The conversion of somatic cells back into induced pluripotent stem cells (iPSCs) or embryonic-like stem cells involves the introduction of four genes commonly called Yamanaka factors, i.e., Sox2, Oct4, Klf4, and c-Myc, into the cells. Because these genes and the viral vectors used to introduce them into cells have the potential to cause cancer, iPSC lines are not clinically useful. Most instances of direct reprogramming have achieved have been by the forced expression of defined factors using viral vectors. Here, we show that Metadichol® has the potential to generate iPSCs non-virally and may be helpful in clinical applications. Metadichol is a nanoformulation of long-chain alcohols derived from food. Quantitative real-time PCR (qRT-PCR) and western blotting showed that OCT4, SOX2, and Nanog are expressed when fibroblasts were treated with Metadichol at one picogram to 100 nanograms. Reverse-transcription PCR (RT-PCR) also revealed that OCT4, KLF4, Nanog, and Sox2 levels increased compared to controls by 4.01-, 3.51- and 1.26-, and 2.5-fold, respectively, in A549 cancer cells. In Colo-205 cells, OCT4, KLF4, and Sox2 were increased by 1.79-, 13.17-, and 2.25-folds, respectively. Metadichol treatment with triple-negative primary breast cancer (HCAF-TNPBC) primary cancer cells led to multifold increases of OKSM factors by 19-, 6-, 8.07-, 2.45-, and 6.91-folds in concentration ranges 1picogram to 100 nanograms. Metadichol is a natural product that induces the expression of Yamanaka factors needed for reprogramming and Klotho, an anti-aging gene, and curbs the expression of the TP53 gene, which is critical for reprogramming somatic cells into IPSCs.Metadichol increases endogenous vitamin C levels, leading to the efficient reprogramming of somatic cells into iPSCs. Metadichol is nontoxic and commercially available as a nutritional supplement. Thus, it can be directly tested in vivo in human subjects to confirm that cells can indeed be programmed into a state of induced pluripotency and cause the mitigation of disease conditions.
Research Article
Metadichol, A natural ligand for expression of Yamanaka reprogramming factors in somatic and primary cancer cell lines
https://doi.org/10.21203/rs.3.rs-1727437/v1
This work is licensed under a CC BY 4.0 License
Version 1
posted
You are reading this older preprint version
10 October, 2023 Editorial note (correction). This submission initially contained a declaration of no competing interests for this submitted work; however, the author has now provided a corrected competing interest declaration as follows: The author, PR Raghavan, is the CEO of Nanorx Inc., the manufacturer of the Metadichol® supplement mentioned in this work, and, as such, has professional and financial interests related to research outcomes of this supplement.
Editorial notes are used to provide important context regarding the topic of a preprint or to alert readers to potential issues concerning that preprint or a downstream publication associated with it. For more information on editorial notes, see our Editorial Policies.
Yamanaka factors
OCT4
SOX2
MYC
OKSM factors
VDR
P53
Reprogramming cells
Somatic
IPSC
Klotho
Primary cancer cell lines
In 2006, Dr. Yamanaka and his group (1) showed that somatic cells could are programmed using just four genes, i.e., Oct4, Sox2, Klf4, and c-Myc (OSKM; also called Yamanaka factors). These genes are used to reprogram adult mouse fibroblasts (connective tissue cells) into an embryonic state known as pluripotency. Pluripotent cells are similar to embryonic stem cells and can become any other cell type in the body.
In 2011, a French researcher, Jean-Marc Lemaitre, added two additional factors (Nanog and LIN28) to the Yamanaka factors and reported comparing aged fibroblasts from healthy older adults and healthy people over 100 years old. These factors lead to cellular rejuvenation. The six factors mentioned above can reprogram cells into induced pluripotent stem cells (iPSCs), which can convert to any other cell type in the body (2). Kromer et al. (3) showed that aged cells such as fibroblasts have short telomeres and dysfunctional mitochondria.
It is relatively easy to isolate cells in a dish, revert them to a developmental state, and then reprogram them into the desired cells using Yamanaka factors. However, this is not practical in living animals because cell memory cannot be erased and reverted to a pluripotent state. It is also possible that the expression of Yamanaka factors causes cancer in animals (4).
