Animal experiments
The experimental animals used in this experiment were 8-week-old adult male C57BL/6 mice (purchased from Beijing Fox Company, clean grade), body weight (25 ± 3g). The animals were fed adaptively for 1 week. During the whole experimental process, the temperature of the animal rearing environment was controlled at 22 ± 3°C, the relative humidity was controlled at 55% ± 5%, the daily light time was 12 hours, and the water and food were free.
Cultivation of P. histicola
Under aseptic conditions, a culture tube filled with nitrogen containing 5% CO2 was oven-dried under high-pressure for 30 s, following which it was covered with a latex plug to render it suitable for anaerobic cultures. The bacterial culture medium was prepared and placed into a sealed box with an anaerobic gas-generating bag, and anaerobic treatment was performed for 24 hours. The strains were implanted in an anaerobic culture tube, to which anaerobic culture medium had been added under aseptic operation, and the culture tube was then incubated at 37°C for 24 hours.
Surgery
After preparing the skin and local disinfection with iodophor, the skin of the mouse head was cut from the posterior to anterior sagittal line, the parietal bone was exposed, and the bregma was identified. The tip of a 2-µl microinjection needle was used to mark the bregma point as the coordinate zero points (0, 0, 0); the coordinates were then adjusted to 1.30 mm, -3.0 mm, and 0 mm and marked as such, following which holes were made using a skull drill. The coordinates were then adjusted to 1.30 mm, -3.0 mm, and − 4.50 mm. A microinjection pump was used to inject 2 µl of LPS (2 µg/µl) or the same dose of saline as a control at an injection speed of 0.2 µL/min. After the injection, the injection needle was maintained in the brain for 10 minutes, following which it was slowly removed. Iodophor disinfection, fixation with dental cement, and skin suturing were performed.
Open-field test
The adapted mice were placed into an open field with a diameter of 0.5 m, and a Sony camera was used to record the activities of the experimental mice in the open field for 120 s. The camera was connected to XeyeAba3.2 software to automatically analyze the total movement. Distance, exercise time, static time, and average speed were recorded and analyzed for each mouse.
Footprint analysis
To assess motor function in the forelimbs and hindlimbs after establishing the PD model, footprint analysis was performed as described previously [34]. Briefly, after each forelimb and hindlimb was respectively brushed with red and blue nontoxic ink, the animals were required to run along a paper-lined runway (3 feet long, 3 inches wide) with a darkened box at the end. The gait of each mouse was measured and quantitatively analyzed.
Rotarod performance
To evaluate balance, grip strength, and motor coordination, the animals were placed on a rotary rod fatigue tester (Anhui Zhenghua Biological Instrument Equipment, YLS-10A) with six channels, which was set to 30 rpm over 5 min. One mouse was placed in each channel for testing (six at a time), and the mice were allowed to adapt to the rotating rod for 5 min. The time spent on the rod before falling was recorded for each mouse.
Immunohistochemical staining
After prefusion with 0.1 mol/L PBS followed by 4% paraformaldehyde (PFA), the brains were collected and immersed in 4% PFA for 24 h, following which they were transferred to 30% sucrose solution until immersion. Subsequently, the brains were cut into 30-µm-thick transverse and horizontal sections using a freezing microtome (Thermo, USA). For staining of brain tissue sections, the antigens were repaired for 6 min at 96℃ using Sodium Citrate Antigen Retrieval Solution (Solarbio). Subsequently, the sections were treated with 3% hydrogen peroxide-methanol solution for 15 min at room temperature to block endogenous peroxidases, followed by overnight incubation with primary antibodies at 4°C. They were subsequently washed three times with PBS and were then incubated for 1 h at room temperature with appropriate secondary antibodies (1:1, 000, Invitrogen).
Western blotting
Substantia nigra tissues were lysed in ice-cold RIPA Buffer (P0013B, Beyotime) with 100 mM NaF, 100 mM Na3VO4, and 100 mM PMSF at 4°C for 30 min, and the sample was mixed with 2 × loading buffer. The proteins were boiled at 96°C for 5 min. The samples were separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto nitrocellulose membranes (Life Sciences, USA). After blocking in 5% skim milk for 2 h, the membranes were incubated with different primary antibodies overnight at 4°C. Subsequently, the membranes were washed three times and were then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (1:5, 000, Pierce) for 2 h. ImageJ software was used to analyze the western blotting results.
