolated from diverse sources and expanded in vitro for extended periods of time. They provide a favorable environment conducive to hematopoiesis and have been extensively used in clinical practice for decades. MSCs derived from bone marrow, umbilical cord blood (UCB) or dental tissue have been successfully reprogrammed into iPSCs using virus-mediated transduction [8, 9]. However, virus-based reprogramming has some undesirable drawbacks because of the genomic integration and background expression of reprogramming factors [4, 10] . Thus virus-free approaches such as plasmid-mediated reprogramming, especially using the episome plasmid containing EBNA/OriP, have been developed to reprogram somatic cells without viral genome integration, which is currently considered as the most reliable and repeatable unintegrated reprogramming approach, despite the lower reprogramming efficiency. The plasmid system described above has been used successfully for the reprograming of unfractionated blood or UCB-derived mononuclear cells (MNCs) into iPSCs [8, 11].

Derivation of iPSCs from adherent cells, such as BM-MSCs, using conventional plasmids has rarely been reported because of its extremely low reprogramming efficiency [12]. However, the multipotent cells may facilitate iPSCs generation at a higher efficiency, as reported by Kim et al. [13, 14]. Certain studies have demonstrated that iPSCs can be generated using one or two Yamanaka factors from cells endogenously expressing a portion of the Yamanaka factors endogenously [6, 8, 14, 15]. Our previous study showed that BM-MSCs overexpressing OCT4 displayed higher proliferation ability compared with that of parental MSCs. Moreover, high ectopic expression of the transcription factor OCT4 in BM-MSCs may drive their growth as ESC-like cells with “stemness” characteristics, capable of forming EBs ex vivo and upregulatng the expression of pluripotent transcription factors such as SOX2 and NANOG[16]. In the current study, we generated putative iPSCs from BM-MSCs using a plasmid only containing OCT4. The generated putative iPSCs were similar to ESCs in some aspects, including morphology, pluripotency marker expression and in vitro differentiation. In addition, the resulting putative iPSCs had the potential to differentiate into CD34+ progenitor cells following exposure to a predefined culture system supplemented with various hematopoietic growth factors. Our findings provide a feasible induction system to generate a cell model for the study of the hematopoietic mechanism in related diseases and may offer a graft source for future HSCT in patients with bone marrow-derived tumor cells.

Cell culture

BM-MSCs were established from whole bone marrow adherent cell culture, cryopreserved in liquid nitrogen in our laboratory, and used as subjective cells for reprogramming. The characteristics of BM-MSCs were determined as previously described [16]. BM-MSCs were grown at a density of 10⁵ cells per 10 cm² in Dulbecco's Modified Eagle Medium (DMEM; Invitrogen) supplemented with 10% fetal bovine serum (FBS), 100 U/ml of penicillin and 100 μg/ml of streptomycin. Cells were cultured at 37°C in a humidified atmosphere of 5% CO2, and the medium was changed every two days. BM-MSCs were split with 0.25% trypsin/ethylene diaminetetracetic acid (trypsin-EDTA)(Haotian, Hangzhou, China) when they reached 90% confluence.

Establishment of OCT4 overexpression BM-MSCs and generation of putative iPS cells

The recombinant plasmid pcDNA3.1-OCT4 was prepared as previously described [16] and transfected into 2×10⁵ BM-MSCs using liposome transfection (Lipofectamine™ 2000, Invitrogen, USA), according to the manufacturer’s instructions. Consecutive transfections were performed to improve the transfection efficiency. Cultures were maintained at 37°C, and 5% of CO₂ with daily medium changes. Stable OCT4 expression was selected with continuous geneticin (500 ng/ml) (G418 Sulfate, Sangon, Shanghai) resistance screening and consecutive single-cell subcloning. Individual cells were isolated from G418-resistant colonies. The expression of OCT4 in G418-resistant stable clones was verified using flow cytometry (FCM), cellular immunofluorescence assay (CIFA), and RT-PCR.

Selected colonies were then cultured with ES medium 2 (additives and their final concentrations of the medium are shown in Table 1) for one week. This was followed by further culture in ES medium 1 (detailed additives and their final concentrations of the medium are shown in Table 1) in 0.1% gelatin-coated 6-well culture plates until putative iPS colonies formed. During the reprogramming process, colonies were observed daily with a inverted microscope (Olympus) and selected for further expansion culture based on cell morphology. The medium was replaced every alternate day. Colonies expanded for up to six passages were used for characterizing iPSC features. Pluripotency marker analysis was carried out as previously described [2, 7, 9]. Differentiation potential in vitro and in vivo analyses were performed as described in literature [2, 7, 9].

