Isolation and identification of Chromohalobacter salexigens 3EQS1
Originally, different halophilic strains were isolated fromuntreated salt samples collected in June 2020 from Lake Qarun (Fayoum Province, Egypt; 29° 27′ 13″ N, 30° 34′ 51″ E, 45 m below sea level) by standard serial dilution and plating techniques (Ibrahim et al. 2020). The isolates were subcultured on agar plates containing a standard growth medium of the following composition (g L-1): casamino acids, 7.5; glucose, 10; sucrose, 10; yeast extract, 10; MgSO4×7H2O, 20; KCl, 2; Na3C6H5O7×2H2O, 3; agar, 20 (pH 7.5) (Sehgal and Gibbons 1960). NaCl was added at 0 to 25% (w/v), and the plates and incubated at 25 °С for 48–72 h. Morphologically distinct EPS-producing mucoid colonies were selected for further validation. Five isolates with a mucoid phenotype grew in a wide NaCl concentration range. Of these isolates, strain 3EQS1 was chosen as the most prolific EPS producer.
Strain 3EQS1 was subjected to morphological and biochemical characterization, as described in Ibrahim et al. (2020), and to molecular identification. Some enzymatic activities were tested with the API-20E and 50CH systems (bioMérieux, Lyon, France) by using 10% (w/v) NaCl. The assignment of the strain to the Chromohalobacter species was confirmed with a Biolog GP Microplate miniaturized biochemical system (Biolog, Hayward, CA, USA). Genomic DNA was extracted from 1 mL of a bacterial suspension (2×107 cells mL-1) with a QIAamp DNA mini kit (Qiagen, Germany), as recommended by the manufacturer. The 16S rDNA was amplified with two universal primers, 27F (5' AGAGTTTGATCCTGGCTCAG 3') and 1492R (5' AAGGAGGTGATCCAGCCGCA 3'). The amplified DNA products were separated on agarose gels and were recovered with a NucleoTrap gel extraction kit (Macherey-Nagel, Duren, Germany). The nucleotide sequence of the purified bands was determined with an ABI PRISM 3500xL genetic analyzer (Applied Biosystems, USA). The isolate was identified through the BLASTn online program (National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov/gquery/?term=blastn) and also through the EzTaxon-e server (http://www.ezbiocloud.net/), on the basis of 16S rRNA gene sequence data (Kim et al. 2012). A phylogenetic tree was constructed by the neighbor-joining method with FastME (Lefort et al. 2015). Confidence in the branching points was established by bootstrap analysis (1000 replicates). The 16S rRNA gene sequence of strain 3EQS1 was deposited in the GenBank under accession number OK189068.
Isolation and purification of EPS
Strain 3EQS1 was grown in a modified liquid nutrient broth composed as follows (g L-1): sucrose, 20 (or glucose, 20, or lactose, 20, or fructose, 20, or mannose, 20); yeast extract, 4; MgSO4×7H2O, 20; KCl, 2; Na3C6H5O7×2H2O, 3; NaCl, 0, 50, 100, 150, and 250. Growth was conducted at 25 °C for 72 h in 1 L Erlenmeyer flasks, each containing 350 mL of the medium, in an ES-20/60 orbital shaker–incubator (Biosan, Latvia; 180 rpm). The initial pH of the medium was 8.0. The effect of the sucrose concentration (30, 50, 100, and 150 g L-1) was evaluated at 10% (w/v) NaCl. Before inoculation, a filtered carbohydrate solution (polytetrafluoroethylene filter; pore size, 0.46 µm; Pall Corporation, USA) was added to the medium. The culture broth was centrifuged at 4000 ´ g for 30 min to separate cells from the supernatant liquid. The cell-free supernatant liquid was evaporated to a minimal volume at 40 °C under reduced pressure (Laborota 4000; Heidolph, Germany). Salts and low-molecular-mass compounds were removed by dialysis against distilled water at 4 °C for 48 h (molecular mass cut-off of the cellulose membrane, 13 kDa; Sigma-Aldrich Chemie, Seelze, Germany). The dialyzed supernatant liquid was concentrated, and the crude EPS was precipitated by slowly pouring a threefold volume of chilled ethanol into the supernatant liquid and stirring the mixture at 200 rpm with an overhead stirrer (Microstar 7.5 control; IKA, Germany). The precipitate was separated by centrifugation at 3000 ´ g for 20 min, washed repeatedly with chilled ethanol, resuspended in water, and lyophilized in a Benchtop 2K freeze dryer (VirTis, USA).
