Clinical samples
54 MM patients were enrolled at the Department of Hematology, The Second Affiliated Hospital of Xi 'an Jiaotong University from April 2017 to June 2020. The demographic characteristics of the MM patients are summarized in Table 1. Patients who were diagnosed with MM for the first time and with no prior treatment history associated with cancer were included. Patients who received prolonged chemotherapy were excluded. In addition, patients with complicated chronic disease, pregnant or lactating women, and children were also excluded. All bone marrow samples were collected and immediately frozen in -80 refrigerator for further examination. The present study was approved by the Institutional Review Borad of Xi 'an Jiaotong University and performed in accordance with the Declaration of Helsinki. All patients provided written informed consent. The collected bone marrow samples were used to measure circXPO1 expression level and analyze the association between circXPO1 and clinicopathological features.
CircRNA microarray
A circRNA microarray (Arraystar Human circRNAs chip, ArrayStar) containing more than 5000 probes specific for splice sites in human circRNAs was used in this study. After hybridization, 5 MM samples and 5 IDA BM samples were examined using the circRNA microarray provided by Kangcheng Bio-Tech Inc. R software was used to process the subsequent data after quantile normalization. Differentially expressed circRNAs were identified through volcano plot filtering and fold change filtering. CircRNAs with a fold change ≥2.0 and a p-value <0.05 were identified as significantly differentially expressed circRNAs. We further confirmed microarray results of 10 randomly selected circRNAs by qRT - PCR in samples from 10 newly diagnosed MM patients and IDA controls.
Cell culture
Human multiple myeloma cell lines (MM.1S, NCI-H929, OPM2, OPMI-8226, U266) and Human bone marrow stromal cells HS-5 were purchased from the American Type Culture Collection and maintained in RPMI-1640 medium or DMEM (Invitrogen) supplemented with 10% fetal bovine serum (FBS). Cells were cultured at 37 ℃ in 5% CO2, and all cell lines were routinely tested for mycoplasma contamination. All in vitro studies were performed repeated three times in MM cell lines, or performed in more than three newly diagnosed MM cells.
RNA stability assay
MM cells were exposed to 1 μg/mL actinomycin D (Sigma-Aldrich, Saint Louis, MO, USA) to block transcription for 4, 8, 12, and 24 h. Then, the cells were harvested, and the stability of the circXPO1 and XPO1 mRNAs was analyzed using qRT – PCR.
RNase R assay
MM cells (2x105 /well) were plated in 6-well plates. For RNase R treatment, total RNAs were extracted from MM cells and incubated in the presence or absence of RNase (BIOSEARCH TECHNOLOGIES, Lucigen) at 37 ℃ for 30 min, and RNase-free water was used as control (Mock). Digested RNA was subsequently purified using a RNeasy MiniElute Cleanup kit (Qiagen). The RNA concentrations of the treated samples were determined, and 1 μg of treated RNA was used for qRT-PCR.
Nuclear and cytoplasmic fractionation
The nuclear and cytoplasmic fractions were extracted according to the manufacturer’s protocol using NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Sciectific). The effectiveness of nuclear and cytoplasmic separation was assessed by determining the protein levels U6 and β-actin, which are specifically expressed in the nucleus and cytoplasm, respectively.
Small interfering RNAs (siRNAs), vector construction and cell transfection
Small interfering RNAs (siRNAs) against circXPO1 and the negative control RNA duplex (siRNA-NC) were purchased from RiboBio, Guangzhou, China. The miR-495-3p mimics(miR-495-3p) or its inhibitor (inhibitor-miR-495-3p) and scrambled oligonucleotides (miR-NC or inhibitor-NC) were purchased from RiboBio, Guangzhou, China. The plasmid for circRNA overexpression (OE) was constructed using pEX-3 circRNA Mini Vector, which was produced by the GenePharma (Shanghai, China). The region spanning the second exon of the XPO1 gene that constitutes the circRNA was PCR amplified from cDNA and seamlessly cloned between the splicing signals AG and GT, which are surrounded by the minimal introns that facilitate the generation of circXPO1 (pEX-3-circXPO1). The construct was verified by sequencing.
Based on the expression levels of circXPO1 in different MM cell lines, we selected the MM cell lines with comparatively high circXPO1 expression (NCI-H929, MM.1S) to perform loss-of-function experiments. Unless otherwise noted, the plasmids and siRNAs were delivered into cultured MM cells by RFectsp Transfection Reagent (Biodai). MM cells (3× 105 cells/sample) were transfected with 100 pmol of the siRNAs in opti-MEM buffer (Gibico) using RFectsp Transfection Reagent. The transfected cells were harvested at different time points after transfection for biological functional analyses for RNA extraction.
For miRNA overexpression, miR-495-3p or corresponding NC mimics were transfected into MM cells for 48 h at a concentration of 100nmol.In addition, miR-495-3p or corresponding NC inhibitors were acquired from GenePharma. For rescue experiments, MM cells were co-transfected with circXPO1 siRNAs (100 nM) and miRNA inhibitor (100nM) or NC inhibitor for 48h.
Cell Counting Kit (CCK) 8 assay
CCK-8 assays were performed to investigate the viability of cells (7Sea Pharmatech Co., Ltd.)). In brief, MM cells were seeded in a 96-well plate (4x103 cells/well) and incubated with CCK8 solution (10 µl) for 1h. A microplate reader (Bio-Rad, Hercules, California, USA) was used to measure the absorbance at 450 nm.
