The clinical data about STIL expression in lung adenocarcinoma and clinical-pathological characteristic was collected using UALCAN9 and GEPIA10 web server (supported by TCGA database and the GTEx projects). STIL expression levels in lung adenocarcinoma tissues and adjacent tissues or Nodal Metastasis state were compared between lung adenocarcinoma tissues and adjacent tissues, and expressed as aberrant transcripts per million (TPM) values. Besides this, the correlation between STIL expression levels and prognosis in lung adenocarcinoma tissues were also analyzed by searching UALCAN, GEPIA and KM plotter 11online database.
Lung cell line NCI-H1299 and 293T cell lines were provided by Genechem Company (Shanghai, China). All cell lines were kept in the medium composed of DMEM supplemented with 100 IU/mL Penicillin and 100 µg/mL Streptomycin, and 10% heat-inactivated fetal bovine serum (BSA: Zhejiang Tianhang Biotechnology Co. Ltd.) in a humidified cell incubator having an atmosphere of 5% CO2 at 37℃. All cells reaching to exponential growth stage were used for further experiments.
Lentiviral infection of lung adenocarcinoma NCI-H1299 cells.
Human lung adenocarcinoma NCI-H1299 cells were seeded in plates with six-well at 5×104 cells/well and incubated at 37℃in 50 mL/L CO2 until 30% confluence was reached. The study was designed as negative control group (shCtrl, transfected with empty green fluorescent protein (GFP) lentivirus) and shSTIL group (shSTIL, transfected with shSTIL GFP lentivirus). A sufficient amount of lentivirus was transfected into NCI-H1299 cells according to the multiplicity of infection (MOI) appropriately. The cells were repeatedly cultured in the culture medium. GFP-tagged gene expression was monitored under a fluorescence microscope at 3 d after transfection, and cells with the transfection efficiency more than 80% were selected for subsequent analysis. Cells were harvested at 48h after post-transfection to guarantee further analysis.
ShSTIL plasmid transfection in 293T cells.
The 293T cells at the logarithmic growth phase were seeded in 24-well plate with 5×104/mL until reached 80–90% confluence and the culture medium was changed with fresh medium by opti-MEM1 with 400 µL for RNAi plasmid transfection. Next, the successfully constructed plasmids containing shSTIL and shCtrl with 0.5µg and lipofectamine 2000 (Life Technologies, China headquarters of USA company, Shanghai, China) were dissolved in opti-MEM respectively and maintained at room temperature for 5 minutes, and then, the plasmids and lipofectamine 2000 were mixed and remained at room temperature for 20 minutes. Once finished that the above mentioned step, the mixture of plasmid DNA and Lipofectamine 2000 were added to 293T cells and cultured for 6–8 hours in incubator at 37℃, 5% CO2 environment, and replaced with fresh complete culture medium containing 10% serum. The transfection rate was observed by fluorescence microscope detection after 24 hours transfection.
RT-qPCR analysis of knockdown efficiency in NCI-H1299 cells.
To detect the efficiency of silencing STIL in lung adenocarcinoma cells, the method of qPCR analysis was utilized. To be simple, lung adenocarcinoma cells at the exponential growth stage following successful silencing of STIL with lentivirus infection were collected and lysed for extracting total RNA using RNAiso Plus regent (Takara Bio, Dalian, China). The purity and concentration of extracted RNA were measured using P100 + UV-Vis spectrophotometer (Pultton, California, Sunnyvale, United States). Next, the reverse transcription reaction from to cDNA was performed using a Prime ScriptTM RT reagent Kit (Takara Bio, Dalian, China). Finally, the amplificationwas executed by a PCR Detection System (Roche, Light Cycle 9600, USA) using an SYBR Master Mixture (Yeasen, Shanghai, China), and the reaction of which was carried out in a final volume of 20 µL containing 1 µl of cDNA, 0.5 mM of each primer and 1X SYBR Master Mixture. The amplification reaction was operated as the following programme: denaturation at 95°C for 15 sec, followed by 40 cycles of 95°C for 5 sec, 60°C for 30 sec, in which fluorescence was detected to catch the amplifid DNA. After completing the amplification procedure, the melting curve was created to analysis the specificity of the expected PCR product of STIL. The the amplified DNA of STIL were normalized to GAPDH to calculate the fold change using the tradition method 2−ΔΔCt. Each sample was run in triplicates for analysis. The primers used were as follows: STIL: forward, 5’- GAGTCAGATAATGGAATGATGGG − 3’, reverse, 5’- CAGCAGTTGTCTTAGGGGAACA − 3’; GAPDH: forward, 5’- TGACTTCAACAGCGACACCCA − 3’, reverse, 5’- CACCCTGTTGCTGTAGCCAAA − 3’.
Western blotting analysis of knockdown efficiency in 293T cells.
Following the transfection procedure for 36–48 hours, the 293T cells of both shSTIL and shCtrl groups were collected and washed twice using PBS solution, next, the collected 293T cells were lysed using ice-cold lysis buffer for 5 min for protein isolation. The total protein concentration of the collected 293T cells was detected with a protein assay kit (Bio-Rad Laboratories, Shanghai, China). The separation of protein samples was conducted using 10% SDS-PAGE, and the transference of which was conducted to PVDF membranes. The immunological blots were incubated with primary antibody (Mouse Anti-Flag, Sigma, 1:2000, China headquarters, Shanghai, China) in appropriate concentration at room temperature. following washed in 5% non-fat milk containing TBST saline at room temperature for 1 h, The immunological blots were incubated with the appropriate horseradish peroxidase (HRP)-conjugated secondary antibody (Goat Anti-Mouse IgG, 1:2000, Santa-Cruz Biotechnology, Dallas, Texas, USA) for 1.5 h. Finally, the bands were evaluated with a method of chemiluminescence (ECL, Thermo Scientific Pierce, Shanghai, China) and scanned images for quantification using ImageJ software (NIH Image for the Macintosh, USA). The western blotting experiments mentioned-above were performed in triplicate, and GAPDH (Mouse Anti-Flag, 1:2000, Santa-Cruz Biotechnology, Dallas, Texas, USA) was employed as a housekeeping control to normalize the expression of STIL protein expression by a semi-quantification method.