Reverse transcription-polymerase chain reaction (RT-PCR)
Total RNA was extracted from the substantia nigra using TRIzol™ reagent (#15596026, Ambion) in accordance with the manufacturer’s instructions. RNA was reverse transcribed into cDNA using the SuperScript™ One-Step Reverse Transcription Kit (#10928-034, Invitrogen, CA, USA). After adding the corresponding parrot, PCR was performed on the cDNA. After the product was subjected to agarose gel electrophoresis, the results were analyzed using ImageJ (Version 1.51n). We then measured transcription levels of IL-1α, IL -6, IL-12, and TNF-α mRNA using the following primers:
b-actin: 5’-3’:GACTGTGCCCATCTACGA
3’-5’:CCATCTCCTGCTCGAAG
IL-1 b: 5’-3’: CGCTTGAGTCGGCAAAGA AAT
3’-5’:CTTCCCGTTGCTTGACGTTG
TNF-a: 5’-3’:CGAGTGACAAGCCTGTAG C
3’-5’:TACTTGGGCAGATTGACCTCA
IL-6: 5’-3’:CCAAACTGGATATAATCAG
3’-5’:GAAAAT CTAGGTTTGCCGAGTAGATCT
IL-12: 5’-3’:AACCTCACCTGTGACACGCC
3’-5’:CAAGTCCATGTTTCTTT GCACC
IL-10: 5’-3’:AGCCTTATCGGAAATGATCCAGT
3’-5’:GGCCTTGTAGACACCTTGGT
Double-immunofluorescence staining
Frozen sections of mouse brain tissues were rinsed three times with PBS for 5 min each, following which they were incubated in citrate buffer at 95°C for 6 min for antigen retrieval and were then rinsed with PBS three times (5 min each time). These sections were incubated with primary antibodies overnight at 4°C and were then rinsed with PBS three times (5 min each time), followed by incubation with fluorescent secondary antibodies for 1 h at room temperature. After rinsing three times with PBS (5 min each time), these sections were mounted on slides with mounting medium and observed under a fluorescence microscope.
Enzyme-linked immunosorbent assay
Each sample was determined according to its own quantity, and multiple wells were used for each sample. The protocol was as follows:① For blank wells/blank control wells without samples, biotin-labeled corresponding antibody, streptavidin-HRP, and chromogenic reagent A&B and stop solution were added, although other steps were the same. ② For standard wells, 50 µl standard and 50 µl streptavidin-HRP were added (biotin antibody was integrated in the standard, so was not added). ③ For sample wells to be tested, 40 µl sample was added, followed by 10 µl of the corresponding primary antibody and 50 ul streptavidin Avidin-HRP, followed which the wells were covered with sealing film. Samples were subjected to gentle shaking and were incubated at 37°C for 60 min. Liquid preparation was performed by diluting the 30-fold concentrated washing liquid by 30-fold with distilled water before use. For washing, the sealing film was carefully removed, the liquid was discarded, and the samples were subjected to spin drying. Each well was filled with washing liquid, which was discarded after 30 s. This process was repeated five times, and samples were pat dry. Color development was achieved by adding 50 µl of developer A and 50 µl of developer B to each well, which were shaken gently to mix. Samples were then incubated at 37°C for 15 min in the dark. To stop reactions, 50 µl stop solution was added to each well (at this time, color shifts from blue to yellow).
Evans blue staining for investigating the permeability of the blood–brain barrier
Evans blue was injected into the tail vein 1 min before the mice were sacrificed. After sacrifice, the brains were mashed in dimethylamine and incubated at 60°C overnight, and the supernatant was then collected on the next day to measure the absorbance of each well at a wavelength of 620 nm.
Molecular fluorescence probe method for detecting intestinal permeability
Mice were administered an intragastric injection of 10% FITC-dextran with a molecular weight of 4,000 kDa 4 h before sacrifice. Blood was taken from the orbit immediately after the mouse was sacrificed by cervical dislocation. After incubation at room temperature for 30 min, the blood samples were centrifuged at 1.6 × 103 rpm for 5 min at room temperature. The serum was collected and placed in a 96-well plate to detect the fluorescence intensity of each well at an excitation wavelength of 630 nm using a multifunctional microplate reader.