CIFA

For CIFA, cells were fixed with 4% paraformaldehyde at 26°C for 10 minutes. When nuclear proteins were detected, cells were permeabilized with 0.1% Triton X-100 (Sigma) for 8 min and then blocked with 4% normal goat serum (Boshide, Wuhan, China) for 30 min. Cells grown in 12-well plates were incubated with primary (rat) antibodies against human OCT4 (1:100 dilution, R&D), SSEA-4 (1:100, Millipore), TRA-1-60 (1:100, Millipore), and TRA-1-81 (1:100, Millipore) for 30 min. After washing with PBST (0.1% Tween-20 in PBS) thrice, cells were incubated with the secondary antibodies (FITC-conjugated goat anti-rat IgG and FITC-conjugated goat anti-rat IgM [KPL, 1:200 dilution])at 26 °C for 2 h. Nuclear counterstaining was then performed with 4’, 6’-Diamidino-2-phenyl indole (DAPI, Kaiji, China), and fluorescence signals were observed and imaged using a fluorescence microscope (Olympus) equipped with a camera.

RT-PCR analysis

Primer Premier 5 software was used to design the primer sets for reverse transcription PCR analysis of endogenous pluripotent genes and the three germ layer (endoderm, ectoderm, and mesoderm), as shown in Table 2. Total RNA was prepared using TRIzol^® Plus RNA Purification Kit (Invitrogen) according to the manufacturer’s protocol and used for cDNA synthesis. The cDNA was synthesized with M-MLV reverse transcriptase (Invitrogen). GAPDH was used as an internal control. Amplification was performed in a final volume of 50 μL, and the PCR reaction conditions were set as shown in Table 2. All reactions were repeated twice in triplicate using independently prepared cDNAs.

FCM analysis

Single cell suspensions were prepared for subsequent experiments. For detecting the expression of ESC surface markers, including stage-specific embryonic antigen 4 (SSEA-4), tumor-related antigen (TRA-1-60), and TRA-1-81 expression (all the above antibodies were purchased from Millipore), cells were stained at 4°C for 30 minutes with the above primary antibodies and then washed and stained with FITC-conjugated goat-anti-mouse IgG and IgM (GAM-FITC, Becton Dickinson). For nuclear protein detecting of OCT4, SOX2 and NANOG, intracellular staining was carried out, cells were fixed with 4% paraformaldehyde and then permeabilized with 0.1% Triton X-100 at 4°C for 30 minutes. After washing, cells were incubated with rat anti-human OCT3/4 (R&D Systems) primary antibody, SOX2-PE (Becton-Dickinson), and NANOG-PE (R&D Systems). Then, cells with OCT3/4 primary antibody staining were washed and incubated with FITC-conjugated goat anti-rat IgG (KPL, USA) at 4°C for 30 minutes under light protection. Hematopoietic surface markers were detected using the following antibodies: CD19PE, CD33-APC, CD41a-PE, CD61-PerCP, CD42a-FITC, CD10-FITC, CD14-FITC, HLA-DR, CD56-PE, CD34-PerCP, and CD45-FITC as detecting reagents, and mouse IgG1-PE, mouse IgG1-APC, IgG1-PerCP, and IgG1-FITC (all purchased from Becton Dickinson, San Jose, CA, USA) served as isotype controls to determine the autofluorescence background. Cells were analyzed using a FACSCalibur flow cytometer (Becton Dickinson, San Jose, CA, USA). The Cell Quest software (Becton Dickinson, USA) was used for data acquisition and analysis. Independent FCM experiments were performed at least twice.

EB formation by putative BM-MSCs derived iPSCs

For EB formation, BMSCs-iPSCs were dissociated into single-cell suspensions using Accutase^TM (Millipore), and then maintained in low-cluster 12-well plate (Nest) in the presence of EB formation medium (detailed components and additives are shown in Table 2) for at least one week in floating culture. The medium was changed every alternate day. The in vitro spontaneous differentiation of BMSC-iPSCs was performed based on EB formation according to the protocol reported by Yamanaka S et al. with some modifications in culture medium [2]. The cells were then harvested and analyzed for the expression levels of the three germ layer marker genes using RT-PCR..

