Patient specimen
102 paired GC tissues and adjacent nontumorous tissues were collected from patients undergoing surgery at Ganzhou People’s Hospital and the First Affiliated Hospital of Zhengzhou University (GZPH GC cohort) between year 2010 and 2018. Tissue microarray (TMA) were constructed with GC tissue specimen. All patients signed the written informed consent. The Ethics Review Committee of Ganzhou People’s Hospital approved the study.
Cell culture
GC cell lines (SGC-7901, AGS, MGC-823, MKN-45, BGC-823) and control gastric epithelial cell line GES-1 were purchased from the Cell Bank, Chinese Academy of Science (Shanghai, China). HEK293 cells were from ATCC and maintained in the lab. Cells were cultured following the culture methods recommended by ATCC.
Cell transfection
SGC-7901 or MGC-823 cells were transiently transfected with si-NRP1 or negative control (NC), miR-19b-3p mimics or NC, miR-19b-3p inhibitor or NC, or pcDNA3.1-NRP1 using lipofectamine 3000 (Invitrogen, USA). SGC-7901 cells were transduced with sh-NRP1 or NC and stably NRP1 knockdown cells were selected using neomycin before cell implantation.
Real Time-quantitative PCR
Complementary DNA was prepared from total RNA using First strand cDNA synthesis Kit (Roche, Germany). NRP1 and miR-19b-3p expression were analyzed by quantitative PCR using SYBR Green master mix (Bio-Rad, USA). GAPDH and U6 were used as control. The primers used in the study were listed as following: NRP1,
5’- ACCCAAGTGAAAAATGCGAATG -3’ and
5’- CCTCCAAATCGAAGTGAGGGTT -3’; miR-19b-3p,
5’- AACAGAAGTTTTGCAGGTTTGCATC -3’ and
5’- CAGTGCAGGGTCCGAGGT -3’; U6, 5’-CCAGUUUACCUAACGCAAUTT-3’ and 5’-TTCACGAATTTGCGTGTCAT-3’; GAPDH,
5’- CTGGGCTACACTGAGCACC -3’ and
5’- AAGTGGTCGTTGAGGGCAATG -3’.
Western Blot
Western blot was performed as previously described 24. The primary antibodies used in the study were listed as following:
NRP1 (Abcam, ab81321), E-cadherin (Abcam, ab194982), vimentin (Abcam, ab92547), N-cadherin (Abcam, ab18203), BMP4 (Abcam, ab200796), ICAM1 (Abcam, ab221777), VCAM1 (Abcam, ab134047), GAPDH (Abcam, ab181602).
Cell growth assays
Cell growth was analyzed by CCK-8 assay, EdU staining assay and Colony formation assay as previously described 25.
Transwell assay
Cell invasion was evaluated with transwell chamber (Corning, USA). Briefly, 1 × 105 transfected SGC-7901 or MGC-823 cells in serum-free medium were added to the Matrigel-coated top chamber. The bottom chamber was added with 500 μL DMEM medium containing 10% FBS. After 48 h, the invaded cells were fixed and stained with crystal violet.
Wound healing assay
SGC-7901 or MGC-823 cells were cultured to form monolayer in 6-well plate. An artificial wound was created using a sterile 200 μL pipette tip. Floating cells were washed awat with PBS and rest cells were cultured in serum-free medium for 48 hours. The wound was recorded at 0 h and 48 h to calculate the migration distance.
Luciferase reporter assay
Luciferase vector containing wild type or mutated 3’-UTR sequence of NRP1 was cloned using pGL3-luc vector (Promega, USA). HEK393 cells were seeded into 24-well plates and transfected with luciferase vector, together with miR-19b-3p mimics or negative control. Relative luciferase activity was analyzed using the Dual-Glo luciferase reporter assay kit (Promega, USA) 48 hours later.
Immunohistochemical (IHC) staining
Briefly, 5 μm paraffin tumor section slides were de-paraffined and blocked with normal rat serum, and then incubated with primary antibodies overnight at 4°C. Then, slides were incubated with HRP conjugated secondary antibodies, and the specific protein expression was detected using a DAB kit (Vector Lab, USA). The primary antibodies used in the study were listed as following: Ki-67 (Proteintech, 27309-1-AP), NRP1 (Abcam, ab81321), E-cadherin (Abcam, ab194982), vimentin (Abcam, ab92547), N-cadherin (Abcam, ab18203), BMP4 (Abcam, ab200796), ICAM1 (Abcam, ab221777), VCAM1 (Abcam, ab134047).
Xenograft tumor model
BALB/C nude mice (5-6 weeks, 6 mice/group) were obtained from Vital River Laboratory (Beijing, China). 3 × 106 stable transfected SGC-7901 cells were subcutaneously inoculated into the nude mice. Tumor growth was monitored every week and tumor volume was calculated (length ×width2 /2). Tumor were extracted and weighed at 5 weeks. The animal experiment was approved by the Institutional Animal Care and Use Committee of Ganzhou People's Hospital.
Statistical analysis
Results were displayed as mean ± SD and analyzed with GraphPad Prism V6 (Prism, USA). Student t-test and one-way ANOVA was conducted to calculate the difference between two or more groups. A * p < 0.05 is considered to be statistically significant.