Spleen Treg cell flow cytometry
A total of 100 µl anticoagulant blood or 1–10 × 106 splenocytes were pipetted into test tubes, and 5 µl Anti-Mouse CD4, FITC, 5 µl Anti-Mouse CD25, and APC were then added to each tube. The tubes were vortexed to ensure thorough mixing and were incubated at room temperature for 15 min in the dark. Then, 2 mL of 1× FCM Lysing Solution (work solution) was added to each tube and pulse vortexed, followed by incubation at room temperature for 15 min in the dark. The tubes were centrifuged at 300–400 × g for 5 min at room temperature, and the supernatant was discarded. The, 2 ml 1× Flow Cytometry Staining Buffer was added, and the tubes were pulse vortexed. After centrifugation at 300–400 × g for 5 min at room temperature, the supernatant was discarded. Subsequently, 1 ml of Fixation/Permeabilization working solution was added, and the tubes were pulse vortexed. After incubation for 30–60 min at room temperature in the dark, without washing, 2 ml of 1× Permeabilization Buffer was added to each tube. The tube was centrifuged at 300–400 × g for 5 min at room temperature, and the supernatant was then discarded. The pellet was resuspended in 100 µl of 1× Permeabilization Buffer (a typically residual volume after decanting). After incubation for 15 min at room temperature in the dark, without washing, 5 µl anti-mouse Foxp3 or 5 µl mouse IgG1 isotype control was added. After vortexing to ensure thorough mixing, the tube was incubated for at least 30 min at room temperature in the dark. After adding 2 ml of 1× Permeabilization Buffer to each tube and centrifugation at 300–400 × g for 5 min at room temperature, the supernatant was discarded. Cells were resuspended in 500 µL of 1× Flow Cytometry Staining Buffer and analyzed on a flow cytometer.
SENP3 knockdown
All small interfering RNAs were purchased from MICRO-G BIOTECK company (Shanghai, China). According to the manufacture’s protocol, BV2 microglia were seeded at 105 cells/well. 20 µM of siRNA was added to serum-free DMEM and then mixed with 5 µl of Lipo3000 transfection reagent. After incubation at room temperature for 15 min, the mixture was added to cells and cultured for 48 h.
siRNA-control: 5’-3’:UUCUCCGAACGUGUCACGUTT,
3’-5’:ACGUGACACGUUCGGAGAATT
si-SENP3: 5’-3’:GGAUGCUGCUCUACUCAAAdTdT
3’-5’:UUUGAGUAGAGCAGCAUCCdTdT
SENP3-containing plasmid transfection
The SENP3 plasmids were got from Professor Jing Yi (Shanghai Jiaotong University, China). For transfection, microglia were grown in Dulbecco’s Modified Eagle’s Medium (Gibco), supplemented with 10% FBS (Gibco) and 1% penicillin/streptomycin (Gibco) in a 5% CO2 incubator at 37℃. Appropriate plasmids were transfected into the cells using Lipofectamine™ 3000 Transfection Reagent 4ul per 1ug of plasmid (L3000-015, Invitrogen) according to the manufacturer’s instructions.
Establishment of IL-10-treated cell model
BV-2 cells were evenly plated in 6-well plates at 1 million cells per well (cultured in 10% FBS in DMEM). 100 ng IL-10 was administered 1 hour after the administration of 100 ng per mL of LPS. The protein was extracted after an additional 3 hours.
Histological of intestinal inflammation
Upon sacrifice, proximal duodenal, jejunal, ileal and colon tissue were harvested and fixed in 10% phosphate-buffered formalin. These samples were embedded in paraffin, sectioned at 4 µm, and stained with H&E or PAS for light microscopy examination. The slides were reviewed in a blinded fashion by a pathologist and were assigned a histological score for intestinal inflammation.
Transmission Electron Microscopy of tight junction
Segments of proximal jejunum (2 cm each) were collected, fixed in 2.5% glutaraldehyde–2% paraformaldehyde solution (2 h; 4°C), rinsed in 0.1 mol/L cacodylate buffer, and then postfixed for 1 h at 4°C in 1% osmium tetroxide. Subsequently, tissue samples were dehydrated in graded ethanol and embedded in Epon-Araldite resin. Ultra-thin sections (70 nm) were obtained with an ultramicrotome system (Reichert OMU2) and collected on copper/palladium grids after staining with 4% uranyl acetate and 0.4% lead citrate. To evaluate changes in TJ morphology, the junctional regions of three randomly selected sections of longitudinally sectioned villi were examined for each specimen. Sections were examined with a Hitachi JEM1200-EX electron microscope. In the gut epithelial cells, open tight junctions (TJs) appeared as a dilatation or a gap in the apical space of the junctional complex. Examinations were performed with a total of 6 TJs per specimen.
Metabolomics data
In a clean bench, the intestinal contents from the colon segment to the rectum segment of the euthanized mouse were taken. Send the contents to Lianlian Biotechnology Co., Ltd. for testing.