Belmonte and his team reported that the cells and organs of living animals could be rejuvenated (5). The research group used a specially engineered mouse strain designed to age more rapidly than usual and an engineered normally aging mouse strain. These mice were engineered to express Yamanaka factors upon exposure to the antibiotic doxycycline in drinking water. Moreover, allowing transient expression of Yamanaka factors for two days > was followed by silencing of these factors upon the removal of doxycycline from the animals’ drinking water.
In late 2020, David Sinclair restored vision in aged mice and mice with damaged retinal nerves using partial cellular reprogramming (6). Only three factors were used, and MYC was removed to reduce cancer risk. This strategy also alleviated age-related vision impairment in treated mice and mice that experienced increased eye pressure, an indicator of glaucoma.
In 2021, researchers exposed cells to OSKM via a doxycycline-inducible lentiviral system, as in previous animal studies (7). This strategy reversed fibroblast cell aging by 30 years, allowing aged cells to function similarly to those in a person approximately 25 years of age.
For the Translation of partial cellular reprogramming strategies in humans, it is necessary to identify a method for inducing Yamanaka factor expression in cells that do not require drugs such as doxycycline.
Other critical challenges related to the clinical application of these cells are their safety and tumorigenic potential when transplanted back into patients (8).
The generation of induced pluripotent stem cells (iPSCs) with viral integration and the use of viruses to deliver transcription factors are associated with tumorigenesis (9). There is a need for reprogramming protocols that do not require permanent genomic integration or viral vectors. Such protocols represent the future of regenerative medicine.
Deng et al. (10) reported that a combination of specific small molecules could reprogram mouse fibroblasts into iPSCs via a single transcription factor, Oct4, eliminating the need for Sox2, Klf4, and c-Myc expression. This finding brought us closer to achieving the generation of iPSCs using small molecules without any genetic modification. Other small molecules that can eliminate the need for exogenous Oct4 expression are needed.
Herein, we show that Metadichol (11), a small nontoxic molecule, naturally induces the expression of Yamanaka factors in vitro in fibroblasts and A549 and Colo-205 cancer cells and primary cancer cell lines.
Experimental procedures – quantitative PCR (qPCR), western blotting, and cell culture
All work was carried out by a service provider, Skanda Life sciences, Bangalore, India.
Chemicals and reagents
A549 cells, Colo-205 cells, and human cardiac fibroblast cells were from the ATCC, USA. Primary breast cancer cells from BIOIVT, Detroit, Michigan, USA. Primary antibodies from either ABclonal, Woburn, Massachusetts, USA, and E-lab science, Maryland, USA. Primers were sourced from SahaGene, Hyderabad, India (Table 1). Other molecular biology reagents were from Sigma Aldrich.
| 1 | OCT4 | F | GTTGATCCTCGGACCTGGCTA | 134 |
| R | GGTTGGCTCACTCGGTTCT | |||
| 2 | P53 | F | GGCCCACTTCACCGTACTAA | 278 |
| R | GTGGTTTCAAGGCCAGATGT | |||
| 3 | KLF4 | F | CCCACACAGGTGAGAAACCT | 199 |
| R | ATGTGTAAGGCGAGGTGGTC | |||
| 4 | SOX2 | F | AACCCCAAGATGCACAACTC | 234 |
| R | CGGGGCCGGTATTTATAATC | |||
| 5 | c-MYC | F | CCATCCAGGTGAACCACCTA | 241 |
| R | ATCTCCGAACACATCACTTC | |||
| 6 | NANOG | F | ATCTGCTGGAGGCTGAGGTA | 180 |
| R | GTGGTTTCAAGGCCAGATGT | |||
| 7 | KLF 2 | F | CTTCTCTCGACGCCATCTCC | 160 |
| R | AGCCATCCAAAAGCCCCATT | |||
| 8 | KLOTHO | F | AGGGTCCTAGGCTGGAATGT | 158 |
| R | CCTCAGGGACACAGGGTTTA |
Maintenance and seeding
The cells were maintained in the appropriate medium, with or without the required supplements and 1% antibiotics, in a humidified atmosphere of 5% CO2 at 37°C. The medium was changed every other day until the cells reached confluency. The viability of the cells was assessed using a hemocytometer.
