Patient Samples
Three patients diagnosed with gastric cancer were enrolled in a mRNA sequencing group, and fifty-six GC patients were enrolled in an expanded group as verification samples. All patients received radical gastrectomy for gastric cancer in the First Hospital of Jilin University between 2017-2018. Paracancerous tissues, CIS tissues and LNM tissues were obtained by microdissection of frozen thin sections. The backgrounds and clinicopathological characteristics of patients in the sequencing group are summarized in table 1. The information of patients in the expanded group is shown in supplementary materials (supplementary table 1).
Two years after surgery, all patients were followed up by telephone interviews. The follow-up data were recorded as survival (0 points), death (1 point), lost/missing data (2 points), and recurrence (3 points). This study was approved by the Ethics Committees of the First Hospital of Jilin University. The ethics form and signed informed consent from all patients are shown in the supplementary materials.
Microdissection of tumor tissue and RNAsequencing
Surgical samples were embedded in OCT and sliced by freezing microtome. The slices were fixed in 95% ethanol for 2 min and stained with haematine for 30 seconds. After washing with ddH2O containing 1‰ DEPC, tissue slices were microdissected using laser capture microdissection, equipped with a 355 nm ultraviolet laser diode (LMD6000, Leica Microsystems, Buffalo Grove, IL). Total RNA was isolated from dissected tissues using the PicoPure protocol (Arcturus, Mountain View, CA). The mRNA was amplified with two linear amplification steps by in vitro transcription using the MEGAscript T7 kit (Ambion, Austin, TX), followed by the labeling step using the BioArray HighYield RNA Transcript Labelling Kit T3 from Enzo Life Sciences (Farmingdale, NY). The final cDNA library construction and sequencing were performed at LC-Bio Technology Co, Ltd (Hang Zhou,China), using Illumina Hiseq 4000 platform.
Cell lines
The human gastric cancer cell lines BGC823 and SGC7901 were purchased from Fenghuibio (Changsha, China). Both cell lines were maintained in DMEM cell culture medium (Gibco, No. 11965-084) supplemented with 10% fetal bovine serum (FBS) (Gibco, No. 10082139), 100 IU/mL of penicillin, and 100 mg/mL of streptomycin (Genview, Carlsbad, CA) in a humidified 5% CO2 atmosphere at 37°C.
q-PCR assay
The mRNA levels of PGAM1 in GC tissues and GC cell lines were evaluated by quantitative reverse transcription PCR (RT-qPCR) using the SYBR Green staining method using a Bio-Rad CFX 96 Touch Real-Time PCR Detection System (Bio-Rad, USA). β-Actin was used as an internal control. The relative change of PGAM1 gene was calculated according to the 2−ΔΔCt method [17].
Primers specific for PGAM1 and internal reference gene are:
Gene
|
primers
|
homo-PGAM1-F1 :
homo-PGAM1-R1 :
|
GTGCAGAAGAGAGCGATCCG
CGGTTAGACCCCCATAGTGC
|
homo-ACTIN-F1
homo-ACTIN-R1
|
CATCCGCAAAGACCTGTACG
CCTGCTTGCTGATCCACATC
|
Cell infections and purification
The lentiviral vector pWSLV-sh09 (Supplementary figure 1) expressing a PGAM1-1-targeting shRNA were transfected into 293T cells using the Lipofectamine LTX reagent (Invitrogen). BGC823 and SGC7901 cells (2×105) were seeded into 12-well cell culture plates and cultured for 18 hours. Cells were then infected with 100 μL of virus-containing supernatant from transfected 293T cells and incubated for 48 hours. Infection with virus from the pWSLV empty vector was used as a negative control. Infected cells were purified by flow cytometry on the basis of green fluorescent protein (GFP) expression.
Cell proliferation assay
Analysis of cell growth/proliferation was performed by measurement of colorimetric conversion of the CCK-8 tetrazolium salt, an indicator of viable cells. For the assay, PGAM1 knockdown BGC823 and SGC7901 cells and negative controls were seeded in 96-well plate (2×105 each) in 200 μL culture media and cells were allowed to attach. At different time points (0h, 24h, 48h, 72h), 20 µL of CCK-8 reagent (Cell Counting Kit-8, Dojindo, Japan) was added to 5 wells of the plate and incubated for 2h at 37 °C. The optical density (OD) of each well was then recorded at 450 nm using a microplatereader (BioTekSynergy-4). The growth curves for PGAM1 knockdown and control cells were generated by plotting the average of the 5 wells for each time point.