Flow cytometry
Cells were seeded onto 6-well plates (2x105 cells/well). After transfection for 48 h, cells were collected to determined cell cycle distribution or cell apoptosis. For cell cycle analysis, cells were pre-treated with 70% cold ethanol at 4℃ overnight and incubated with PI solution for 30 min at 4 ℃ in the dark according to the manufacturer’s protocol (Shanghai Bioscience Technology Co. Ltd). Cell apoptosis was measured using Annexin V-PE/RedNucleus II apoptosis detection kit (Shanghai Bioscience Technology Co. Ltd). Flow cytometry instrument NovoCyte (ACEA Bioscience, Inc.) was used to detect the cells and NovoExpress 1.3.4 software (ACEA Bioscience, Inc.) was used to analyze data.
5-ethynyl-2’-deoxyuridinr (Edu) staining assay
The Edu assay kit (Beyotime Institute of Biotechnology) was utilized to assess cell proliferation. Briefly, transfected MM cells (2 x105 cells/plate) were collected and incubated with Edu reagent according to the manufacturer’s protocol. Subsequently, cells were counterstained with Azide 647 for 15min at room temperature and EDU- positive cells were determined via flow cytometer.
Luciferase reporter assay
Bioinformatics analysis predicted that circXPO1 was complementary to six miRNAs (miR-495-3p, miR-580-5p, miR-125a-5p, miR-125b-5p, miR-409-3p and miR-138-1-3p) based on StarBase v 2.0 (starbase.sysu.edu.cn/index.php) [30]and Circular RNA Interactome software (circinteractome.nia.nih.gov/index.html) [31]. In addition, these six miRNAs were predicted to bind with DDIT4 3’-UTR based on StarBase. In order to confirm this association, wild-type and mutant sequence of the targeting region of circXPO1 or DDIT4 were constructed and cloned into a primer GLO vector (Promega Corporation). Subsequently, MM cells were co-transfected with the wild-type or mutant luciferase reporter plasmids targeting circXPO1 or DDIT4, together with miR-495-3p, miR-580-5p, miR-125a-5p, miR-125b-5p, miR-409-3p or miR-138-1-3p mimics using RFectsp Transfection Reagent for 48 h. Binding activity was measured using a Dual luciferase reporter assay kit (Promega Corporation), relative to firefly/Renilla luciferase activity.
Quantitative real-time PCR
Total RNA extracted with TRIzol reagent (Thermo Scientific) was used for cDNA synthesis using HiFi Script cDNA Synthesis Kit (CW Biotech, China) or miRcute Plus miRNA First-Strand cDNA Kit (TIANGEN BIOTECH, BenJing CO., LTD). Next, quantitative real-time PCR (qRT-PCR) reaction was performed using Ultra SYBR Mixture (CW Biotech, China) or miRcute Plus miRNA qPCR Kit (TIANGEN BIOTECH, BenJing CO., LTD). β‑actin was used as the internal control for circRNA and mRNA and U6 (for miR-495-3p) was used as the internal control for miRNA. The relative gene expression levels in cell lines were normalized to the control. The primers used in the current experiments were designed and purchased from Tsingke Biotechnology (Beijing, China) (Table 1).
Table1 Primers used in the present study
Gene
|
Primer sequence
|
β-actin
|
forward: 5′- GTGGCCGAGGACTTTGATTG -3′
reverse: 5′- CCTGTAACAACGCATCTCATATT -3′
|
U6
|
forward: 5′- CTCGCTTCGGCAGCACA-3′
reverse: 5′- AACGCTTCACGAATTTGCGT-3′
|
hsa_circRNA_102735
|
forward: 5′- ATCATTTGGCTGCTGAACTCTA -3′
reverse: 5′- AGTTCTGTTCATCATCTTTTCCAT -3′
|
hsa_circRNA_105013
|
forward: 5′- TTCTTCCAGGTGATGGTGAGGT -3′
reverse: 5′- CTTGGTCATTGTGTGTGC -3′
|
hsa_circRNA_104423
|
forward: 5′- CCACTGGCAAAGAGTCACCTAAA -3′
reverse: 5′- ATTCCCTGGCAGTTCCGTGTA -3′
|
DDIT4
|
forward: 5′- TGCATTGGGGACACATACCC-3′
reverse: 5′- CCCAAGTGATCCCTGACACC-3′
|
Western blot assay
Total cellular protein was extracted, and protein quantification was performed with a protein quantification kit. After quantification, 40 μg of the samples was loaded on a 10% SDS-PAGE gel, transferred to a PVDF membrane (Millipore, USA), and blocked with 5% skim milk, washed, and incubated with primary antibodies : anti-DDIT4 (Proteintech, 1:1000) , and anti-β-Tubulin (Proteintech, 1:1000) at 4℃ overnight. Subsequently, secondary antibodies (1:2000, Abcam) was incubated for 1h. Immunoreactions were then visualized with ECL reagents.
Statistical analysis
Data were presented as mean ±SD in three independent replicates. Differences t between groups were compared using unpaired Student’s t-test or one-way ANOVA followed by post hoc Bonferroni’s correction. GraphPad Prism 5 software (GraphPad, San Diego, California, USA) was applied for data analysis. Associations between circXPO1 expression level and clinic ‑ pathological features were analyzed using Chi‑square or Fisher's exact test. Statistical significance was considered when P value <0.05.