Comparative prevalence of oral pathogenic bacteria and protozoa in patients with periodontitis in Taiwan

doi:10.21203/rs.3.rs-1714102/v1

Download PDF

Research Article

Comparative prevalence of oral pathogenic bacteria and protozoa in patients with periodontitis in Taiwan

https://doi.org/10.21203/rs.3.rs-1714102/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objectives

Periodontitis is an inflammatory disease caused by bacteria present in the dental plaque. However, the role of two oral protozoans, Entamoeba gingivalis and Trichomonas tenax, in patients with the periodontal disease remains largely unknown in Taiwan. Therefore, we investigated the prevalence of oral microbial infections between the sites with mild gingivitis and chronic periodontitis in patients with periodontitis.

Materials and Methods

We collected 60 dental plaque samples from sites with mild gingivitis (probing depth < 5 mm) and chronic periodontitis (probing depth ≥ 5 mm) from 30 patients at the National Cheng Kung University Hospital. The samples were analyzed via polymerase chain reaction and gel electrophoresis.

Results

Among oral protozoans, E. gingivalis and T. tenax were detected in 44 (74.07%) and 14 (23.33%) of all samples, respectively. Among oral bacteria, P. gingivalis, T. denticola, and T. forsythia were detected in 50 (83.33%), 47 (78.33%), and 48 (80.0%) samples, respectively. Furthermore, the infection rates of T. tenax and T. forsythia were significantly different between the sites with mild gingivitis and chronic periodontitis.

Conclusions

This study, which is the first to analyze E. gingivalis and T. tenax presence among patients with periodontitis in Taiwan, revealed an association between periodontitis and oral microbes.

Clinical Relevance:

Compared with the different sites with mild gingivitis and chronic periodontitis, chronic is more likely to also have the infection rates of T. tenax and T. forsythia. These oral protozoans and bacteria may be the reason for chronic periodontitis in Taiwan.

oral bacteria

oral protozoans

mild gingivitis

chronic periodontitis

Periodontitis, an inflammatory disease of the oral cavity, is a prevalent oral disease worldwide, including Taiwan [1]. The prevalence of severe periodontitis in global population was 11% in 2010 [2]. Periodontal and gingivitis diseases result from bacterial plaque accumulation in the teeth and gums, which causes gingivitis inflammation [3]. Periodontitis is considered a progression of irreversible destruction by the bacterial biofilm around the teeth and soft tissue and causes tooth loss in patients with periodontitis [4]. Oral microbes such as Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia play important roles in periodontal disease [5]. In a previous study, the oral microbial composition of healthy individuals and patients with periodontitis in Taiwan has been investigated to examine the presence of pathogenic bacteria [6]. In addition to that of pathogenic bacteria, the prevalence of oral protozoa, Entamoeba gingivalis and Trichomonas tenax, has also been investigated in some studies [7, 8]. Entamoeba gingivalis and Trichomonas tenax exist only in the trophozoite form and are always found in the human oral cavity, particularly gingival tissues [9]. Entamoeba gingivalis and Trichomonas tenax can be transmitted by close contact with others, including kissing, as well by indirect contact, for example, through individuals infected with oral protozoa [10]. However, Entamoeba gingivalis and Trichomonas tenax infections are usually ignored in Taiwanese patients [11]. Hence, the prevalence of protozoa such as Entamoeba gingivalis and Trichomonas tenax in Taiwan remains unknown. In this study, we identified pathogenic bacteria and protozoa in patients with periodontitis in Taiwan.

Patients and samples

The Institutional Review Board (IRB) of National Cheng Kung University Hospital approved the study protocol. The samples were collected from 30 patients with periodontitis. After a brief explanation of the objectives and clinical procedures involved in the study, patients who agreed to participate signed the informed consent forms. Dental plaque samples were collected from sites with mild gingivitis (probing depth < 5 mm) and chronic periodontitis (probing depth ≥ 5 mm). All samples were transported to the Parasitology Laboratory at the National Cheng Kung University within 2 h of collection and stored at -20°C until processing.

