Animals
all the experimental animals used in this study were provided by the Animal Experimental Center of Guizhou Medical University: A total of 20 young New Zealand white rabbits (2.0 ± 0.5 kg). All animals are approved by the Experimental Animal Bioethics Committee of Guizhou Medical University (Grant No.1900590), and all procedures are carried out in strict accordance with the guidelines for the Care and use of Experimental Animals issued by the National Institutes of Health (NIH publication No. 85-23, 1996 revised).
Cell culture
The rabbits were fixed on the operating table of small animals in the supine position, and routinely disinfected and laid towels. The distal femur and proximal tibia of rabbits were anesthetized with 2% lidocaine hydrochloride (ShandongHualuPharmaceuticalCo.,Ltd.,China), and then punctured. The bone marrow solution was extracted from 4-5 mL, and then the cells were separated by density gradient centrifugation【36,37】. The complete L-DMEM (Gibco,USA) medium containing 10%FBS (Gibco,USA) and 1% double antibody (Hyclon,USA) was inoculated in the 25cm2 culture bottle (Corning,USA) and cultured at 37 ℃ in the 5%CO2 incubator (Thermo,USA). After that, the complete medium was changed every 3 days, and when the confluence of the cells at the bottom of the culture bottle reached more than 90%, the BMSCs began to be digested and passaged at 1:3.
Mitochondrial extraction
The treated BMSCs was washed with PBS, the cells were digested by trypsin, and the cells were collected and counted. 5×107 cells were extracted and added to 1.0mL ice-precooled PBS resuspended cells. The cell suspension was transferred into a small volume glass homogenizer and grinded in an ice bath at 0 ℃ for 30 times to obtain cell homogenate. Isolation and extraction of mitochondria according to the steps of the cell mitochondria separation kit (Beytime,China), and the mitochondrial precipitation was resuscitated with 50-100 μL Store Buffer or suitable reaction buffer, and then used immediately or stored at -70 ℃.
BMSCs surface antigen identification
The third generation of rabbit BMSCs, was digested and centrifuged to adjust the cell concentration to make 2.0×107 cells/mL single cell suspension. 50μL cell suspension was taken into the flow tube (Corning,USA) and added with Anti-CD29/AF647, Anti-CD90/PE-CyTM7, Anti-CD106/PE, Anti-CD45/FITC and Anti-CD11b/V450 (BD,USA), respectively. Buffer (Hyclon,USA) was used as negative control, and the supernatant was centrifuged to remove the supernatant after incubation at room temperature for 30 min, 1000 rpm/min and 5 min. Each tube was washed with buffer twice, and then 500uLbuffer resuspension cells were added to each tube and detected by flow cytometry (Beckman,USA).
BMSCs multidirectional differentiation induction
The third generation of rabbit BMSCs, with good growth was selected and the cell concentration was adjusted to 2.0×104 cells/cm2, according to osteogenic, adipogenic and chondrogenic induction differentiation kit (CyagenBiosciencesSuzhouInc.,China). The cells were inoculated on a 6-well plate with 2ml per well. When the cell convergence degree reached 60%,100% and 60% respectively, the experimental group changed the induced differentiation medium respectively, while the control group continued to use complete L-DMEM medium. The operation is carried out according to the instructions of each induction kit. After the induction is completed, the culture medium is absorbed, washed twice with PBS (Hyclon,USA), 4% paraformaldehyde (BeijingLeageneBiotech.Co.,Ltd.,China) of 1mL is added to each well, fixed at room temperature for 30 minutes, and each well is washed twice with PBS buffer, according to the staining instructions of each kit, Alizarin red staining solution, oil red O staining solution and alisin blue staining solution were used for staining (CyagenBiosciencesSuzhouInc.,China), and observed and photographed under inverted microscope.