Differentiation into CD34+ progenitor cells following growth factor treatment

The hematopoietic differentiation potential of putative iPSCs was evaluated under feeder-free condition, as previously described [7, 17]. To differentiate into CD34+ progenitor cells, the single-cell suspensions were transferred to a 12-well low-cluster plate and cultured in BM-MSCs medium with 20% FBS for seven days. The cells were divided into two groups to induce CD34+ progenitor cell formation. In the first group, cells were cultured in the hematopoietic differentiation medium 1 supplemented with six growth factors for 2-3 weeks. In the second group, cells were cultured in differentiation medium containing SCF (50 ng/ml) and Flt-3 ligand (50 ng/ml) for 7-10 days, then transferred to the hematopoietic differentiation medium 2 with the second set of seven growth factors for additional 2-3 weeks. The cells were then prepared for further characterization for CD34 and CD45 expression using FCM.

Alkaline phosphatase (ALP) staining and telomerase activity detection

ALP staining was performed using an Alkaline Phosphatase Kit (Millipore, USA) according to the manufacture’s instructions. Telomerase activity was verified with a TRAP_eze-RT Telomerase Detection Kit (Millipore, USA) according to the manufacturer’s instructions. Each sample of the latter was separated using TBE-based 10% polyacrylamide gel electrophoresis and the gel was stained with ethidium bromide.

Teratoma formation assay

One million putative iPSCs were harvested after Collagenase (Accutase^TM) digestion, washed with PBS, and resuspended in 200 μl ES medium. Then these cells were injected subcutaneously in nude mice. The presumed teratomas were excised 6-8 weeks after injection and histologiclly treated as previously described [7, 11]. These experiments were approved by the Institutional Animal Conservation and Utilization Committee (IACUC) of Zhejiang University. Putative teratomas were collected and fixed with 4% paraformaldehyde/PBS. Paraffin-embedded teratomas were stained with hematoxylin and eosin.

Data analysis

The data were analyzed using SAS 9.2 (SAS Institute Inc., Raleigh, NC, USA), and processed using Microsoft Excel. The expression levels of surface markers (CD19-PE, CD33-APC, CD41a-PE, CD61-PerCP, CD42a-FITC, CD10-FITC, CD14-FITC, HLA-DR, CD56, CD34, and CD45) and pluripotent transcript factors (TRA-1-60, OCT4, SOX2 and NANOG) were expressed as the mean ± standard deviation (SD). Analysis of variance was performed to compared the parameters and a P value < 0.05 was regarded statistically significant.

Introduction of OCT4 into BM-MSCs using plasmid transfection generated putative iPSCs

Previously cryopreserved culture-expanded BM-MSCs stably expressing OCT4(referred to as BM-MSCs-OCT4) were recovered and used for this study. To explore whether BM-MSCs with ectopic high expression of OCT4 could be reprogrammed into a pluripotent state, these cells were cultured in ES medium for several weeks to validate their ESC characteristics. BM-MSCs-OCT4 cells underwent a series of changes, including transformation from a fibroblast-like (Fig. 1A-a) to a round shape, culminating in the formation of colonies with typical ESC morphology on days 14–21 days of culture (Fig. 1A-b). Three colonies (G4, E7, and B2) resembling human ES or iPSCs were selected (G4, E7 and B2) and amplified for several generations prior to use in subsequent experiments.. hESC markers were verified using FCM, CIFA, RT-PCR, ALP activity and telomerase activity assays. ALP staining showed that the putative iPSCs exhibited a comparatively strong ALP activity (Fig. 1A-c-d). CIFA showed that putative iPS cells expressed ESC-specific surface antigens, including SSEA-4, TRA-1-60 and TRA-1-81 (Fig. 1B). The putative BMSC-iPSCs exhibited high telomerase activity, whereas the untransfected parental cells and the heat-treated cells were telomerase-negative (Fig. 1C). These cells also expressed the ESC-specific transcription factors including OCT4, NANOG and SOX2, which was confirmed by FCM (Fig. 1D) and RT-PCR (Fig. 1E).

EB formation and differentiation in vitro and in vivo

The pluripotency and differentiation characteristics of these putative iPSCs were further confirmed by performing EB formation, in vitro differentiation, and in vivo teratoma formation assays. Spheroid structures were formed by the putative BMSCs-iPSCs (Fig. 2A-b) after a week of suspension culture. Then these cells were transferred into serum-free medium for at least one week to induce spontaneous differentiation. The EBs-derived cells expressed marker genes of the three germ layers as shown by RT-PCR analysis, including ectoderm (TUBB3+), mesoderm (Brachyury+, TBX20+), and endoderm (SPARC+) genes at various differentiation time, including differentiation days 14 and 26 (Fig. 2B-2C). The results showed that the mesoderm gene Brachyury appeared slightly later in the second cocktail growth factor culture than it did in the first(Fig. 2B).