When the cells reached 70–80% confluence, single-cell suspensions containing 106 cells/mL were prepared and seeded in 6-well plates at a density of 1 million cells per well. The cells were incubated for 24 h at 37°C in 5% CO2. After 24 h, the cell monolayer was rinsed with serum-free medium and treated with Metadichol at predetermined concentrations.
Cell treatments
Different concentrations of Metadichol (1 pg/mL, 100 pg/mL, 1 ng/ml, and 100 ng/mL) were prepared in serum-free medium. Subsequently, a Metadichol-containing medium was added to predesignated wells. Control cells received medium without the drug. The cells were incubated for 24 h. After treatment, the cells were gently rinsed with sterile PBS. Whole-cell RNA was isolated using TRIzol reagent (Invitrogen) per the manufacturer’s instructions, and cDNA was prepared. The samples were analyzed by qPCR and western blotting for various biomarkers.
Quantitative real-time PCR (qRT-PCR)
RNA isolation
Total RNA was isolated from each treatment group using TRIzol. Approximately ~ 1×106 cells were collected in 1.5 mL microcentrifuge tubes. The cells were centrifuged at 5000 rpm for 5 min at four °C, and the cell supernatant was discarded. Then, 650 µL of TRIzol was added to the pellet, and the contents were mixed well and incubated on ice for 20 min. Subsequently, 300 µL of chloroform was added to the mixture, and the samples were mixed well by gentle inversion for 1–2 min and incubated on ice for 10 min. The samples were centrifuged at 12000 rpm for 15 min at four °C. The upper aqueous layer was transferred to a new, sterile 1.5 mL centrifuge tube, and an equal amount of prechilled isopropanol was added to the tube. The samples were incubated at -20°C for 60 min. After incubation, the mixture was centrifuged at 12000 rpm for 15 min at four °C. The supernatant was discarded carefully, and the RNA pellet was retained. The pellet was washed with 1.0 mL of 100% ethanol, followed by 700 µL of 70% ethanol via centrifugation, as described above, after each step. The RNA pellet was air-dried at RT for approximately 15–20 min and then resuspended in 30 µL of DEPC-treated water. The RNA concentration was quantified using a Spectradrop (Spectramax i3x, USA) spectrophotometer (Molecular Devices), and cDNA was synthesized using reverse-transcription PCR (RT-PCR).
cDNA synthesis
cDNA was synthesized from 2 µg of RNA using the PrimeScript cDNA synthesis kit (Takara) and oligo dT primers per the manufacturer’s instructions. The reaction volume was 20 µL, and cDNA synthesis was performed on an Applied Biosystems instrument (Veritii). The cDNA was used for qPCR (50°C for 30 min followed by 85°C for 5 min).
Primers and qPCR
The PCR mixture (final volume of 20 µL) contained 1 µL of cDNA, 10 µL of SYBR green Master Mix, and one µM complementary forward and reverse primers specific for the respective target genes. The samples were run under the following conditions: initial denaturation at 95°C for 5 min, followed by 30 cycles of secondary denaturation at 95°C for 30 s, annealing at the optimized temperature for 30 s, and extension at 72°C for 1 min. The number of cycles that allowed amplification in the exponential range and without reaching a plateau was selected as the optimal number of cycles. The obtained results were analyzed using CFX Maestro software.
Fold change was calculated using the following equation.
(ΔΔCT Method)
The comparative CT method determined the relative expression of target genes to the housekeeping gene (β-actin) and untreated control cells.
Delta CT for each treatment was calculated using the formula.
Delta Ct = Ct (target gene) – Ct (reference gene)
To compare the delta Ct of individually treated samples with the untreated control sample, the Ct was subtracted from the control to get the delta delta CT.
Delta delta Ct = delta Ct (treatment group) – delta Ct (control group)
The fold change in target gene expression for each treatment was calculated using the formula. Fold change = 2^ (− delta delta Ct)
Protein isolation
Total protein was isolated from 106 cells using RIPA buffer supplemented with the protease inhibitor PMSF. The cells were lysed for 30 min at four °C with gentle inversion. The cells were centrifuged at 10,000 rpm for 15 min, and the supernatant was transferred to a fresh tube. The Bradford method determined the protein concentration, and 25 µg of protein was mixed with 1× sample loading dye containing SDS and loaded onto a gel. The proteins were separated under denaturing conditions in Tris-glycine buffer.