Lentivirus infection
The third generation of rabbit BMSCs, were divided into three groups according to the transfection conditions: group A (BMSCs), group B (BMSCs+Lv-EGFP) and group C (BMSCs+Lv-NMNAT3-EGFP). Lentivirus transfection (ShanghaiHengYuanBiologicalTechnologyCo.,Ltd.,China) (MOI=100) was performed for 12 hours according to the experimental group【37】. After 3 days, the expression of green fluorescent protein was observed by inverted fluorescence microscope and the transfection efficiency was calculated. After 5 days of transfection, the culture medium containing puromycin (Solarbio,Beijing,China) (2ug/mL) was added for screening. After all the cells in the control group died, the concentration of puromycin was halved (1ug/mL) to obtain stable strains.
Real-time RT-PCR
Isolation and extraction of total RNA from cells using Trizol(Invitrogen,USA),take 10 μL of total RNA for reverse transcription using RevertAid™ 1st-strand cDNA Synthesis Kit (SangonBiotech,China). The reaction parameters were as follows: 65 ℃, 5 min; 42 ℃, 30 min; 70 ℃, 10 min. 1 μL reverse transcriptional product cDNA was used for real-time fluorescence quantitative PCR, cycle parameters: 95 ℃, 3 min; 95 ℃, 3 min; 60 ℃, 30 s; 40 cycles. At the same time of determining the target gene, the endogenous butler gene (β-actin) , was determined with the internal reference as the comparative standard. Using the comparative threshold method: the relative expression quantity of the target gene =2-△△ Ct, was converted into the relative quantitative relationship of the initial template number of the sample.Rabbit primers (Sangon Biotech) were as follows: NMNAT3-F: CCCGTCAATGACAGCTACAGGAAG; NMNAT3-R: AGCACCTTCACCGTCTCCATCC; β-actin-F: TCCCTGGAGAAGAGCTACGA; β-actin: GTACAGGT CCTTGCGGATGT.
Immunoblot and Immunoprecipitation
The total protein of each group was extracted by cell lysis, and the protein concentration of each group was determined by BCA method. After adjusting the protein concentration, the protein was boiled and denatured, and then electrophoretic, membrane transfer and sealing were carried out in turn. Than the target first antibody (Anti-NMNAT3、Anti-PGC-1α、Anti-NRF1、Anti-Sirt3、Anti-IDH2、Anti-FOXO3a) (diluted by 1: 300) and internal reference antibody (Anti-β-actin、Anti-COX IV) (diluted by 1: 7500) were added respectively and incubated overnight at 4 ℃. The TBST film was washed for 3 times, then incubated at room temperature with secondary antibody (diluted by 1: 7500) for 1h, and then washed for 3 times. Finally, the film was exposed by Fusion Fx exposure machine. β-actin and COX IV were used as an internal reference protein, and the relative expression of the target protein was calculated according to the gray value of protein band/β-actin(or COX IV) protein band gray value. For co-immunoprecipitation, the cell protein was also extracted by lysate and quantified by BCA method, then the protein was added to ProteinA/G agarose beads and incubated at 4 ℃ for 2 hours, and the supernatant was obtained by 2500rpm centrifugation for 3min at 4 ℃, and the corresponding antibody was put in the refrigerator at 4 ℃ and slowly rotated to incubate overnight. The next day, ProteinA/G agarose beads were slowly incubated at 4 ℃ for 3h, 2500rpm centrifugation for 3 minutes, and the precipitate was slowly washed for 3 times. For the last time, carefully absorb the supernatant and add the sample buffer to the precipitation to mix well; boil at 95 ℃ for 5min and centrifuge at 12000rpm for 1min; Western Blot detection was carried out according to the above method.
Cellular oxidative stress
After the stable strain of BMSCs overexpressing NMNAT3 gene was obtained, according to the experimental group, each group was treated with H2O2 with a concentration of 600μM BMSCs for 24 hours【35】, and the control group continued to be cultured in complete L-DMEM medium.