Cell proliferation detection by Cell counting with Cellomics Array detection.
The NCI-H1299 cells of both shSTIL and shCtrl groups were collected from plates using 0.25% trypsin-EDTA and suspended in standard medium until the cells grow to the logarithmic stage for cell counting with the cellomics array scan imaging detection. The specific procedures are as follows: the well prepared NCI-H1299 cells of both shSTIL and shCtrl groups were seeded in five wells at 1000 cells/well, followed by further incubation at 37 ℃ and 50 mL/L CO2. A Cellomics Array Scan VT1 (Thermo Fisher Scientific) was utilized to monitor GFP expression of cells in both groups seeded in each well over 5 days continuously. In this study, statistical data of cells growth were mapped and cell proliferation curves were drawn to compare the multiplication ability of NCI-H1299 cells in both shSTIL and shCtrl groups.
Apoptosis assay.
The NCI-H1299 cells were harvested with 0.25% trypsin from and washed once with 4°C ice-cold D-Hanks (pH = 7.2 ~ 7.4) for centrifuge operation with the centrifuge force at 1300 rmp for 5 min. After rewashed with 1×binding buffer, the NCI-H1299 cells received another centrifuge operation at 1300 rmp for 3 min. Next, the NCI-H1299 Cells were resuspended in 200 µL binding buffer 106 cells/mL to execute apoptosis assay using a Annexin V-APC Apoptosis Detection Kit (MultiSciences, Hangzhou, China). The cell suspension of 100 µL volume was mixed with 10 µL Annexin V-APC for incubation in the dark for 15 min at room temperature. As a necessary step, a volume of 400–800µL 1×binding buffer was added to stained cells in proportion to the amounts of cells. The percentage of apoptotic rate was analyzed by flow cytometry in triplicate.
Caspase 3/7 activity assay.
Human lung adenocarcinoma NCI-H1299 cells were treated as a resuspended solution and seeded in 96-well plates in triplicate with a cell density of 1,000 cells/well at 37°C under incubation environment with 5% CO2 for caspase 3/7 activity assay. Caspase 3/7 activity was then tested using a Caspase Glo 3/7 Assay (Promega Corporation, G8091, WI, USA) kit based on the manufacturer’s protocol. The Caspase-Glo3/7 buffer solution and Caspase-Glo3/7 freeze-dried powder were placed at 18–22 ℃ (room temperature) for balance. Then a volume of 10 mL Caspase-Glo3/7 buffer solution was added to the brown bottle containing the Caspase-Glo3/7 substrate, and the brown bottle was whirled or reversed repeatedly until the substrate completely dissolved to form the Caspase-Glo reaction solution. After cell counting, the cell suspension concentration was adjusted to 1 × 104 cells / well at room temperature, and a volume of 100 µL of non-negative control cells were added to the new 96 well plates per well. At the same time, a group of empty control group without cells was setted up (adding only 100 µL per well medium). Next, a volume of 100 µL Caspase-Glo reaction solution was added to each well. The culture plate was place with cells on the plate shaker and shake lightly for 30 minutes at 300–500 rpm speed. Then the cells were incubated at 18–22 ℃ for 2 hours. Absorbance values were measured with a microplate reader (SpectraMax i3X, MOLECULAR, California, USA) at 405 nm.
Cell cycle analysis by flow cytometry.
When the NCI-H1299 cells reached 80% confluence in the 6 cm dish of each experimental group, it will be resuspended in triplicate in full culture medium. For suspension cells, the supernatant was directly collected by centrifugation at 1300 rmp for 5 min, and then washed with the precooled D-Hanks (pH = 7.2 ~ 7.4) at 4 ℃. Next, the cells were treated with centrifuge operation at 1300 rmp for 5 min. and then treated with precooled 75% ethanol at 4 ℃ for at least 1 h. After removing the immobilization solution and the cells were washed using precooled D-Hanks, a certain volume (0.6-1 mL) of cell staining (composed with 40 × PI mother liquor (2 mg/mL), 100 × RNase mother liquor (10 mg/mL) and 1 × D-Hanks, and the proportion of which is 25: 10: 1000) solution was added to heavy suspension to stain cells with propidium iodide for cell cycle analysis according to cell quantity. The cell cycle detection was conducted using a Guava EasyCyte Plus Flow Cytometry System (Merck Millipore, Billerica, MA, USA).
Antibody Array assay of Cancer Phenotype,Stress and Apoptosis pathway.
To explore the activation of possible intracellular signaling related to the influences in lung adenocarcinoma caused by STIL silencing, the PathScan of Cancer Phenotype Antibody Array Kit (#14821, Cell Signaling Technology, Danvers, MA, USA), Stress and Apoptosis Signaling Antibody Array Kit (#12923, Cell Signaling Technology, Danvers, MA, USA ) were used to screen and analysis potential proteins. After, till cells reaching around 85% confluence following lentivirus infection for 5 days, NCI-H1299 cells of both groups were collected and lysed to carry out detection in compliance with the manufacturer's instructions. The detection of cells between STIL silenced group and ShCtrl group was repeated in triplicate. Images were captured by exposing the slide to chemiluminescent film according to standard protocol.
Statistical analysis.