Genomic DNA extraction and polymerase chain reaction (PCR) amplification

The total DNA mini kit (Qiagen, Hilden, Germany) was used for DNA extraction. PCR was performed using Taq DNA polymerase (Ampliqon, Odense, Denmark). Primers were designed to detect specific microbes. For bacteria, the 16S rRNA primers used were Pg_1 F 5′ AGGCAGCTTGCCATACTGCG 3′; Pg_2 R 5′ ACTGTTAGCAACTACCGATGT 3′ for Porphyromonas gingivalis, Td_1 F 5′ TAATACCGAATGTGCTCATTTACAT 3′; Td_2 R 5′ TCAAAGAAGCATTCCCTCTTCTTCTTA 3′ for Treponema denticola, and Bf_1_F 5′ GCGTATGTAACCTGCCCGCA 3′; Bf_2 R 5′ TGCTTCAGTGTCAGTTATACCT 3′ for Tannerella forsythia [12]. The SSU rDNA primers used were EGHF 5′ TACCATACAAGGAATAGCTTTGTGAATAA 3′ and EGHR 5′ ACAATTGTAAATTTGTTCTTTTTCT 3′ [13]. To identify subtypes ST1 and ST2 of Entamoeba gingivalis, the 18S-ITS1-5.8S-ITS2 rRNA region of a new subtype of Entameba gingivalis “E. gingivalis ST2, kamaktli variant”, which is 89% identical to E. gingivalis ST1, was sequenced and identified [14]. The first set of primers used for nested PCR was EgST1-2F 5′ GCCATGCATGTGTAAGTATAAAGACC 3′; EgST1-2R 5′ ACTATTGGAGCTGGAATTACCGC 3′. The ST1- and ST2-specific primers used for E. gingivalis identified were GEgFST1 F 5′ GAGACGATCCTGTTCTATTAC 3 ′; GEgFST2 F 5′ GAGACAATCCCAGTTGTTTGTAC 3′; GEg1R R 5′ ACTATGTACGTTCCGTTCATTCC 3′ [15]. For Trichomonas tenax, the 18S rRNA gene was amplified using the first primer pair (TRC1-F 5′ GGTAATTCCAGCTCTGCG 3′ and TRC1-R 5′ TGGTAAGTTTCCCCGTGT 3′). The PCR product was amplified using the second primer pair (TRC2-F 5′ GTTAAAACGCCCGTAGTC 3′ and TRC2-R 5′ CCAGAGCCCAAGAACTAT 3′) [16]. The PCR products were separated on an agarose gel, stained with DNA VIEW (BIOTOOLS Co., Ltd.), and sequenced.

Statistical analysis

To determine whether the observed differences in the infection rates were significant between the oral microbial infection rate between the sites with mild gingivitis and chronic periodontitis in patients with periodontitis, we performed statistical analysis (Chi-square or Fisher’s exact test) using GraphPad Prism 5.0; results with p < 0.05 were considered significant.

Patient characteristics

We collected 60 dental plaque samples from 30 patients (18 male and 12 female) with mild gingivitis (probing depth < 5 mm) and chronic periodontitis (probing depth ≥ 5 mm). The patients were grouped according to age as follows: 20–40 years (1), 40–60 years (12) and 60–80 years (17) (Table 1).

Table 1

Demographic characteristics of the patients
	Sample n (%)
Gender
Male	18
Female	12
Total n (%)	30 (100%)
Age (years)
20–40	1
40–60	12
60–80	17
Total n (%)	30 (100%)

Percentage of oral microbes in dental plaque samples

To determine the association of oral pathogenic bacteria and protozoa with mild and severe periodontal diseases, we analyzed dental plaque samples from sites with chronic periodontitis (labeled as position 1) and mild gingivitis (labeled as position 2). We detected three oral pathogenic bacteria (Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia) and two protozoans (Entamoeba gingivalis and Trichomonas tenax) using PCR (Table 2). Positive and negative samples were detected based on the agarose gel electrophoresis results of the sample from patient No. 7, who was positive for three oral pathogenic bacteria and two protozoans (Fig. 1). The infection rate of oral microbes, including three oral pathogenic bacteria and two protozoans, from sites with chronic periodontitis (labeled as position 1) and mild gingivitis (labeled as position 2) was showed (Fig. 2) (Table 3). The results were showed that the infection rates of T. tenax and T. forsythia were significantly different between the sites with position 1 and position 2.