Putative iPS cells were subcutaneously injected into dorsum of the nude mice. At 6–8 weeks after the injection, half of the mice (3/6) showed putative teratoma formation (Fig. 3A-a). However, immunohistochemical analysis did not demonstrate the representative tissues of three embryonic germ layers but rather the undifferentiated primitive cells (Fig. 3A-c-d). These cells were isolated from teratoma and further confirmed in in vitro culture. Only the ESC-specific transcription factor SOX2 was detected using FCM (Fig. 3B), while ectoderm genes, including ectoderm TUBB3+, Nestin + and WNT1 + were detected using RT-PCR (Fig. 3C).

Generation of CD34 + hematopoietic progenitor cells and dynamic analysis during hematopoietic cell differentiation

Defined cell culture conditions for CD34 + progenitor cell differentiation from putative iPSCs were used to evaluate the potential of these cells to differentiate into the hematopoietic lineage. EBs derived from BMSC-iPS cells were cultured in a medium supplemented with various hematopoietic cytokines as shown in Table 1. The result showed that the proportion of CD34 + progenitor cells in the first group increased from 0.93 ± 0.46% in untransfected parental BMSCs and 1.58 ± 1.29% in undifferentiated BMSC-iPS cells to 16.16 ± 1.27% and 25.40 ± 3.08% in BMSC-iPS cells at days 14 and 21, respectively (Fig. 4A). While the proportion of CD34 + progenitor cells was higher in the group with diverse concentrations of growth factor cocktails, in which it reached 31.39 ± 3.60% and 73.68 ± 6.63% in differentiated BMSC-iPS cells at days 14 and 21, respectively (Fig. 4B).

The expression of pluripotency markers at different induction times, including TRA-1-60, OCT4 and SOX2, in differentiated iPS cells was examined using FCM. The results showed decreased expression of TRA-1-60 and OCT4 during hematopoietic differentiation of the putative BMSC-iPSCs (Fig. 5A). Interestingly, the expressions of SOX2 and CD56 in the culture system containing the seven growth factors gradually increased, as showed by FCM results (Fig. 4C, Fig. 5B). The expression levels of other hematopoietic markers, including CD19, CD33, CD41a, CD61, CD42a, CD10, CD14 and HLA-DR are showed in Table 3. All markers except CD61 were not detected in the differentiated BMSC-iPS-like cells under the current differentiation system. The expression of CD61 was increased from 0.63 ± 0.37% in control parental MSCs to 11.06 ± 2.52% in differentiated cells. A hematopoietic colony-forming cell assay was carried out using these cells, and typical hematopoietic CFU colonies were not observed unfortunately (data not shown).

Human somatic cells can be reprogrammed into a pluripotent state by ectopic expression of several Yamanaka factors using various vectors. OriP/EBNA1 is a transient transfection system capable of continuously expressing reprogramming factors without the risk of random genomic integration. Induced neural stem cells have been successfully generated from adult human fibroblasts using a plasmid-based protocol [18]. Successful reprogramming of unfractionated blood- or UCB-derived MNCS into iPSCs using the plasmid description described above has also been reported [8, 11]. Moreover,the cell type of origin, with different proliferation potential and multipotency, contributes to the generation of iPSCs [3, 4]. In our previous study, BM-MSCs with ESC-like characteristics and stable ectopic OCT4 expression were established using a conventional plasmid vector [16]. Based on the above research findings and our results, we explored the possibility of iPSC generation from BM-MSCs by transfecting cells with a plasmid containing OCT4. Our results showed that BM-MSCs with ectopic high expression of OCT4 exhibited an altered morphology in ES medium during a two-week culture period, expressed pluripotent markers, and possessed the potential for EBs formation. However, the putative ESCs-like cells could not form teratomas in vivo, albeit their potential for differentiation into cells of the three germ layers, indicating that these cells were partly reprogrammed into iPSCs due to the down-regulation of the pluripotency markers including OCT4 and TRA-1-60. Moreover, cells isolated from putative teratoma expressed only the ESC-specific transcription factor SOX2 and the ectoderm genes, including TUBB3, Nestin and WNT1. Further research is needed to examine pluripotency and the partial reprogramming process presented in this study. However, many studies have showed that iPSCs can be obtained by expressing fewer Yamanaka factors from somatic cells endogenously expressing high levels of one or two reprogramming factors,, and that the reprogramming efficiency can be greatly improved by certain defined small-molecule compounds [13–15]. Results from the published literature confirmed the possibility of generating iPSCs with single transcription factor (OCT4) from multipotent cells such as BM-MSCs.