Stool Sample Processing and DNA Extraction
The fecal samples collected were frozen immediately in liquid nitrogen and stored at -80℃until analysis. Fecal genomic DNA was extracted from the fecal samples with the QIAamp® DNA Stool Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s protocol. The concentration and purity were detected through the Nanodrop, and the integrity was detected through regular 0.8% agarose gel electrophoresis.
High throughput sequencing
The bacterial genomic DNA was used as the template to amplify the V3–V4 hypervariable region of the 16S rRNA gene with the forward primer (5-CCTACGGGNGGCWGCAG-3) and the reverse primer (5-GACTACHVGGGTATCTAATCC-3). Each sample was independently amplified three times. Finally, the PCR products were checked by agarose gel electrophoresis, and the PCR products from the same sample were pooled. The pooled PCR product was used as a template, and the index PCR was performed by using index primers for adding the Illumina index to the library. The amplification products were checked using gel electrophoresis and were purified using the Agencourt AMPure XP Kit (Beckman Coulter, CA, USA). The purified products were the indexed in the 16S V3–V4 library. The library quality was assessed on the [email protected] Fluorometer (Thermo Scientific) and Agilent Bioanalyzer 2100 systems. Finally, the pooled library was sequenced on an Illumina MiSeq 250 Sequencer for generating 2×250 bp paired-end reads.
Bioinformatics and statistical analysis
The raw reads were quality filtered and merged with the following criteria: (1) Truncation of the raw reads at any site with an average quality score < 20, removal of reads contaminated by adapter and further removal of reads having less than 100 bp by TrimGalore, (2) The paired end reads are merged to tags by Fast Length Adjustment of Short reads (FLASH, v1.2.11), (3) Removal of reads with ambiguous basa (N base) and reads with more than 6 bp of homopolymer by Mothur, (4) Removal of reads with low complexity to obtain clean reads for further bioinformatics analysis. The remaining unique reads were chimera checked compared with the gold.fa database (http://drive5.com/uchime/gold.fa) and clustered into operational taxonomic units (OTUs) by UPARSE with 97% similarity cutoff. All OTUs were classified based on Ribosomal Database Projet (RDP) Release9 201203 by Mothur. Rarefaction analysis and alpha diversities (including Shannon, Simpson and InvSimpson index) were analyzed by Mothur. Sample tree cluster by Bray-Curtis distance matrix and unweighted pair-group method with arithmetic means (UPGMA) and Jaccard principal coordinate analysis (PCoA) based on OTUs were performed by R Project (Vegan package, V3.3.1). Redundancy analysis (RDA) was analyzed by Canoco for Windows 4.5 (Microcomputer Power, NY, USA), which was assessed by MCPP with 499 random permutations.
Antibodies information
Table 1
Antibody name
|
Brand
|
LOT
|
WB
|
IF/IHC
|
Species
|
TH (Anti-Tyrosine Hydroxylase)
|
sigma
|
T1299
|
1/10000
|
1/5000
|
M
|
Anti-beta Actin
|
Abcam
|
ab8226
|
1/2000
|
|
M
|
Cleaved Caspase-3
|
Cell Signaling Technology
|
9664S
|
1/1000
|
|
R
|
iNOS
|
Cell Signaling Technology
|
D6B6S
|
1/1000
|
1/200
|
R
|
Arginase-1
|
Santa Cruz
|
D4E3M
|
1/1000
|
1/50
|
R
|
AIF-1/Iba1 Antibody
|
Novus
|
NB100-128
|
|
4–6 ug/mL
|
G
|
SENP3
|
Cell Signaling Technology
|
D20A10
|
1/1000
|
1/400
|
R
|
Anti-MKK7抗体
|
Abcam
|
ab52618
|
1/10000
|
1/50
|
R
|
SUMO-2/3
|
Cell Signaling Technology
|
4971S
|
1/1000.
|
1/100
|
R
|
Phospho-SAPK/JNK (Thr183/Tyr185)
|
Cell Signaling Technology
|
4668T
|
1/1000.
|
1/50
|
R
|
Occludin
|
Absin
|
abs136990
|
1/1000
|
1/200
|
R
|
ZO-1
|
Abcam
|
ab96587
|
1/2000
|
1/500
|
R
|
Anti-IL-1 beta
|
Abcam
|
ab283818
|
1/1000.
|
1/500
|
R
|
Statistical analysis
All data were analyzed using Prism5 software. The experimental results are expressed as the mean ± standard deviation (X ± S), and all data presented represent results from at least three independent experiments. Student’s unpaired two-tailed t-test or analyses of variance (ANOVAs) with pairwise comparisons were used to compare data among the groups. Statistical significance was defined as P < 0.05.