Table 2

Distribution of oral microbes detected via PCR of samples from patients
	Oral protozoans		Oral bacteria
Total patients	E. gingivalis	T. tenax	P. gingivalis	T. denticola	T. forsythia
30	26/30 (86.66%)	12/30 (40.0%)	28/30 (93.33%)	28/30 (93.33%)	30/30 (100%)
Patients No.
1–1	+ (ST2)	-	+	+	+
1–2	+ (ST2)	-	+	+	-
2 − 1	+ (ST1, ST2)	-	+	+	+
2–2	+ (ST2)	-	+	+	-
3 − 1	+ (ST1)	-	+	+	+
3 − 2	+ (ST1)	-	+	+	+
4 − 1	-	+	+	+	+
4 − 2	+ (ST2)	+	+	+	+
5 − 1	+ (ST1)	-	+	+	+
5 − 2	+ (ST1, ST2)	-	+	+	-
6 − 1	+ (ST2)	-	+	-	+
6 − 2	+ (ST1, ST2)	-	+	-	+
7 − 1	+ (ST1)	+	+	+	+
7 − 2	-	-	+	-	-
8 − 1	-	-	-	-	+
8 − 2	-	-	+	+	-
9 − 1	+ (ST1, ST2)	-	+	+	+
9 − 2	-	-	+	+	+
10 − 1	+ (ST1, ST2)	-	+	+	+
10 − 2	+ (ST1)	-	-	+	+
11 − 1	+ (ST1, ST2)	+	-	+	+
11 − 2	+ (ST1, ST2)	+	-	-	-
12 − 1	+ (ST1, ST2)	-	+	+	+
12 − 2	+ (ST1, ST2)	-	+	-	+
13 − 1	-	+	+	-	-
13 − 2	-	-	+	-	+
14 − 1	+ (ST1)	-	+	-	+
14 − 2	-	-	+	+	+
15 − 1	+ (ST1)	+	-	+	+
15 − 2	-	-	-	+	-
16 − 1	-	-	+	+	+
16 − 2	-	-	-	+	+
17 − 1	+ (ST1, ST2)	-	+	+	+
17 − 2	+ (ST1, ST2)	-	+	+	+
18 − 1	+ (ST1, ST2)	+	+	+	+
18 − 2	+ (ST1, ST2)	-	+	+	+
19 − 1	+ (ST1, ST2)	-	+	+	+
19 − 2	+ (ST1)	-	+	-	+
20 − 1	+ (ST1, ST2)	-	+	+	+
20 − 2	+ (ST1, ST2)	-	+	+	+
21 − 1	+ (ST1, ST2)	-	+	+	+
21 − 2	+ (ST2)	-	+	+	+
22 − 1	-	+	+	+	+
22 − 2	+ (ST1, ST2)	-	-	+	+
23 − 1	+ (ST1, ST2)	-	+	+	+
23 − 2	+ (ST1, ST2)	-	+	+	+
24 − 1	+ (ST1, ST2)	+	+	+	+
24 − 2	+ (ST1, ST2)	-	+	+	+
25 − 1	+ (ST2)	-	+	+	+
25 − 2	+ (ST2)	-	+	-	-
26 − 1	+ (ST1, ST2)	+	+	+	+
26 − 2	-	-	-	-	-
27 − 1	+ (ST1, ST2)	+	+	+	+
27 − 2	-	-	+	+	+
28 − 1	+ (ST1, ST2)	+	+	+	+
28 − 2	+ (ST1, ST2)	-	+	+	+
29 − 1	-	-	+	+	+
29 − 2	-	-	-	-	-
30 − 1	+ (ST1, ST2)	-	+	+	+
30 − 2	+ (ST1, ST2)	+	+	+	-