The proteins were transferred to methanol-activated PVDF membranes (Invitrogen) using a Turbo transblot system (Bio-Rad, USA). Non-specific binding to the membranes was blocked by incubation in 5% BSA for one h. The membranes were incubated overnight with the respective primary antibody at four °C, followed by a species-specific secondary antibody for one h at RT. The blots were washed and incubated with ECL substrate (Merck) for 1 min in the dark. Images were captured at appropriate exposure settings using a ChemiDoc XRS system (Bio-Rad, USA).
Table 2: RT-PCR results of Metadichol treatment with human cardiac fibroblasts (HCFs)
Summary of results: qRT-PCR
Table 2: RT-PCR results of Metadichol treatment with human cardiac fibroblasts (HCFs)
| Cancer cell lines (Fold Increase) | ||||||
|---|---|---|---|---|---|---|
| A549 lung carcinoma cell line | P53 | Oct4 (Pou5F1) | Klf4 | Nanog | SOX2 | Klotho |
| Concentration of Metadichol | Fold increase | Fold increase | Fold increase | Fold increase | Fold increase | Fold increase |
| Control | 1 | 1 | 1 | 1 | 1 | 1 |
| 1 picogram | No expression | 0.27 | 1.05 | 0.82 | 0.47 | 0.37 |
| 100 picograms | No expression | 0.92 | 0.44 | 0.82 | 0.80 | 0.60 |
| 1 nanogram | No expression | 4.01 | 3.51 | 1.26 | 2.51 | 1.99 |
| 100 nanograms | No expression | 1.25 | 1.58 | 0.81 | 0.73 | 0.83 |
| Colo-205 pancreatic cancer cell line | ||||||
| Concentration of Metadichol | Fold increase | Fold increase | Fold increase | Fold increase | Fold increase | Fold increase |
| Control | 1 | 1 | 1 | 1 | 1 | 1 |
| 1 picogram | No expression | 0.41 | 2.55 | 1.74 | 2.16 | 1.89 |
| 100 picograms | No expression | 0.88 | 2.98 | 0.68 | 2.21 | 1.22 |
| 1 nanogram | No expression | 1.79 | 13.17 | 0.41 | 2.25 | 2.58 |
| 100 nanograms | No expression | 0.81 | 6.77 | 1.19 | 1.71 | 0.86 |
| Human cancer associated fibroblasts (HCAF) triple negative primary breast cancer (TNPBC | c-MYC | Oct4 (Pou5F1) | Klf4 | SOX2 | Klotho |
|---|---|---|---|---|---|
| Concentration of Metadichol | Fold increase | Fold increase | Fold increase | Fold increase | Fold increase |
| Control | 1 | 1 | 1 | 1 | 1 |
| 1 picogram | 3.36 | 4.56 | 3.36 | 0.57 | 2.13 |
| 100 picograms | 4.39 | 4.94 | 4.39 | 0.62 | 1.10 |
| 1 nanogram | 4.04 | 19.63 | 8.07 | 2.45 | 0.64 |
| 100 nanograms | 6.91 | 9.32 | 6.91 | 1.16 | 1.02 |
Metadichol is a nano emulsion of a mixture of the long-chain chain alcohols C26, C28, and C30; C28 is the primary alcohol (greater than 85% of the mixture). We observed that 100 picograms of Metadichol increased the expression of Yamanaka factors in fibroblasts, whereas one nanogram of Metadichol increased Yamanaka factor expression in cancer cell lines. We did not observe p53 expression in the cancer cell lines. Published reports (12, 13) suggest that the inactivation of p53 markedly increases the efficiency of iPSC production. This shows that p53 deficiency simplifies iPSC generation by allowing the production of iPSCs expressing Oct4 and Sox2.
However, reprogramming human primary cancer cells remains a challenge. Hu et al. (14) successfully reprogrammed primary human lymphoblasts from a BCR–ABL + CML patient using trans-free gene IPSC technology to ectopically express OKSM factors.