Observation of mitochondrial ultrastructure with electron microscope
After the BMSCs treatment of each group, routine digestion and centrifugation, EP tube to collect cells, add 3% glutaraldehyde to fix, then dehydration, osmosis, entrapment and other treatments, and make ultra-thin sections, electron staining, transmission electron microscopy to observe the ultrastructural changes of mitochondria, and select a typical visual field to take pictures.
JC-1 staining
According to the instructions of JC-1 mitochondrial membrane potential detection kit, the treated cells were incubated with dye mixture at 37 ℃ for 30 minutes and washed gently for 3 times. the cells were observed under laser confocal microscope and recorded by random typical visual field. The red / green fluorescence ratio was calculated by Image software.
NAD+ content detection
According to the experimental group, the well-growing BMSCs was taken for routine digestion, the cells were suspended in the complete culture medium, the appropriate cell concentration was adjusted, and the cells were inoculated in 96-well plate to continue culture. after the cell growth density met the requirements, the operation was carried out according to the instructions of NAD+ detection kit. After the cells of each group were treated, the standard curve was drawn by enzyme labeling instrument, and the absorbance at 520nm wavelength of each group was recorded and calculated.
ATP levels detection
According to the experimental group, the well-growing BMSCs was taken for routine digestion, the cells were suspended in the complete culture medium, the appropriate cell concentration was adjusted, and the cells were inoculated in 96-well plate to continue culture. after the cell growth density met the requirements, the operation was carried out according to the instructions of ATP detection kit. After the cells of each group were treated, the standard curve was drawn by enzyme labeling instrument, and the absorbance at 532nm wavelength of each group was recorded and calculated.
DCFH-DA staining
After the third generation of BMSCs was digested and centrifuged, the cell density was adjusted to 2.5×104/ mL,1mL/ dish and cultured in confocal petri dish, and then treated according to the conditions of each group. Finally, the cells in each group were treated strictly in accordance with the instructions of the ROS detection kit, the red fluorescence channel was detected under confocal microscope, and the pictures were collected.
MDA content detection
The third generation of BMSCs was digested and centrifuged and inoculated in 96-well plates with 2.5×103 cells per well. Then, according to the treatment conditions of each group, the cells were lysed with IP cell lysate, and the cell lysate was collected and centrifuged in EP tube to absorb the supernatant. Finally, strictly according to the instructions of the (MDA) determination kit, the absorbance value was measured and calculated at the 532nm wavelength by the enzyme labeling instrument.
β-gal staining
According to the experimental group, the cells were fixed at room temperature for 15 minutes, and the staining solution was prepared according to the cell senescence β-galactosidase staining kit. According to the instructions of the kit, after adding the working solution, the cells were cultured overnight at 37 ℃ and observed with an ordinary optical microscope.
Cell viability and proliferation
After routine trypsin digestion of BMSCs in each group, the complete culture medium was suspended and inoculated into 96-well plates according to (2.0-3.0) × 103/well. There were 4 multiple holes in each group, a total of 8 plates, and continued culture in 37 ℃ and 5%CO2 incubator. After that, one plate was taken at the fixed time every day according to the operation instructions of CCK-8 kit. After the cells of each group were treated, the absorbance (OD value) of each group at 450nm was measured by enzyme labeling instrument, and continuously monitored for 8 days. The cell growth curve of each group was drawn with the cell culture days as the horizontal axis and the average absorbance value of each group as the vertical axis.
TUNNEL/DAPI detection of apoptosis
According to the experimental group, the treated cells were digested and centrifuged, and the cell density was adjusted to 2.5×104 / mL,1mL/ dish, then inoculated in confocal petri dish, and then treated according to each treatment condition. Finally, the cells of each group were treated strictly in accordance with the instructions of TUNEL and DAPI detection kit, observed under confocal microscope, and the pictures were collected.
Statistical analysis
All statistical data were calculated and graphed using GraphPad Prism software version 6 (GraphPad Software, San Diego, California, USA). All numerical data are expressed as mean ± standard deviation (SD) (±SD). Statistical significance was evaluated using paired two-tailed Student's t-test. Differences were considered significant at p<0.05.