Cell cycle and apoptosis assays
Cell cycle analysis was performed using propidium iodide (PI) staining. Cells were synchronized by incubation in starvation medium (containing 0.5% FBS) for 48 hours. Complete medium was then added to activate cell cycle entry and cells were cultured for 24h. BGC823 and SGC7901 cells with and without PGAM1 knockdown were harvested with 0.25% trypsin (Millipore, Shanghai, China) and re-suspended in 100 μL PBS. The cells were gently dripped into chilled 75 % ethanol and fixed at -20°C overnight. After washing 3 times with sterile PBS to remove residual ethanol, cells were treated with 20 μg/mL RNase-A at 37 °C for 10 min and then stained with 10 μg/mL PI for 10 min at room temperature. DNA content was measured by flow cytometry.
Apoptosis was measured using the Annexin-V/PI double staining method. BGC823 and SGC7901 cells were dissociated and washed and resuspended in sterile PBS. Cells were labeled with Annexin V-FITC and PI (AnnexinV-FITC Apoptosis Detection Kit, Beyotime Institute of Biotechnology, Haimen, China), according to manufacturer’s instructions. The DNA content and apoptosis of GC cells were measured by flow cytometry (BD, Biosciences, California, USA). The flow cytometry data was analyzed by CellQuest (BD, Bioscience) and MultiCycle software.
Cell migration assay
BGC823 and SGC7901 cells were incubated in starvation medium (containing 0.5% FBS) overnight. Cells were then harvested and approximately 1×105 cells were added to a Transwell chamber (Millipore, Shanghai, China). The chambers were placed into wells of a 24-well plate containing complete (10% FBS) DMEM media and cultured in 5 % CO2 incubator at 37 °C for 24 hours. Cells that did not migrate through the membrane were removed using a disinfected cotton swab. Cells that migrated through the membrane were stained with crystal violet and photographed under an inverted microscope. Stained cells from each group were counted in five defined areas of 200 μm2 in the center of a random field of vision. Cells that migrated further into the well of the 24-well plate were detected by CCK-8 reagent and the OD values of the culture medium were recorded at 450 nm in a microplate reader.
Wound-healing assay
BGC823 or SGC7901 cells (1×106 each) with or without PGAM1 knockdown were seeded into wells of 12-well plate. After the cells reached 80% confluence, a disinfected 10-μL tip was used to make a vertical wound in each well. Cells were gently washed with sterile PBS to remove the cell fragments and continuously cultured in complete media. Wound closure was observed at different time points (0h, 24h, 48h, and 72h) and images were captured using an inverted microscope. ImageJ software was used to calculate the wound-healing rate according to the following equation :
Flow cytometry assay for migration-related proteins MMP2, MMP9 and ICAM-1
To analyze the expression of metastasis and migration-related proteins, cells (2×105 each) in the PGAM1 knockdown group and empty vector control group were harvested and washed with sterile PBS. For intracellular antigen detection, the cells were fixed by using eBioscienceTM Fixation buffer (No. 00-5223-56, invirtogen) for 30 min, and then penetrated by diluted Permeabilization Buffer 10X (No. 00-8333-56, invirtogen) for another 20 min with the PE-conjugated primary antibody matrix metalloproteinases 2 (MMP2, No. ab51125, Abcam) or MMP9 (No. ab194314, Abcam) in it. For detecting cell surface antigens, cells were incubated with PE-conjugated primary antibody of intercellular cell adhesion molecule-1 (ICAM-1) (No. ab27582, Abcam) at room temperature for 10 min. Expression levels were measured by flow cytometry. Flow cytometry data was analyzed by CellQuest (BD, Bioscience).
