Clinic data collection
The study was approved by the Affiliated Hospital Ethics Committee of Youjiang Medical University for Nationalities (Baise, Guangxi Province, P.R. China) and informed consent was obtained from all participants. 91 newly diagnosed patients with LN and 64 healthy controls were selected in this study. All participants were initially diagnosed with LN from May 2019 to May 2021 at the Affiliated Hospital of Youjiang Medical University for Nationalities. Patients with LN were aged 42±16 years with mean proteinuria of 7.9±1.4g/24h and a mean estimated GFR of 69±20mL/min/1.73m2 . SLE was diagnosed according to the revised criteria of the American Rheumatism Association in 1997. Patients were clinically diagnosed as LN by kidney biopsies according to the International Society of Nephrology (ISN)/Renal Pathology Society classification[11].
All patients with LN were divided into two subgroups as active LN (score≥10) and inactive LN (score<10) according to SLEDAI-2K or for LN with renal damage (GFR< 60ml/min) and without renal damage (GFR≥60ml/min) according to patients’ renal function. The definition of leukopenia was that the white blood cell count was <3.5 ×10 9 /L. The definition of anemia was that the hemoglobin was <110g/L for female (<120g/L for male). The definition of thrombocytopenia was that the blood platelet count was <100×109/L. Patients with C-reactive protein (CRP) of more than 3mg/L were defined as elevated. Serum complement of C3 <580mg/L and complement of C4 < 70mg/L were regarded as decreasedAll patients have signed the informed consent forms. Laboratory test results (including routine blood tests, GFR, C3, C4, anti-Sm antibody) were collected before treatment. Peripheral blood was collected from patients with LN before they received any immunosuppressive treatment which included glucocorticoid and an immunosuppressant[11]. An aliquot of the collected fresh blood sample was used for PCR, and the serum was extracted in the rest of the samples and stored at -80°C for later use.
Cell culture
RAW264.7 cells were obtained from the Beina Chuanglian Biology Research Institute (BNCC300973, Beijing, China). Cells were cultured in DMEM (Gibco) with 10% fetal bovine serum (Gibco) at 37°C in a 5% CO2 incubator. RAW264.7 cells were infected with lentiviral vector particle-CX3CL1 and Ubi-MCS-3FLAG-SV40-Cherry-IRES-negative control according to manufacturer's protocol (Shanghai GeneChem Co., Ltd.) to achieve FKN overexpression. RAW264.7 cells were infected with lentiviral vector particle-CX3CL1 and hU6-MCS-CBh-gcGFP-IRES-negative control according to manufacturer's protocol (Shanghai GeneChem Co., Ltd.) to achieve FKN knockdown. Stable cell lines were selected by adding puromycin in the culture medium[16]. Cells were divided into 12 groups as follows:
- control group with no treatment
- IFN-γ group: cells were infected with IFN-γ (Peprotech, Cranbury, NJ, USA) (the IC50 for RAW264.7 cells was 400ng/mL) 400ng/mL for 48 hours
- VP (Hippo signaling pathway inhibitor) group: cells were infected with Verteporfin (HY-B0146 MCE, MedChemExpress, NJ, USA) (the IC50 for RAW264.7 cells was 2uM) 2uM for 48 hours
- IFN-γ+VP group: cells were treated with 400ng/mL IFN-γ and 2uM VP for 48 hours
- Ex-FKN group
- Ex-FKN+IFN-γ group: ex-FKN cells infected with 400ng/mL IFN-γ for 48 hours
- Ex-FKN+VP group: ex-FKN cells infected with 2uM VP for 48 hours
- Ex-FKN+IFN-γ+VP group: ex-FKN cells were treated with 400ng/mL IFN-γ and 2uM VP for 48 hours
- Si-FKN group
- Si-FKN+IFN-γgroup: si-FKN cells infected with 400ng/mL IFN-γ for 48 hours
- Si-FKN+VP group:si-FKN cells were infected with 2uM VP for 48 hours
- Si-FKN+IFN-γ+VP group: si-FKN cells were treated with 400ng/mL IFN-γ and 2uM VP for 48 hour.
Mice
2-3-month-old (22-28g) specific pathogen- free (SPF) WT C57BL/6 mice (FKN+/+) and KO-FKN C57BL/6 mice (FKN−/−) were purchased from Shanghai Genechem Animal Co. Ltd (NO.SYXK 2015-0008). For KO-FKN mice, CRISPR/Cas9 technology was used to construct an sgRNA sequence (CX3CL1-sgRNA1:CTGGCAGGTTATCACGGGTTGGG;CX3CL1-sgRNA2:TGGCAGTAACTCATACGTCCTGG) that targeted the FKN gene locus. The surviving embryos after injection with CRISPR/Cas9 mRNA were raised to adulthood, and then the founders with FKN knockout were selected. Before the experiment, mice were maintained in a room with controlled temperature (23 ± 1℃), humidity and lighting (12-h light/12-h dark cycle), and given free access to food and water[16]. The animal experiment protocol was approved by the animal experiment ethics of Youjiang Medical University for Nationalities and carried out in compliance with the Animals in Research: Reporting In vivo Experiments (ARRIVE) guidelines. All animal procedures were in accordance with the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 85–23, revised 1996).