Table 3

Positive percentage and number of microbes in samples from sites with chronic periodontitis and mild gingivitis.
Position	E. gingivalis	T. tenax	P. gingivalis	T. denticola	T. forsythia
1	24 (80.0)	11 (36.67)	27 (90.0)	26 (86.67)	29 (96.67)
2	20 (66.67)	3 (10.0)	23 (76.67)	21 (70.0)	19 (63.33)
Total	44 (73.33)	14 (23.33)	50 (83.33)	47 (78.33)	48 (80.0)

Prevalence of oral protozoans in patients with periodontitis

Total 44 samples were positive for Entamoeba gingivalis. The infection rates from sites with chronic periodontitis (labeled as position 1) and mild gingivitis (labeled as position 2) were 80.0% and 66.67%, respectively (Table 4). We also analyzed the subtypes ST1 and ST2-kamaktli of Entamoeba gingivalis. The infection rate of ST1 subtypes in Entamoeba gingivalis was 13.33% at positions 1 and 2. The infection rates of ST2-kamaktli subtypes in Entamoeba gingivalis were 10.0% and 16.67% at positions 1 and 2, respectively. The infection rates of both ST1 subtypes and ST2-kamaktli subtypes in Entamoeba gingivalis were 56.67% and 36.67% at positions 1 and 2, respectively (Fig. 3) (Table 5). In Trichomonas tenax, we found that 14 samples were positive. The infection rates at positions 1 and 2 were 36.67% and 10.0%, respectively, in Trichomonas tenax (Table 6).

Table 4

Infection rates of *E. gingivalis* at sites with chronic periodontitis and mild gingivitis in patients
		Presence of E. gingivalis
Position	Sample n (%)	Yes n (%)	No n (%)	p value*
1	30	24 (80.0)	6 (20.0)	0.2429
2	30	20 (66.67)	10 (33.33)
Total	60 (100)	44 (73.33)	14 (25.93)
(Chi-square test was used; *P-value was significant.)

Table 5

Positive infection rate and number of subtypes of *Entamoeba gingivalis* at sites with chronic periodontitis and mild gingivitis
Position	Presence of E. gingivalis
Position	ST1 n(%)	ST2-kamaktli n(%)	ST1, ST2-kamaktli n(%)
1	4 (13.33)	3 (10.0)	17 (56.67)	24 (80.0)
2	4 (13.33)	5 (16.67)	11 (36.67)	20 (66.67)

Table 6

Infection rate of *T. tenax* at sites with chronic periodontitis and mild gingivitis in patients
		Presence of T. tenax
Position	Sample n (%)	Yes n (%)	No n (%)	p value*
1	30	11 (36.67)	19 (63.33)	0.0303
2	30	3 (10.0)	27 (90.0)
Total	60 (100)	14 (23.33)	46 (76.67)
(Fisher’s exact test was used; *P-value was significant.)

Prevalence of oral pathogenic bacteria in periodontitis patients

Total 50 samples were positive for Porphyromonas gingivalis. The infection rates of Porphyromonas gingivalis at positions 1 and 2 were 90.0% and 76.67%, respectively (Table 7). Total 60 samples were positive for Treponema denticola. The infection rates of Treponema denticola at positions 1 and 2 were 86.67% and 70.0%, respectively (Table 8). Sixty samples were positive for Tannerella forsythia. The infection rates of Tannerella forsythia at positions 1 and 2 were 96.67% and 63.33%, respectively (Table 9).

Table 7

Infection rates of *P. gingivalis* at sites with chronic periodontitis and mild gingivitis in patients
		Presence of P. gingivalis
Position	Sample n (%)	Yes n (%)	No n (%)	p value*
1	30	27 (90.0)	3 (10.0)	0.2990
2	30	23 (76.67)	7 (23.33)
Total	60 (100)	50 (83.33)	10 (16.67)
(Fisher’s exact test was used; *P-value was significant.)

Table 8

Infection rates of *T. denticola* at sites with chronic periodontitis and mild gingivitis in patients
		Presence of T. denticola
Position	Sample n (%)	Yes n (%)	No n (%)	p value*
1	30	26 (86.67)	4 (13.33)	0.2092
2	30	21 (70.0)	9 (30.0)
Total	60 (100)	47 (78.33)	13 (21.67)
(Fisher’s exact test was used; *P-value was significant.)