In this study, we evaluated the hematopoietic capacity of putative iPS cells. Interestingly, we found that partially reprogrammed iPSCs could be induced to differentiate into the CD34 + progenitor cells under defined culture condition,. and the proportion of CD34 + progenitor cells varied with the growth factor composition. Our results were inconsistent with other studies [6, 11]. He Huang et al. reported efficient commitment to functional CD34 + progenitor cells from hBM-MSCs-derived iPSCs by treatment with a growth factor cocktail containing mesodermal, hematopoietic, and endothelial inducers [19]. One possible explanation for this discrepancy is that the induction efficacy and cellular function of CD34 + progenitor cells from iPSCs differ to some extent depending on the differentiation schemes, cell derivation methods and cytokine composition. We found higher levels of CD34 + progenitor cells when cells were cultured with the second growth factor combination, composed of Flt3-ligand and SCF for 7–10 days followed by continuous culture in specific growth medium containing seven growth factors, compared with those of cells cultured with the first cytokine combination consisting of IL-3, IL-6, Flt-3 ligand, SCF, BMP4, and G-CSF.. One possible explanation for this phenomenon is that early acting hematopoietic signaling is favorable for CD34 + progenitor cell generation. Moreover, the expression of surface marker CD56 also increased in addition to that of CD34, following the gradual expression of SOX2. One possible explanation for this result is that the CD34 + CD56 + could be a type of stem cells, as showed in separated teratoma cells cultured in vitro, which highly expressed the pluripotency marker SOX2 gene. Maucksch et al. showed that overexpressing of SOX2 and PAX6 using plasmid transfection could reprogram fibroblasts into neural precursor-like cells [20], supporting our hypothesis. However, the mechanism underlying this phenomenon deserves further study.

OCT4 is considered a very important transcription factor, which participates not only in regulating the pluripotent state of ESCs but also in somatic cell reprogramming.. It has been demonstrated that the other two transcription factors NANOG and SOX2, as well as OCT4, also played an equally crucial role in maintaining the pluripotency of ESCs [21, 22]. Our study showed that the expression levels of SOX2 and NANOG were downregulated and decreased during the differentiation process. These results indicate that OCT4, SOX2 and NANOG cooperate and interact with each other to maintain the pluripotency of putative iPSCs [23]. Our results indicate, to some extent, transient ectopic expression of the transcript factor OCT4 could initiate endogenous pluripotent marker expression and prompt the multipotent BM-MSCs to transit into a pluripotent state [18]. However, the underlying mechanism related to the pluripotency maintenance need to be studied further.

The limitations of this study include aree as follows: first, the underlying molecular mechanisms of partially reprogrammed iPSCs have not been clearly investigated and warrant further intensive study. Second, efficient commitment to functional CD34 + progenitor cells from putative iPSCs should be performed to confirm the hematopoietic differentiation potential. Last, but not least, the function of the proportion of CD34+/CD56 + cells remains to be determined and is worthy of in-depth study.

In this study, putative iPSCs (or partly reprogrammed iPSCs) were generated from BM-MSCs via high ectopic expression of OCT4 using plasmid transfection. The putative iPSCs display the unique growth pattern and morphology of iPSCs when they are maintained in undifferentiated pluripotent state. They express ESC-specific pluripotent markers and were capable of differentiation into the three germ layers in vitro. Moreover, the putative iPSCs could be induced to differentiate into hematopoietic progenitor cells in predefined culture system containing a cocktail with seven growth factors. Our findings provide a feasible approach to establish hematopoietic progenitor cells using patient-specific iPSCs generated using plasmid transfection for hematological disease modeling. Autologous grafts may be generated with further development of this culture system.

MSCs, mesenchymal stromal cells; iP-HSCs, induced pluripotent hematopoietic stem cells; iPSCs, induced pluripotent stem cells; HSCT, hematopoietic stem cell transplantation; BM-MSCs, bone marrow-derived MSCs; hESCs, human embryonic stem cells; UCB, umbilical cord blood; MNCs, mononuclear cells; FCM, flow cytometry; CIFA, cellular immunofluorescence assay; DMEM, Dulbecco's Modified Eagle Medium; FBS, fetal bovine serum; EDTA, ethylene diaminetetracetic acid; KSR, knockout serum replacement; NEEA, non-essential amino acids; bFGF, basic fibroblast growth factor; EB, embryoid body;

Ethics approval and consent to participate

The ethics approval was required according to the guidelines from the Children’s Hospital of Zhejiang University School of Medicine Committee on the Use of Human Subjects in Research. All the procedures described in this report have been approved by the Children’s Hospital of Zhejiang University IRB. (Approval number: 2021-IRBAL-045; Approval date: 2021-02-09). All animal procedures described in this report have been approved by Zhejiang University’s Institutional Animal Conservation and Utilization Committee (IACUC).