8-10 weeks old WT and KO-FKN (FKN-/-) female mice were selected, and an LN mouse model was induced by a single intraperitoneal injection of 0.5mL pristane (P815856, Shanghai Macklin Biochemical Co., Ltd). When constructing the model, different parameters including the mouse body weight, joint diameter and urine protein concentration as well as the anti-ANA, anti-Sm and anti-dsDNA antibody concentration were measured every 4 weeks. The LN models of WT and FKN-/- mice were established approximately 4-6 months later. Subsequently, the mice were randomly divided into 8 groups with 3-5 animals in each group):
- WT group: WT mice were intraperitoneally injected with 500uL of normal saline every day for 10 consecutive days
- WT+VP group: VP was dissolved in dimethyl sulfoxide (DMSO, 0.05% v/v), and DMSO (0.05%v/v) was used as the vehicle. WT mice were intraperitoneally injected with VP (100mg/kg) daily for 10 days.
- LN group: LN mice were intraperitoneally injected with 500uL of normal saline every day for 10 consecutive days.
- LN+VP group: LN mice were intraperitoneally injected with VP (100mg/kg) daily for 10 days
- KO-FKNgroup: KO-FKN mice were intraperitoneally injected with 500uL of normal saline every day for 10 consecutive days
- KO-FKN+VP group: KO-FKN mice were intraperitoneally injected with VP (100mg/kg) daily for 10 days
- KO-FKN-/-+LN group: KO-FKN mice with LN were intraperitoneally injected with 500uL of normal saline every day for 10 consecutive days
- KO-FKN+LN+VP group: KO-FKN mice with LN were intraperitoneally injected with VP (100mg/kg) daily for 10 days.
Then, the mice were sacrificed after the last injection 10 days later. The animals were weighed and anaesthetized with 1% pentobarbital (35 ml/kg i.p.), and kidney samples were collected for histological examination and immunofluorescence staining. Some samples were also stored at -80℃ for analysis by western blotting.Great efforts were made to minimize the pain of animals.
ELISA
The collected serum was used for ELISAs. The following ELISA kits were purchased including YAP (JL45328, Shanghai Jianglai Co. Ltd.), TAZ (JL19183, Shanghai Jianglai Co. Ltd.), MST (CSB-E09062h, Cusabio Biotech Co. Ltd), IL-6 (CSB-E04638h, Cusabio Biotech Co. Ltd.) and IL-10 (CSB-E04593h, Cusabio Biotech Co. Ltd.) and used according to the manufacturers’ instructions. A TriStar LB941 multimode microplate reader was used to measure the absorbance at 450 nm.
Renal function measurements
Metabolic cages (Nalgene, Rochester) were used to collect mice urine samples for a 24-hour period. Urinary protein collected over 24 hours was measured using a urine protein assay kit (C035-2-1, Jiancheng Bioengineering Institute) according to the manufacturer's instructions. The stored mouse serum was used to measure blood urea nitrogen (BUN) and serum creatinine (Scr) in order to assess renal function. A BUN assay kit (C013-2-1, Jiancheng Bioengineering Institute) and a creatinine assay kit (C011-2-1, Jiancheng Bioengineering Institute) were respectively used to measure the serum levels of Scr and BUN of mice according to the manufacturer's instructions.
Cells viability assay
A cell counting kit (M4839, AbMole, Beijing, China) was used to assess the viability of cells. RAW264.7 cells were seeded into 96-well plates at 5×103 cells per well and then treated with different concentrations of IFN-γ (100, 200, 300 and 400 ng/mL) and VP (0, 0.5, 1and 2 μM) for 24, 48 and 72 hours. 10 μL CCK-8 was added to each well and incubated for 1 hour at 37°C in an incubator in an atmosphere of 5% CO2 after the treatment with IFN-γ and VP. The OD was measured using a TriStar LB 941 multimode microplate reader (Berthold Technologies, Germany) at 450 nm.
Cell apoptosis assay
The fluorescein isothiocyanate-annexin V/propidium iodide (FITC-annexin V/PI) apoptosis kit (556 547, BD Biosciences) was used to assess cell apoptosis. Cells in different groups were cultured for 48 hours, collected, washed twice with PBS buffer, and buffer was added to adjust the RAW264.7 cell concentration to 1x105 cells/mL. 5 μL of FITC-annexin V/PI was added, then incubated for 15min at room temperature in the dark. The apoptosis rate was measured within 1 hour after adding 400 μL of buffer by flow cytometry.