The crude EPS was fractionated by gel-permeation chromatography (GPC) (Sepharose CL-6B column, 2.5×50 cm; GE Healthcare, USA), with 0.025 M NH4HCO3 as the eluent (flow rate, 30 mL h-1). The EPS-containing fractions were pooled and lyophilized for further purification by anion-exchange chromatography (DEAE Toyoperl 650M column, 1.5×40 cm; Supelco, Germany). The buffer was Tris-HCl (pH 7.2), the NaCl gradient was from 0 to 1 M, and the flow rate was 60 mL h-1. The purified EPS was lyophilized, and its structure was characterized.
General analytical techniques
Total carbohydrates and proteins were measured by the methods of DuBois et al. (1956) and Bradford (1976), respectively. The instrument used was a Specord 40 spectrophotometer (Analytik Jena AG, Germany).
The monosaccharide composition of the EPS (2 mg) was analyzed after hydrolysis in 0.01 M H2SO4 at 80 °C for 2 h, followed by neutralization with 5 M NaOH. The analysis was done by high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC–PAD), by using a Smartline 5000 instrument (Knauer, Germany) equipped with a CarboPac PA-20 column.
The average molecular mass of the EPS was determined by high-performance gel-permeation chromatography (HPGPC; Smartline 5000, Knauer), by using a 7.8 mm × 300-mm PolySep-GFC-P 5000 column (Phenomenex, Torrance, CA, USA; column temperature, 30 °C) and a refractive index detector. The concentration of the polysaccharide samples used for analysis was 1 mg ml-1, the mobile phase was 0.2 M NaNO3, and the flow rate was 0.5 mL min-1. The system had been calibrated with dextrans as standards (20, 40, 70, 110, 229, 500, and 2000 kDa; Fluka, Germany). The molecular mass of the EPS was calculated from a standard curve.
Fourier transform infrared (FTIR) spectroscopy
Functional groups of the EPS were examined on a Nicolet 6700 FTIR spectrometer (Thermo Scientific, USA). The spectrum of dry air was used as the reference. The lyophilized EPS (2 mg) was ground with dried KBr powder (0.5 g) and pressed into a tablet under vacuum. The FTIR spectrum was recorded with an air dryer and with an H2O and СО2 absorber within the wave range 4000–400 cm−1 at a spectral resolution of 4 cm−1. In total, not less than 64 scans were collected.
Nuclear magnetic resonance (NMR) spectroscopy
The EPS samples were deuterium exchanged by freeze-drying from D2O. The 1H and 13C NMR spectra were recorded with an AVANCE DPX-500 instrument (Bruker Corporation, USA) at 313 K. 3-Trimethylsilylpropanoate-d4 (δH 0.0 ppm) and acetone (δC 31.45 ppm) were used as internal standards. Two-dimensional (2D) experiments were done with standard Bruker software. TOCSY spectra were recorded at 200-ms duration of the MLEV-17 spin-lock, and ROESY spectra were recorded at 200-ms duration of the spin-lock. The HMBC spectrum was recorded with a 60-ms delay for the evolution of long-range spin couplings.
