Animals
Forty-eight adult male Sprague Dawley (SD) rats (250-300 g; certificate No.: SCXK Lu 2014-0007) were provided by Lukang Pharmacy (Linyi, China). The rats were kept in a controlled environment at a constant temperature of 25±1˚C and a humidity of 50%±10%. All the animals were free access to food and water on a 12h/12 h light/dark cycle for at least 21 days under standard conditions before any treatment.
MCAO construction
MCAO was established according to Zea-Longa’s method, with slight modifications [7]. In brief, the rats were intraperitoneally anesthetized with 4% chloral hydrate (0.7 ml/100 g). Then the anterior cervical tissues were cut longitudinally to expose the right common carotid artery (CCA), external carotid artery (ECA) and internal carotid artery (ICA). A small incision was made at a position that was about 4 mm from the CCA branch, and then a line was inserted into the blood vessel at a depth of 18 mm.
Experimental design
The rats were randomly divided into sham-operation group (n=24) and the MCAO model group (n=24), according to the random number table method. The rats in the sham-operation group were given a ligation of right carotid artery without inserting the line. In the model group, MCAO induction was conducted on day 1. BDA injection was performed in both groups on day 7, together with behavioral tests on day 7, 14 and 21, respectively. Animals were sacrificed on day 7, 14 and 21, followed by sample collection for the subsequent tests, including immunohistochemistry, Western blot analysis, and Real-Time PCR.
Neurobehavioral Evaluation
Behavioral testing was performed by experienced investigators blinded to the experimental groups. The performance of animals in behavioral tests was assessed during the light portion of the light-dark cycle. The methods for each behavioral test are listed as follows.
The beam walking test
To evaluate the motor function of rats, the beam walking test (BWT) was conducted on day 7, 14 and 21 according to the previous description [8]. Briefly, rats were placed on a beam with a size of 122 cm×2.5 cm×75.5 cm, and were trained to walk along the beam to reach the opposite side of the beam for three trials about 3 days before the experiment [9]. A 0 to 7-point scale modified from Goldstein method [10] was utilized to evaluate the locomotor function of the animals.
The modified grip-traction test
The rats were required to grasp a plastic tube placed in an horizontal direction (0.6 cm in diameter) with their forward claws. The tube was about 45 cm above a desk. Then we determined the muscle strength and recorded the time for falling.
The rotarod test
Three days before MCAO induction, the rats were trained on a rotated bar (4-35 rotation per min). All the animals were trained for 3 days, with a frequency of 3 times per day lasting for 5 min, respectively. Then we recorded the time of animals with no falling when walking on the rotated bar. The time interval for the test was 15 min. The averaged value was obtained after two tests.
Anterograde corticospinal tract tracing
Biotinylated dextan amine (BDA, 0.2 µl) was injected to 4 sites. For the selection of injection sites, two sites were fixed in the position that was about 1 mm and 2 mm from the anterior and posterior bregma, while two sites were fixed in the position that was about 3.5 mm and 4 mm to the lateral bregma. After deep anesthesia, the rats were positioned on a stereotaxic apparatus via a finely drawn glass capillary on day 7. For each site, the BDA was injected at a depth of 1.5 mm, and the needles were dwelled for 2 min after injection.
Two weeks after BDA injection, rats were anesthetized and sacrificed for the subsequent analysis. Cervical spinal cord tissues obtained from C4-C6 segments were fixed by 4% paraformaldehyde overnight, followed by dehydration in sucrose with a concentration of 10%, 20% and 30%, respectively. The tissues were then embedded by paraffin, and the sections (7 µm) were placed in 0.5% H2O2 for 15 min, followed by washing three times with tris-buffered saline (TBS) solution. Subsequently, the sections were incubated in TBS containing 0.3% Trition X-100 at 4˚C for 6 h, and then were incubated overnight with HRP. The sections were presented in DAB solution for 15 min and were attached to the antistripping slide. Finally, the images were observed by light microscope.
Quantitative Real-Time PCR
Total RNA was extracted from the tissues of the left cervical spinal cords using TRIzol reagent (Thermo Fisher Scientific, CA, USA). The cDNA synthesis was carried out using the Transcriptor First-Strand cDNA Synthesis kit (Roche Diagnostics, Basel, Switzerland). Quantitative PCR was performed using 2 × SYBR Green qPCR Mix (Aid lab Biotech, Beijing, China). PCR amplification was performed using a Real-Time PCR System (Agilent Tech, CA, USA) using the following specific primers: β‑actin, 5'-GCCTTCCTTCCTGGGTATGG-3', 5'‑ACGCAGCTCAGTAACAGTCC‑3'; GAP-43, 5'‑ACCACTGATAACTCGCCGTC‑3', 5'‑CTACAGCTTCTTTCTCCTCCTC‑3'. The amplification conditions were as follows: denaturation at 94˚C for 5 min, 42 cycles at 95˚C for 10 sec, 58˚C for 30 sec, and 72˚C for 30 sec. The amplification results were evaluated using the ΔΔCq method as previously described [11].
Western blot analysis
Protein was extracted from the left cervical spinal cord homogenized in RIPA lysis buffer. The protein concentration was evaluated based on BCA method, followed by separation by 10% SDS–PAGE gels. Afterwards, proteins were transferred onto polyvinylidene difluoride membranes under 80 V for 30min and 100V for 2 h. The membranes were blocked with 5% non-fat dry milk for 1 h and incubated at 4˚C overnight with primary rabbit anti-GAP-43 (1:20,000, Abcam, UK). Then the membranes were incubated with secondary antibody, goat anti-rabbit IgA (1:3,000, Bioss, Beijing, China), for 1 h at room temperature. The beta-actin served as the internal standard. Finally, the band gray values were analyzed via the application of Bio1D software.
Immunofluorescence
Cervical spinal cord tissue sections (6 μm) were soaked in acetone for 15 min and were incubated with 10% goat serum (0.01 mmol/L) at room temperature for 1 h. The slices were incubated with primary antibody overnight at 4˚ C, including mouse anti-Slit1 (1: 100, Abcam), rabbit anti-Slit2 (1: 100, Abcam), and rabbit anti-Robo1 (1: 10, Abcam). Upon washing with PBS, the slices were incubated with secondary antibodies at room temperature for 2 h, including Alexa Fluor488-conjugated goat anti-rabbit IgG (1:400; H&L, ab150077), Alexa Fluor 555-conjugated goat anti-mouse IgG (1:400; H&L, ab150114). DAPI solution (1:500) was added to the slices. After fluorescence quenching, the images were observed under a fluorescence microscope (ZEISS 780).
Statistical analysis
SPSS 18.0 (SPSS, Chicago, USA) was utilized for the data analysis. All the data were expressed as mean ± standard error of mean. Student’s t-test or the Mann–Whitney test was used for the comparison of measurement data between the two groups. P < 0.05 was statistically significant.