HE, PASM and Masson staining
Kidney tissue samples were fixed in 10% formalin and then embedded in paraffin for histopathology. 3-4 µm serial sections dewaxed and hydrated and then stained with haematoxylin-imidine red (HE), Masson and periodic acid-silver methenamine (PASM) stains according to standard procedures. These sections were subsequently visualized using a light microscope (Nikon Eclipse E100).
Immunofluorescence assay
RAW.267.4 cells (5×103 cells/well) were seeded into glass bottom cell culture dishes (IBIDI, Germany) for 72 hours. After the slides were dried slightly, 50-100μL of a rupture working solution was added, incubated at room temperature for 20min and washed 3 x 5min with PBS. Then 3% BSA was added to cover the tissue section evenly, and then these were sealed at room temperature for 30 minutes. Cells were incubated with fluorescently labelled primary antibodies (anti-FKN, anti-p-YAP, anti-IL-10 or anti-TNF-a) followed by either goat anti-rabbit IgG (H + L) FITC-conjugated antibody (S0008, 1:200, Affinity) or goat anti-mouse IgG (H + L) Fluor594-conjugated antibody (S0005, 1:200, Affinity). Finally, cells were incubated with DAPI for 10 minutes and imaged using an Olympus Fluoview 3000 Confocal Laser Scanning Microscope (FV3000, Olympus and Tokyo) the cells and collect the images[16].
Mice kidney sections were prepared according to standard procedures. The primary antibodies used included anti-F4/80, anti-p-YAP, anti-IL-10 and anti-TNF-a followed by secondary antibody staining as described above for cells. An Olympus Fluoview 3000 Confocal Laser Scanning Microscope was used as described above.
Western blotting
50ug total protein extracts were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to PVDF transfer membranes (Thermo Scientific, Illkirch, France). The membranes were incubated overnight at 4°C with different antibodies. The primary antibodies used for western blotting were rabbit anti-FKN(DF12376,1:1000, Affinity), rabbit anti-iNOS(AF0199, 1:1000, Affinity), rabbit anti-YAP (DF3182, 1:1000, Affinity), rabbit anti-phospho-YAP (AF3328, 1:1000, Affinity), rabbit anti-TAZ (DF4653, 1:1000, Affinity), rabbit anti-phospho-TAZ (AF4316, 1:1000, Affinity), rabbit anti-TNF-α (AF7014, 1:1000, Affinity), rabbit anti-IL-10 (DF6894, 1:1000, Affinity), anti-Arg-1 (DF6657, 1:1000, Affinity), rabbit monoclonal FKN antibody (ab25091, 1:1000, Abcam), rabbit anti-iNOS (18985 1:1000, Proteintech), rabbit anti-MST1 (3682, 1:3000, CST) and rabbit anti-MST (DF8430, 1:1000, Affinity). The membranes were then incubated with either goat anti-rabbit IgG (S0001,1:5000,Affinity) or goat anti-mouse IgG (S0002, 1:5000, Affinity) for 60 minutes at room temperature, then exposed to an enhanced chemiluminescence substrate (KF003, Affinity) and visualized using a Tanon-5200 (Tanon, Shanghai, China)[16].
Preparation of PBMCs and RT-qPCR
Five milliliters of peripheral blood were collected in evacuated tubes containing EDTA as the anticoagulant. PBMCs were purified from peripheral blood by centrifugation. The One-step Trizol-based procedure was used for total RNA extraction from freshly isolated PBMCs. RNA was reverse transcribed into cDNA after the purity and concentration was checked. The YAP primer sequence was: forward primer 5′-GCTTCCCCGACTACCTG-3′, reverse primer 5′- CACAGACTCCACGTCCAA-3′ with a product size of 146bp. The MST1 primer sequence was: forward primer 5′-GCAGTGTGCGTTTCCAGA-3′, reverse primer 5′-CAGGTCCCAGCGTTGAC-3′ with a product size of 131bp. The TAZ primer sequence was: forward primer 5′-AGGGAGGGAACAGAGCA-3′, reverse primer 5′-GTGAGCAGTGGGCAAGTAG-3′ with a product size of 123bp. The internal reference GAPDH primer sequence was: forward primer 5′-CAGGAGGCATTGCTGATGAT-3′, reverse primer 5′-GAAGGCTGGGGCTCAGGG-3′ with a product size of 84bp. The PCR reaction system consisted of a SYBR Green Mix, forward and reverse primers, cDNA and deionized RNAase-free water. The PCR was initially denatured at 95 °C for 30s followed by 95°C for 10s and 65°C for 30s for 40 cycles and 81 cycles at 55-95°C for 10 s for the melting curve analysis. After the cycle threshold (Ct) was determined, the expression of YAP,TAZ and MST1 mRNA was quantified according to the reference gene and analyzed by using the 2-△△Ct method[16].
Statistical analysis
Histograms and data are shown as mean±SD of a minimum of three independent experiments. SPSS 23.0 and GraphPad Prism 8.0 were used to analyze all statistical data. P<0.5 was considered to be statistically significant.