Thermogravimetric analysis allied with differential scanning calorimetry and mass spectroscopy (TGA-DSC-MS)
A levan sample was put in a platinum pan and was analyzed in an argon atmosphere on an STA 449 F1 Jupiter apparatus (Netzsch-Geratebau, Germany) equipped with a QMS 403 C Aëolos mass spectrometer (Netzsch-Geratebau). Heating was programmed to increase from 35 to 650 °C at 20 °C min-1. The mass spectrometer was set to monitor the ions of common decomposition gases such as water (m/z 18), CO and/or N2 (m/z 28), and CO2 (m/z 44).
Scanning electron and atomic force microscopy
Scanning electron microscopy (SEM) of the EPS was done with a MIRA II LMU instrument (TESCAN, Czech Republic) operating at 4 kV in a secondary electron mode. Magnification ranged from 1000× to 20000×. Samples were prepared by air-drying a drop of an aqueous EPS solution (0.5%, w/v) on a silicon wafer at room temperature.
The topography of the dried samples was measured by atomic force microscopy (AFM) on an NTEGRA Spectra device (NTMDT, Russia) operating in a tapping mode and equipped with NSG10 tips (TipsNano, Russia). Samples were prepared by placing a 5-μL droplet of material on a glass substrate and drying it for several hours. All data (background subtraction, filtering of the feedback autogeneration frequency) were processed with Gwyddion software (Nečas and Klapetek 2012).
Dynamic light scattering (DLS) measurements
DLS analysis of the critical aggregation concentration (CAC) of aqueous EPS suspensions was done with a Malvern Zetasizer Nano ZS system equipped with a He-Ne laser (633 nm, 4 Mw; Malvern Instruments, UK). DLS was measured for concentrations ranging from 15.6 to 1 mg mL-1. Measurements were made at 25 °C in a 10-mm polystyrene cell (Sarstedt, Germany) at a detection angle of 173° and at a constant aperture (attenuator 9). The measured scattering light intensity was displayed as a photon count rate with a unit of kilo counts per second (kcps). From the data of light scattering and the correction function of the scattering intensity fluctuations in time, we estimated the average hydrodynamic diameter (d) and the most probable modal hydrodynamic diameter (dm) of the supramolecular particles (Burygin et al. 2016). Data were analyzed with DTS software (Version 4.2; Malvern Instruments, UK). The CAC was found at the intersection point of the two slopes of the curve of light scattering intensity versus EPS concentration (Aurell and Wistrom 1998).
Surfactant and emulsifying activities
The surfactant activity of the levan solution was evaluated by the oil displacement test. Briefly, 10 mL of distilled water was poured into Petri dishes and 100 μL of crude oil was added to the surface of the water. Then, 5 μL of an aqueous 0.1% (w/v) levan solution was spotted in the center of the crude oil surface. The area of the clear zone on the oil surface was measured 30 s later by comparison with 5 μL of distilled water (negative control) and 5 μL of 0.1% Triton X-100 (positive control) (Rodrigues et al. 2006).
The standard assay for emulsifying activity was based on a modification of the method of Cooper and Goldenberg (1987). The tested compounds included sunflower oil, kerosene, and crude oil. Briefly, 3 mL of oil or of a hydrocarbon was added to 2 mL of an EPS solution in distilled water (1%, w/v) in a glass tube and was vortexed for 5 min. After 24/48 h, the emulsion index (E24/48, %) was calculated as given below:
E24/48 = he / hT ×100,
where he is the height of the emulsion layer (mm) and hT is the overall height of the mixture (mm). All samples were kept at 25 °C. All tests were done in triplicate.
Surface tension measurements
These were made by the Wilhelmy plate method with an EasyDyne K20 tensiometer (Krüss, Germany) equipped with a thermostated jacket. The measurements were made at 30 °C with two concentrations of aqueous polysaccharide solutions¾0.5% and 0.1% (w/v). Milli-Q quality water was used to calibrate the instrument. Before every single measurement, the platinum plate was cleaned with isopropyl alcohol, heated in a flame, and cooled to room temperature.
Statistics
All measurements were replicated at least three times. Data are expressed as mean ± standard deviation (SD). Statistical differences between samples were determined with the significance level at p < 0.05.