Consent for publication

Not applicable.

Availability of data and materials

The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.

Conflict of interests

No potential conflict of interests to declare.

Funding

This work was partly supported by the grants from National Natural Science Foundation of China (Nos: 30971283, 81770202, 81470304), Key R & D Projects of Zhejiang Provincial Science and Technology Department (No: 2019C03032), Natural Science Foundation of Zhejiang Province (No: LY20H080007), and Pediatric Leukemia Diagnostic and Therapeutic Technology Research Center of Zhejiang Province (No. JBZX-201904).

Author Contributions

Xiaoping Guo designed and carried out the experimental study, and drafted the manuscript. Diandian Ba performed partial experiment and animal model construction. Sisi Li provided the technical assistance and performed some of FCM and participated in its data analysis. Wenwen Weng participated in BM-MSCs culture and PDT analysis. Jin Pan performed the statistical analysis and analyzed the data. Yanfei Chen, Lisa Cai and Xiaojun Xu contributed reagents and analysis tools. Yongmin Tang is the correspondence author and has conceived the idea, designed the study, edited the manuscript and takes the full responsibility for the study. All authors read and approved the final manuscript.

Acknowledgement

We would like to thank Ping Chen, Ning Zhao and Hongqiang Shen in Hematology-oncology laboratory and Weizhong Gu in the Pathology Department for their excellent technical support.

Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 2006 Aug 25;126(4):663–76. PubMed PMID: 16904174.
Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 2007 Nov 30;131(5):861–72. PubMed PMID: 18035408.
Dannenmann B, Klimiankou M, Oswald B, Solovyeva A, Mardan J, Nasri M, et al. iPSC modeling of stage-specific leukemogenesis reveals BAALC as a key oncogene in severe congenital neutropenia. Cell Stem Cell. 2021 May 6;28(5):906–922.e6. PMID: 33894142.
Sabitha KR, Shetty AK, Upadhya D. Patient-derived iPSC modeling of rare neurodevelopmental disorders: Molecular pathophysiology and prospective therapies. Neurosci Biobehav Rev. 2021 Feb;121:201–19. PMID: 33370574.
Maza I, Caspi I, Zviran A, Chomsky E, Rais Y, Viukov S, et al. Transient acquisition of pluripotency during somatic cell transdifferentiation with iPSC reprogramming factors. Nat Biotechnol. 2015 Jul;33(7):769–74. PMID: 26098448.
Xu M, Shaw G, Murphy M, Barry F. Induced Pluripotent Stem Cell-Derived Mesenchymal Stromal Cells Are Functionally and Genetically Different From Bone Marrow-Derived Mesenchymal Stromal Cells. Stem Cells. 2019 Jun;37(6):754–65. PMID: 30779868.
Choi NY, Lee Y, Park YS, Ko K, Park B, Koh YG. Establishment of an integration-free human induced pluripotent stem cell line (TJCi001-A) from normal bone marrow-derived mesenchymal stem cells. Stem Cell Res. 2021 Aug;55:102484. PMID: 34371346.
Okumura T, Horie Y, Lai CY, Lin HT, Shoda H, Natsumoto B, et al. Robust and highly efficient hiPSC generation from patient non-mobilized peripheral blood-derived CD34 + cells using the auto-erasable Sendai virus vector. Stem Cell Res Ther. 2019 Jun 24;10(1):185. PMID: 31234949.
Bakopoulou A, Apatzidou D, Aggelidou E, Gousopoulou E, Leyhausen G, Volk J, et al. Isolation and prolonged expansion of oral mesenchymal stem cells under clinical-grade, GMP-compliant conditions differentially affects "stemness" properties. Stem Cell Res Ther. 2017 Nov 2;8(1):247. PMID: 29096714.
Menon S, Shailendra S, Renda A, Longaker M, Quarto N. An Overview of Direct Somatic Reprogramming: The Ins and Outs of iPSCs. International journal of molecular sciences. 2016 Jan 21;17(1). PMID: 26805822.
Dowey SN, Huang X, Chou BK, Ye Z, Cheng L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 2012 Nov;7(11):2013–21. PubMed PMID: 23080273.
Maza I, Caspi I, Zviran A, Chomsky E, Rais Y, Viukov S, et al. Transient acquisition of pluripotency during somatic cell transdifferentiation with iPSC reprogramming factors. Nat Biotechnol. 2015 Jul;33(7):769–74. PMID: 26098448.
Kim JB, Sebastiano V, Wu G, Arauzo-Bravo MJ, Sasse P, Gentile L, et al. Oct4-induced pluripotency in adult neural stem cells. Cell. 2009 Feb 6;136(3):411-9. PubMed PMID: 19203577.
Kim JB, Greber B, Arauzo-Bravo MJ, Meyer J, Park KI, Zaehres H, et al. Direct reprogramming of human neural stem cells by OCT4. Nature. 2009 Oct 1;461(7264):649-3. PubMed PMID: 19718018.
Liu P, Chen M, Liu Y, Qi LS, Ding S. CRISPR-Based Chromatin Remodeling of the Endogenous Oct4 or Sox2 Locus Enables Reprogramming to Pluripotency. Cell stem cell. 2018 Feb 1;22(2):252 – 61 e4. PubMed PMID: 29358044.
Guo X, Tang Y, Zhang P, Li S, Chen Y, Qian B, et al. Effect of ectopic high expression of transcription factor OCT4 on the "stemness" characteristics of human bone marrow-derived mesenchymal stromal cells. Stem cell research & therapy. 2019 Jun 3;10(1):160. PubMed PMID: 31159871.
Tursky ML, Loi TH, Artuz CM, Alateeq S, Wolvetang EJ, Tao H, et al. Direct Comparison of Four Hematopoietic Differentiation Methods from Human Induced Pluripotent Stem Cells. Stem Cell Reports. 2020 Sep 8;15(3):735–748. PMID: 32763163.
Capetian P, Azmitia L, Pauly MG, Krajka V, Stengel F, Bernhardi EM, et al. Plasmid-Based Generation of Induced Neural Stem Cells from Adult Human Fibroblasts. Front Cell Neurosci. 2016;10:245. PubMed PMID: 27822179.
Xu Y, Liu L, Zhang L, Fu S, Hu Y, Wang Y, et al. Efficient commitment to functional CD34 + progenitor cells from human bone marrow mesenchymal stem-cell-derived induced pluripotent stem cells. PLoS ONE. 2012;7(4):e34321. PubMed PMID: 22496789.
Maucksch C, Firmin E, Butler-Munro C, Montgomery J, Dottori M, Connor B. Non-Viral Generation of Neural Precursor-like Cells from Adult Human Fibroblasts. J stem cells regenerative Med. 2012;8(3):162–70. PubMed PMID: 24693194.
Zhou H, Martinez H, Sun B, Li A, Zimmer M, Katsanis N, et al. Rapid and Efficient Generation of Transgene-Free iPSC from a Small Volume of Cryopreserved Blood. Stem cell reviews and reports. 2015 Aug;11(4):652–65. PubMed PMID: 25951995.
Huang CE, Hu FW, Yu CH, Tsai LL, Lee TH, Chou MY, et al. Concurrent expression of Oct4 and Nanog maintains mesenchymal stem-like property of human dental pulp cells. International journal of molecular sciences. 2014 Oct 15;15(10):18623-39. PubMed PMID: 25322154.
Guo XP, Tang YM. Effect of OCT4 Gene Expression Upregulation on the Expression of iPSC-related Transcription Factors in Human Bone Marrow Derived Mesenchymal Stem Cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 2020;28(4):1086–95. PMID: 32798382.

Table 1 Mediums and their components used in various cells cultures

	ES medium 1	ES medium 2	MSC medium	EB medium	Hematopoietic differentiation medium 1	Hematopoietic differentiation medium 2
DMEM/F12 (%)	80%	80%	/	/	/	/
DMEM (%)	/	/	90%	80%	80%	80%
L-glutamine	2mM	2mM	2mM	0.2mM	/	/
β-mercaptoethanol	0.1mM	0.1mM	/	0.1mM	/	/
NEAA	2mM	2mM	/	1%	/	/
FBS (%)	/	10%	10%	20%	20%	20%
KSR (%)	20%	10%	/	/	/	/
Penicillin	100 U/ml	100 U/ml	100 U/ml	100 U/ml	100 U/ml	100 U/ml
streptomycin	100 μg/ml	100 μg/ml	100 μg/ml	100 μg/ml	100 μg/ml	100 μg/ml
bFGF	4ng/ml	/	/	/	/	/
IL-3	/	/	/	/	10 ng/ml	10 ng/ml
IL-6	/	/	/	/	10 ng/ml	10 ng/ml
Flt-ligand	/	/	/	/	300ng/ml	50 ng/ml (7-10d) 100 ng/ml (2-3W)
SCF	/	/	/	/	300ng/ml	50 ng/ml (7-10d) 100 ng/ml (2-3W)
G-CSF	/	/	/	/	50 ng/ml	50 ng/ml
BMP4	/	/	/	/	50 ng/ml	50 ng/ml
GM-CSF	/	/	/	/	/	50 ng/ml