Table 9

Infection rates of *T. forsythia* at sites with chronic periodontitis and mild gingivitis in patients
		Presence of T. forsythia
Position	Sample n (%)	Yes n (%)	No n (%)	p value*
1	30	29 (96.67)	1 (3.33)	0.0025
2	30	19 (63.33)	11 (36.67)
Total	60 (100)	48 (80.0)	12 (20.0)
(Fisher’s exact test was used; *P-value was significant.)

In this study, we analyzed the prevalence of oral pathogenic bacteria and protozoa in patients in Taiwan, using PCR, with respect to the probing depth and clinical data. A previous study showed that the subgingival microbiota accumulated in periodontal pockets of 5 mm and one healthy site (probing depth ≤ 3 mm) in 30 periodontitis patients, including 17 women and 13 men. The ST1 and ST2-kamaktli subtypes of Entamoeba gingivalis were detected in 70% and 18.3% pathological samples and 10% and 3.3% healthy samples, respectively [17]. However, in our study, the ST1 and ST2-kamaktli subtypes were detected in 13.33% and 13.33% of pathological samples and 10% and 16.67% healthy samples, respectively. We speculate that the reason for this inconsistency between the results of the previous study and our study is that we considered mild gingivitis (probing depth < 5 mm) in healthy samples. Moreover, in another study, Trichomonas tenax was detected in 33.3% of pathological samples and 6.7% healthy samples [17]. In our study, it was detected in 36.67% of pathological samples and 10.0% healthy samples. These findings showed that the results regarding the prevalence of Trichomonas tenax between pathological samples and healthy samples in the previous study were consistent with those of our study.

A previous study on oral bacteria in Kuwait showed that P. gingivalis was present in 33.3 % patients with periodontitis and 6.4 % healthy individuals. T. denticola was detected in 60% periodontitis patients and 29% healthy individuals. T. forsythia was detected in 83.3% periodontitis patients and 51.6 % healthy individuals [18]. Moreover, a previous study also showed that in 30 periodontitis patients, the infection rates of P. gingivalis were 29.4% and 38.5% at moderate and severe infection sites, respectively; The infection rates of T. denticola were 64.7% and 76.9% at moderate and severe infection sites, respectively; the infection rates of T. forsythia were 76.47% and 92.3% at moderate and severe infection sites, respectively [18]. Based on the moderate and severe infection sites, results showed that the results of the previous study were almost consistent with those of our study on the prevalence of oral bacteria, except for P. gingivalis. However, in a study conducted in Italy, P. gingivalis, T. denticola, and T. forsythia were detected in 65.5%, 66.4%, and 72.7% of 2992 Italian adults with chronic periodontitis, respectively [19]. Another previous study also showed that P. gingivalis and T. forsythia were detected in over 60% aggressive or chronic periodontitis patients in Japan [20]. Our study demonstrated that oral bacteria, such as P. gingivalis, T. denticola, and T. forsythia, were highly prevalent in over 70% of periodontitis patients in Taiwan.

In a previous study based on different infection sites, bacterial plaque samples were collected from 107 periodontitis patients and 68 gingivitis patients in Kayseri. In periodontitis patients, Entamoeba gingivalis and Trichomonas tenax were detected in 35.5% and 2.8% samples, respectively. Entamoeba gingivalis and Trichomonas tenax co-infections were detected in 1.9% patients. Entamoeba gingivalis and Trichomonas tenax were detected in 32.4% and 2.9% samples, respectively, of gingivitis patients. Entamoeba gingivalis and Trichomonas tenax co-infections were detected in 1.5% patients [21]. Previous study also showed that the salivary and dental plaque specimens mixed were collected from 80 periodontitis patients and 45 gingivitis patients. In periodontitis patients, Entamoeba gingivalis and Trichomonas tenax were detected in 11.1% and 25.6% samples, respectively. Entamoeba gingivalis and Trichomonas tenax co-infections were detected in 23.3% patients. Entamoeba gingivalis and Trichomonas tenax were detected in 15.1% and 5.7% samples, respectively, of gingivitis patients. Entamoeba gingivalis and Trichomonas tenax co-infections were detected in 5.7% patients [22]. Compared with that in a previous studies, in 30 periodontitis patients, positive percentage of Entamoeba gingivalis and Trichomonas tenax were detected in 26 (86.67%) and 12 (40.0%) samples in this study. The infection rate of Entamoeba gingivalis, which were approximately 10–30% in a previous studies, were lower in our study (86.67%). Furthermore, results showed that the infection rate of Trichomonas tenax in the previous study was lower than that in this study [21, 22].