The effect of Metadichol on Human cardiac Fibroblasts (sew Table 2) and on Cancer cell lines (A-549) and Pancreatic cancer cell lines COLO 205 are shown in Table 3. and on triple-negative primary breast cancer cells (HCAF-TNPBC primary cancer cells). There are multifold increases in OKSM factors in all these, but interestingly, no increase in p53 expression. Interestingly, Metadichol also induced expression of the Klotho gene. A mutation in the Klotho gene (KL (−/−)) significantly decreases the proliferation of adipose-derived stem cells, which leads to lower expression of pluripotent transcription factors (Nanog, Sox-2, and Oct-4) in mice (15, 16). The expression of these factors is vital for maintaining the pluripotency of stem cells. As a longevity hormone, Klotho protects cells from oxidative stress; simultaneously, as a tumor suppressor, it inhibits the growth of cancer cells (17).
Another critical factor involved in the reprogramming of cells is vitamin C. Numerous studies have shown that adding vitamin C to the culture medium of somatic cells during reprogramming improves the efficiency and quality of iPSC formation (18, 19). Metadichol, as shown in previous studies, increases vitamin C levels in vivo in patients (20–22). iPSC generation via the forced expression of OSKM leads to increased production of reactive oxygen species (ROS), which can cause DNA damage and senescence (23). Owing to its antioxidant properties, vitamin C was initially added to the culture medium of mouse and human cells during reprogramming to mitigate the effects of ROS, which can potentially hamper the efficiency and quality of reprogramming (24).
Compared with other antioxidants, such as glutathione, N-acetylcysteine, vitamin E, and lipoic acid, vitamin C is substantially more efficient at enhancing the generation of mouse ESCs and iPSC from mouse or human fibroblasts (25). Vitamin C can facilitate reprogramming by increasing histone demethylation, and histone demethylases are essential for expressing the ESC master transcription factor Nanog (26). Other studies have shown that vitamin C increases the embryonic stem cell population in humans and leads to DNA demethylation at genomic loci known to undergo widespread loss of methylation during the reprogramming of somatic cells into iPSCs (27).
Analysis of gene networks using Pathway Studio (28, 29) and protein-protein interaction maps shows the formation of a loop feedback network, as shown in Fig. 1. The top 25 most highly significant (p < E-9) cell processes regulated by the gene set are shown in Table 5. A complete list of processes regulated by the subset of genes is available in the supplementary material. The gene network shows the role of TP53, which inhibits key Yamanaka factors Oct4, KLF2, Nanog, and Sox2. Metadichol is an inverse agonist or, more likely, a protean agonist (30) of the Vitamin D receptor (11). Binding to VDR leads to increased Klotho gene expression (31), which blocks the actions of TP53, potentially clearing the way for IPSC conversion
The cell processes regulated by the genes in Fig. 1 are shown in Table 5. There are over 700 significantly changed genes, and almost all are involved in cell differentiation pluripotency maintenance, cellular senescence, Regulation of DNA methylation, fibroblast differentiation, and other vital cellular processes. And stem cell development. These genes have more interactions among themselves than expected for a random set of genes of the same size and degree distribution drawn from the genome. Such an enrichment indicates that the group of genes shares a significant biological connection through their involvement in cell pluripotency processes.
Summary and conclusion
Our study shows that the forced programming of external Yamanaka factors and grafting with viruses are not needed for reprogramming. Metadichol is a safe compound (with an LD50 of over 5000 mg/kg in rats (32–34) and is commercially available as a supplement. The knockdown of tumor suppressor genes, such as p53, enhances reprogramming efficiency (35, 36). Cancer cell reprogramming can safely, precisely, and effectively reactivate silenced tumor suppressor genes, e.g., Klotho, as we have demonstrated. Additionally, vitamin C plays a critical role in cell reprogramming by mitigating ROS effects, which can increase the expression of Yamanaka factors. Given the effect of Metadichol on the expression of critical genes involved in the reprogramming of somatic cells, the effects of Metadichol should be assessed in patients to see if the in vitro results translate to in vivo effects. Previous studies (37, 38) of treating various skin diseases with Metadichol showed skin renewal, including wound healing and rejuvenation. Such a strategy to harness the body’s cells, thus avoiding the incompatibility issues associated with external donor cell sources, would likely be effective in mitigating many human diseases, including cardiovascular and neurological disorders.