Table 2 Primers (for TFs and ectoderm, endoderm, mesoderm Genes )by RT-PCR and reaction conditions

Initial

denaturation

(°C)

35 cycles

Final

Extension

(°C)

Genes

Primer Sequences (5’-3’)

Products (bp)

Denaturation (°C)

Time (s)

Annealing (°C)

Time (s)

Extension (°C)

Time (s)

GAPDH

For: GAAGGTGAAGGTCGGAGTC

Rev: GAAGATGGTGATGGGATTTC

226

94 °C

5 min

94 °C

30 s

60 °C

50 s

72 °C

30 s

72 °C

10 min

OCT4-Ⅰ

OCT4-Ⅱ

For: CGGGCTGATGGGCAAGTT

Rev: GGGCAGGAAGGATGGGTAA

For: CGCAAGCCCTCATTTCAC

Rev: GGCAGGCACCTCAGTTTG

247

1 143

94 °C

5 min

94 °C

5 min

94°C

30 s

94°C

30 s

60 °C

50 s

62 °C

50 s

72 °C

30 s

72 °C

90 s

72 °C

10 min

72 °C

10 min

NANOG

For: CAAAGGCAAACAACCCACTT

Rev: CTGGATGTTCTGG GTCTGGT

426

94 °C

5 min

94°C

30 s

60 °C

50 s

72 °C

30 s

72 °C

10 min

SPARC

For: CCTGATGAGACAGAGGTGGTGG

Rev: GCTTGTGGCCCTTCTTGGTG

349

94 °C

5 min

94°C

30 s

60 °C

50 s

72 °C

30 s

72 °C

10 min

TBX20

For: AAGGAGGCGACGGAGAACA

Rev: TCCTGCCCGACTTGGTGAT

289

94 °C

5 min

94°C

30 s

60 °C

50 s

72 °C

30 s

72 °C

10 min

TUBB3

For: AGCTCAACGCTGACCTGC

Rev: GCCTCGGTGAACTCCATCT

499

94 °C

5 min

94°C

30 s

60 °C

50 s

72 °C

30 s

72 °C

10 min

WNT1

For: CCGATGGTGGGGTATTGTG

Rev: TCATGAGGAAGCGCAGGTC

500

94 °C

5 min

94°C

30 s

60 °C

50 s

72 °C

30 s

72 °C

10 min

Brachyury

For: AAGAACGGCAGGAGGATG

Rev: TCTCAGGGAAGCAGTGGC

373

94 °C

5 min

94°C

30 s

60 °C

50 s

72 °C

30 s

72 °C

10 min

C-MYC

For: CAGCCCACTGGTCCTCAA

Rev: TTTCCGCAACAAGTCCTC

391

94 °C

5 min

94°C

30 s

60 °C

50 s

72 °C

30 s

72 °C

10 min

KLF4

For: CGGGCTGATGGGCAAGTT

Rev: GGGCAGGAAGGATGGGTAA

391

94 °C

5 min

94°C

30 s

60 °C

50 s

72 °C

30 s

72 °C

10 min

LIN28

For: GTTCGGCTTCCTGTCCAT

Rev: ACTCCACTGCCTCACCCT

397

94 °C

5 min

94°C

30 s

60 °C

50 s

72 °C

30 s

72 °C

10 min

SOX2

For: GAATTCATGTACAACATGATGGAGACGG

Rev: CTCGAGTCACATGTGTGAGAGGGGCAGTG

966

94 °C

5 min

94°C

30 s

60 °C

50 s

72°C

60 s

72 °C

10 min

Table 3 Hematopoietic markers expression of MSCs and MSCs-OCT4 (%)

Surface marker (%)	Con MSCs	MSCs-OCT4
CD45	1.06±0.68	16.62±1.68
CD19	1.54±0.74	0.83±0.24
CD14	0.75±0.43	3.08±1.08
HLA-DR	1.22±0.15	1.55±1.08
CD41a	0.78±0.49	0.66±0.70
CD61	0.63±0.37	11.06±2.52
CD42	1.13±0.94	2.28±1.52
CD10	2.37±1.20	2.32±0.91
CD33	1.97±1.41	1.42±1.17

Introduction of OCT4 into human bone-marrow derived mesenchymal stromal cells generates putative iPS cells with the potential to differentiate into CD34+ hematopoietic progenitor cells ex vivo

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Materials And Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Tables

Status:

Version 1