This study has two limitations. The number of samples collected from patients with periodontitis was small. Furthermore, the samples were only collected from patients with periodontitis but not collected from healthy individuals. Therefore, they may not represent the infection rates of oral pathogenic bacteria and protozoa associated with periodontitis in Taiwan. In conclusion, this study, which is the first to detect E. gingivalis and T. tenax in patients with periodontitis in Taiwan, revealed the possibility of an association between periodontitis and oral microbes.

Ethics approval

The Institutional Review Board (IRB) of National Cheng Kung University Hospital approved the study protocol (registration No. A-ER-108-349). All methods were carried out in accordance with relevant guidelines and regulations.

Consent for publication

Not applicable

Competing interests

All authors declare no conflicts of interest.

Availability of data and materials

Data supporting the conclusions of this article are included within the article. The datasets used and/or analyzed during the present study are available from the corresponding author upon reasonable request.

Funding

This research was supported by the Ministry of Science and Technology (MOST) to WCL (grant MOST 110-2628-B-006-32) and by the National Cheng Kung University Hospital to Chun Chan Ting.

Author Contributions

Wei-Chen Lin conceived and designed the experiments; Yu Chun Chen performed the experiments; Wei-Chen Lin and Yu Chun Chen analyzed the data; Kuo Yuan, Ying-Ying Chang and Chun Chan Ting contributed clinical samples; and Jian-Ming Huang wrote the paper.

All authors read and approved the final version of the manuscript.

Acknowledgments

We acknowledge Professor Kuo Yuan and Chun Chan Ting (Department of Stomatology, National Cheng Kung University Hospital) for providing samples collected from patients with periodontitis. We would like to thank Editage (www.editage.com) for English language editing.