| Cell processes regulated by entities enriched in input genes | Total # of Neighbors | Overlap | Percent Overlap | Overlapping Entities | p-value |
|---|---|---|---|---|---|
| Protein regulators of messenger RNA synthesis | 615 | 9 | 1 | POU5F1,KLF4,NANOG,MYC,KL,KLF2,VDR,SOX2,TP53 | 4.2643E-13 |
| Protein regulators of cancer stem cell population | 203 | 7 | 3 | POU5F1,KLF4,NANOG,MYC,VDR,SOX2,TP53 | 3.383E-12 |
| Protein regulators of cancer stem cell differentiation | 100 | 6 | 5 | POU5F1,KLF4,NANOG,MYC,SOX2,TP53 | 7.7156E-12 |
| Protein regulators of cell renewal | 938 | 9 | 0 | POU5F1,KLF4,NANOG,MYC,KL,KLF2,VDR,SOX2,TP53 | 1.9437E-11 |
| Protein regulators of dedifferentiation | 969 | 9 | 0 | POU5F1,KLF4,NANOG,MYC,KL,KLF2,VDR,SOX2,TP53 | 2.6076E-11 |
| Protein regulators of stem cell development | 529 | 8 | 1 | POU5F1,KLF4,NANOG,MYC,KL,KLF2,SOX2,TP53 | 2.6336E-11 |
| Protein regulators of cell transdifferentiation | 976 | 9 | 0 | POU5F1,KLF4,NANOG,MYC,KL,KLF2,VDR,SOX2,TP53 | 2.7829E-11 |
| Protein regulators of cancer stem cell development | 48 | 5 | 10 | POU5F1,NANOG,MYC,SOX2,TP53 | 4.0368E-11 |
| Protein regulators of cancer stem cell renewal | 144 | 6 | 4 | POU5F1,KLF4,NANOG,MYC,SOX2,TP53 | 7.156E-11 |
| Protein regulators of cancer stem cell proliferation | 147 | 6 | 4 | POU5F1,KLF4,NANOG,MYC,SOX2,TP53 | 8.1118E-11 |
| Protein regulators of cell maturation | 1156 | 9 | 0 | POU5F1,KLF4,NANOG,MYC,KL,KLF2,VDR,SOX2,TP53 | 1.284E-10 |
| Protein regulators of endothelial cell homeostasis | 64 | 5 | 7 | KLF4,NANOG,MYC,KL,KLF2 | 1.7908E-10 |
| Protein regulators of trophoblast differentiation | 375 | 7 | 1 | POU5F1,KLF4,NANOG,MYC,VDR,SOX2,TP53 | 2.5516E-10 |
| Protein regulators of cancer stem cell phenotype | 383 | 7 | 1 | POU5F1,KLF4,NANOG,MYC,KLF2,SOX2,TP53 | 2.9585E-10 |
| Protein regulators of cell plasticity | 385 | 7 | 1 | POU5F1,KLF4,NANOG,MYC,KL,SOX2,TP53 | 3.0685E-10 |
| Protein regulators of cell dedifferentiation | 389 | 7 | 1 | POU5F1,KLF4,NANOG,MYC,KL,SOX2,TP53 | 3.2989E-10 |
| Protein regulators of gene repression | 737 | 8 | 1 | POU5F1,KLF4,NANOG,MYC,KLF2,VDR,SOX2,TP53 | 3.7447E-10 |
| Protein regulators of stem cell function | 764 | 8 | 1 | POU5F1,KLF4,NANOG,MYC,KL,VDR,SOX2,TP53 | 4.9918E-10 |
| Protein regulators of stem cell maintenance | 779 | 8 | 1 | POU5F1,KLF4,NANOG,MYC,KL,KLF2,SOX2,TP53 | 5.8304E-10 |
| Protein regulators of stem cell fate determination | 81 | 5 | 6 | POU5F1,KLF4,NANOG,MYC,SOX2 | 5.9944E-10 |
| Protein regulators of blastocyst formation | 208 | 6 | 2 | POU5F1,KLF4,NANOG,KL,SOX2,TP53 | 6.6392E-10 |
| Protein regulators of stem cell fate | 473 | 7 | 1 | POU5F1,KLF4,NANOG,MYC,VDR,SOX2,TP53 | 1.2955E-09 |
| Protein regulators of nuclear reprogramming | 497 | 7 | 1 | POU5F1,KLF4,NANOG,MYC,KLF2,SOX2,TP53 | 1.8304E-09 |
| Protein regulators of cellular senescence | 1563 | 9 | 0 | POU5F1,KLF4,NANOG,MYC,KL,KLF2,VDR,SOX2,TP53 | 1.9549E-09 |
| Protein regulators of stem cell fate commitment | 262 | 6 | 2 | POU5F1,KLF4,NANOG,MYC,SOX2,TP53 | 2.6661E-09 |
Funding
This study was supported by the Research & Development budget of Nanorx Inc. NY USA
Availability of data and materials
All raw data are presented in supplementary materials.