Western blot analysis
For western blot analysis, BGC823 and SGC7901 cells (3×107), with or without a PGAM1 knockdown were washed with PBS and lysed in RIPA buffer (CWbiotech, Beijing, China) supplemented with protease inhibitors (CWbiotech, Beijing, China) on ice for 10 min. BCA protein assay (Beyotime Institute of Biotechnology, Haimen, China) was used to quantify protein in the lysates of each sample. Approximately 20 µg of each protein sample were separated in 12% Tris-glycine gels and transferred onto polyvinylidene fluoride (PVFD) membranes. Blots were blocked in 5% nonfat milk for 1 h, washed three times with TBST, and incubated with primary antibodies overnight at 4 °C in blocking buffer. Anti-GAPDH antibodies were used as a loading control. Blots were washed 3X with TBS, and incubated with horseradish peroxidase (HRP)-labeled secondary antibody at room temperature for 1h under gentle shaking. The blots were washed again with TBS and then developed with chemiluminescent substrate (EasySeeVR Western Blot Kit, TransGen Biotech, Beijing, China) for 1 min. Signals were detected by exposure of the blots to x-ray film. The list of antibodies is shown in table 2.
Immunohistochemistry
For PGAM1 IHC, thin sections from LNM tissue, CIS tissues and matched paracancerous tissues of GC patients were embedded in paraffin, deparaffinized by xylene and dehydrated by using graded alcohol solutions. The sections were incubated in 0.01 M citrate buffer (pH 6.0) to rehydrate at 121 °C for 2 min in a pressure vessel. Sections were incubated in 3% hydrogen peroxide at room temperature for 15 minutes to eliminate the activity of endogenous peroxidase, washed three times with PBS, blocked with PBS containing 5% BSA (No. p0007, Beyotime Institute of Biotechnology, Haimen, China) at room temperature for 30 minutes and incubated with primary antibody at 4°C overnight. After washing with PBS, secondary antibody (UltraSensitiveTM SP (Mouse/Rabbit) IHC Kit, KIT-9710, Maixin, FuZhou, China) was added to samples and incubated at room temperature for 20 min, and the chromogenic reaction was activated with DAB (DAB-0031, Maixin, FuZhou, China). Hematoxylin was added as a counterstain. The expression of PGAM1 in samples was observed and photographed with an inverted microscope. Scoring was performed by two people in a double-blind reading, and compared to unstained sections as a negative control. The positive cells in five visual fields of each slice were counted and graded according to the following standard, unstained, zero points, negative; faint yellow, one points, weak positive; pale brown, two points, moderately positive; dark brown, three points, strong positive. The percentage of positive cells was graded as follows: <10%, zero points; 11%-25%, one points; 26%-50%, two points, 51%-75%, three points, >75%, four points. By multiplying positive cell score and percentage score, ≤ 6 defined as low expression, >6 defined as high expression.
The in vivo effect of PGAM1 in a murine GC xenograft model
Experimental mouse protocols were approved by the Ethics Committees of the First Hospital of Jilin University (License No. 2020-0455), and all experimental procedures conformed to IACUC policy. Immunodeficient NPSG (NOD-Prkdcscid IL2rgtm201(-/-)/V) mice (male, 6 weeks old) were obtained from Beijing GeneX Health Co. ltd and maintained in specific pathogen-free (SPF) conditions. Mice were randomly divided into four groups (n=6). Each cohort of mice received a subcutaneous injection in the flank with one of the four cell lines: BGC823 or SGC7901, control cells or with PGAM1 knockdown (5×106 cells per mouse in 0.1ml DMEM/Matrigel (1:1 v/v). All mice were fed under standardized animal house conditions (12 h light/dark cycle at 22 °C, and relative humidity 50%) with free access to food and water. The growth of tumors was measured every week using calipers. The tumor size was calculated according to the following formula: V=1/2×ab2 [maximum (a) and minimum (b) length of the tumor]. After approximately 6 weeks, mice were sacrificed, and the tumors were measured and weighed.
Data Analysis.
GraphPad Prism 7 software and spss 25.0 software were used to perform statistical analysis for all data. The results were analyzed using the Student’ t test or Kruskal-Wallis test. Data were presented as the mean ± SD. Statistical significance was defined as p < 0.05.