Yu HC, Su NY, Huang JY, Lee SS and Chang YC (2017) Trends in the prevalence of periodontitis in Taiwan from 1997 to 2013: A nationwide population-based retrospective study. Medicine (Baltimore) 96:e8585. doi: 10.1097/MD.0000000000008585
Marcenes W, Kassebaum NJ, Bernabé E, Flaxman A, Naghavi M, Lopez A and Murray CJ (2013) Global burden of oral conditions in 1990–2010: a systematic analysis. J Dent Res 92:592–597.
Löe H, Theilade E and Jensen SB (1965) Experimental gingivitis in man. The Journal of periodontology 36:177–187.
Pihlstrom BL, Michalowicz BS and Johnson NW (2005) Periodontal diseases. The lancet 366:1809–1820.
Marsh PD (2010) Microbiology of dental plaque biofilms and their role in oral health and caries. Dent Clin North Am 54:441–454.
Chen WP, Chang SH, Tang CY, Liou ML, Tsai SJ and Lin YL (2018) Composition Analysis and Feature Selection of the Oral Microbiota Associated with Periodontal Disease. BioMed research international 2018:3130607. doi: 10.1155/2018/3130607
Al-Dulaimi FHA, Alajeely AAA and Ail YM (2020) Incidence of Entamoeba Gingivalis and Trichomonas Tenax in Periodontitis and Gingivitis Patients Who Attended to Private Clincs in Babylon Province. Medico Legal Update 20:906–910.
El Hayawan I and Bayoumy M (1992) The prevalence of Entamoeba gingivalis and Trichomonas tenax in Periodontal disease. J Egypt Soc Parasitol 22:101–105.
Chen J, Wen W, Liu G, Chen W, Lin L and Hong H (2001) Studies on periodontal disease caused by Entamoeba gingivalis and its pathogenetic mechanism. Rev China Med J 114:12–15.
Al-Najar S and Adnan E (1986) The first record of Entamoeba gingivalis in Iraqi patients. J Fac Med Baghdad 28:73–80.
Huang JM, Ting CC, Chen YC, Yuan K and Lin WC (2020) The first study to detect co-infection of Entamoeba gingivalis and periodontitis-associated bacteria in dental patients in Taiwan. Journal of Microbiology, Immunology and Infection.
Ashimoto A, Chen C, Bakker I and Slots J (1996) Polymerase chain reaction detection of 8 putative periodontal pathogens in subgingival plaque of gingivitis and advanced periodontitis lesions. Oral Microbiol Immunol 11:266–273.
Trim RD, Skinner MA, Farone MB, DuBois JD and Newsome AL (2011) Use of PCR to detect Entamoeba gingivalis in diseased gingival pockets and demonstrate its absence in healthy gingival sites. Parasitol Res 109:857–864.
Garcia G, Ramos F, Martinez-Hernandez F, Hernandez L, Yanez J and Gaytan P (2018) A new subtype of Entamoeba gingivalis: "E. gingivalis ST2, kamaktli variant". Parasitol Res 117:1277–1284. doi: 10.1007/s00436-018-5798-6
Garcia G, Ramos F, Maldonado J, Fernandez A, Yanez J, Hernandez L and Gaytan P (2018) Prevalence of two Entamoeba gingivalis ST1 and ST2-kamaktli subtypes in the human oral cavity under various conditions. Parasitol Res 117:2941–2948. doi: 10.1007/s00436-018-5990-8
Lin C, Ying F, Lai Y, Li X, Xue X, Zhou T and Hu D (2019) Use of nested PCR for the detection of trichomonads in bronchoalveolar lavage fluid. BMC Infect Dis 19:1–6.
Dubar M, Zaffino ML, Remen T, Thilly N, Cunat L, Machouart MC and Bisson C (2020) Protozoans in subgingival biofilm: clinical and bacterial associated factors and impact of scaling and root planing treatment. J Oral Microbiol 12:1693222. doi: 10.1080/20002297.2019.1693222
Alazemi AM, Jamal W, Al Khabbaz A and Rotimi V (2020) Prevalence of target anaerobes associated with chronic periodontitis. Access Microbiol 2.
Tettamanti L, Gaudio R, Cura F, Mucchi D, Illuzzi N and Tagliabue A (2017) Prevalence of periodontal pathogens among Italian patients with chronic periodontitis: A retrospective study on 2992 patients. Oral Implantol 10:28.
Tomita S, Komiya-Ito A, Imamura K, Kita D, Ota K, Takayama S, Makino-Oi A, Kinumatsu T, Ota M and Saito A (2013) Prevalence of Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis and Tannerella forsythia in Japanese patients with generalized chronic and aggressive periodontitis. Microb Pathog 61:11–15.
Yazar S, Çetinkaya Ü, Hamamcı B, Alkan A, Şişman Y, Esen Ç and Kolay M (2016) Investigation of Entamoeba gingivalis and Trichomonas tenax in Periodontitis or Gingivitis Patients in Kayseri. Turkiye Parazitol Derg 40:17–21. doi: 10.5152/tpd.2016.4351
Yaseen A, Mahafzah A, Dababseh D, Taim D, Hamdan AA, Al-Fraihat E, Hassona Y, Şahin GÖ, Santi-Rocca J and Sallam M (2021) Oral Colonization by Entamoeba gingivalis and Trichomonas tenax: A PCR-Based Study in Health, Gingivitis, and Periodontitis. Frontiers in cellular and infection microbiology:1240.

No competing interests reported.

originalfulllengthgelforfig.1.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

Comparative prevalence of oral pathogenic bacteria and protozoa in patients with periodontitis in Taiwan

Status:

Version 1

Abstract

Objectives

Materials and Methods

Results

Conclusions

Clinical Relevance:

Figures

Introduction

Methods

Patients and samples

Genomic DNA extraction and polymerase chain reaction (PCR) amplification

Statistical analysis

Results

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1