Competing interests
The author declares no competing financial interests.
|
Symbol |
Full Name |
|
KL |
klotho |
|
KLF2 |
Kruppel like factor 2 |
|
KLF4 |
Kruppel like factor 4 |
|
MYC |
MYC proto-oncogene, bHLH transcription factor |
|
NANOG |
Nanog homeobox |
|
POU5F1 ( OCT 4) |
POU class 5 homeobox 1 |
|
SOX2 |
SRY-box transcription factor 2 |
|
TP53 |
tumor protein p53 |
|
VDR |
vitamin D receptor |
|
IPSC |
Induced Pluripotent Stem Cell |
- Takahashi, K., & Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 126(4), 663–676.
- Jean-Marc Lemaitre, et.al, Genes & development, 25(21), 2248–2253.
- Kroemer, G. et.al, (2013). The hallmarks of aging. Cell, 153(6), 1194–1217.
- Abad, M, et.al, (2013). Reprogramming in vivo produces teratomas and iPS cells with totipotency features. Nature, 502(7471), 340].
- Belmonte JC et al. In vivo amelioration of age-associated hallmarks by partial reprogramming. Cell. 2016;167:1719–33.].
- Sinclair, D. A. (2020). Reprogramming to recover youthful epigenetic information and restore vision. Nature, 588(7836), 124–129].
- Reik, W. (2021). Multi-omic rejuvenation of human cells by maturation phase transient reprogramming.eLife. 2022; 11: e71624].
- Tan Y, Ooi S, Wang L. Immunogenicity and tumorigenicity of pluripotent stem cells and their derivatives: genetic and epigenetic perspectives. Curr Stem Cell Res Ther. 2014;9:63–72.
- Liu C-B. Non-viral methods for generating integration-free, induced pluripotent stem cells. Curr Stem Cell Res Ther. 2015;10:153–8
- Deng et.al., Generation of iPSCs from mouse fibroblasts with a single gene, Oct4, and small molecules. Cell Research (2011) 21:196–204.
- P. R. Raghavan, Policosanol Nanoparticles, US patent 8,722093 B2 (May 2014); Policosanol Nanoparticles, US patent 9,034,383 B2 (May 2015); Metadichol Liquid and Gel Nanoparticle formulations US patent 9,006,292 B2(April 2015).
- Hong H, et al.2009. Suppression of induced pluripotent stem cell generation by the p53–p21 pathway. Nature, 460(7259):1132–5.
- T. Kawamura et al, 2009. Linking the p53 tumour suppressor pathway to somatic cell reprogramming. Nature Vol 460 (7259) 1140–1144.
- Hu, K. et al. (2011) Efficient generation of transgene-free induced pluripotent stem cells from normal and neoplastic bone marrow and cord blood mononuclear cells. Blood 117, e109–e119
- Jun Fan, Zhongjie Sun, Stem Cells 2016 Jun;34 (6):1615–25.
- Popović B, et al. Mesenchymal stem cells of different origin: comparative evaluation of proliferative capacity, telomere length and pluripotency marker expression. Life Sci. 2015;141:61–73.
- Riva Shmulevich et al., 2020, Klotho rewires cellular metabolism of breast cancer cells through alteration of calcium shuttling and mitochondrial activity oncogene 2020 Jun;39(24):4636–4649
- Wang et al., 2011; The histone demethylases Jhdm1a/1b enhance somatic cell reprogramming in a vitamin-C-dependent manner. Cell Stem Cell 9, 575–587
- Stadtfeld et al., 2012 Ascorbic acid prevents loss of Dlk1-Dio3 imprinting and facilitates generation of all-iPS cell mice from terminally differentiated B cells. Nat. Genet. 44, S1–S2.
- P. R. Raghavan, “Metadichol®, vitamin C and GULO gene expression in mouse adipocytes,” Biology and Medicine, vol. 10, no. 1, p. 426, 2017. View at: Publisher Site | Google Scholar
- P. R. Raghavan, “Metadichol® and vitamin C increase in vivo, an open-label study,” Vitamins and Minerals, vol. 6, p. 163, 2017. View at: Google Scholar
- P. R. Raghavan, “Metadichol® induced high levels of vitamin C: case studies,” Vitamins and Minerals, vol. 6, p. 169, 2017. View at: Google Scholar;
- Banito et al., 2009 Senescence impairs successful reprogramming to pluripotent stem cells. Genes Dev. 23, 2134–2139.
- Esteban et al., 2010 Vitamin C enhances the generation of mouse and human induced pluripotent stem cells. Cell Stem Cell 6, 71–7923.
- Cloos et al., 2008. Erasing the methyl mark: histone demethylases at the center of cellular differentiation and disease. Genes Dev. 22, 1115–1140
- Chung et al., 2010. Vitamin C promotes widespread yet specific DNA demethylation of the epigenome in human embryonic stem cells. Stem Cells 28, 1848–1855.
- Chong et al 2019, Front. Cell Dev. Biol., 16 July. Reprogramming the Epigenome With Vitamin C;
- Sergei Egorov, Nikolai Daraselia, Ilya Mazo,2003. Pathway studio–the analysis and navigation of molecular networks. Bioinformatics 2003 Nov 1;19(16):2155-7.
- Andrey Y Sivachenko 1, Anton Yuryev, Nikolai Daraselia, Ilya Mazo, 2007. Molecular networks in microarray analysis. J Bioinform Comput Biol Apr;5(2B):429–56.
- T. Kenakin,2011.Inverse, protean, and ligand-selective agonism: matters of receptor conformation. FASEB J. 15(3):598–611
- Ryan G Forster, 2011. Vitamin D receptor controls expression of the anti-aging klotho gene in mouse and human renal cells. Biochem Biophys Res Commun 2011 Oct 28;414(3):557 – 62
- C. Aleman, R. Mas, C. Hernandez et al., “A 12-month study of policosanol oral toxicity in Sprague Dawley rats,” Toxicology Letters, vol. 70, no. 1, pp. 77–87, 1994. View at: Publisher Site |
- C. L. Alemán, R. M. Ferreiro, M. N. Puig, I. R. Guerra, C. H. Ortega, and A. Capote, “Carcinogenicity of policosanol in Sprague Dawley rats: a 24 month study,” Teratogenesis, Carcinogenesis, and Mutagenesis, vol. 14, no. 5, pp. 239–249, 1994. View at: Publisher Site | Google Scholar
- C. L. Alemán, M. N. Puig, E. C. Elias et al., “Carcinogenicity of policosanol in mice: an 18-month study,” Food and Chemical Toxicology, vol. 33, no. 7, pp. 573–578, 1995. View at: Publisher Site | Google Scholar
- Ramos-Mejia V, Fraga MF, Menendez P. iPSCs from cancer cells: challenges and opportunities. Trends Mol Med. 2012;18:245–7.
- Lin SL, Chang DC, Chang-Lin S, et al. Mir-302 reprograms human skin cancer cells into a pluripotent ES-cell-like state. RNA. 2008;14:2115–24.
- Raghavan, P.R. Metadichol® and Healthy Skin: One Approach many Possible CuresJ Clin Exp Dermatol Res 2018, 9:1. DOI: 10.4172/2155-9554.1000445.
- Raghavan PR (2017) Metadichol, A Novel ROR Gamma Inverse Agonist and Its Applications in Psoriasis. J Clin Exp Dermatol Res 8: 433. doi:10.4172/2155-9554.1000433