MATERIALS
Chicks.
The study was carried out on (150) Cobb broiler chicks at one day old were procured from Misr El-Arabia for chicken. Chicks were housed on a floor of a suitable size house and were managed as any commercial broiler.
Brooding and Rearing.
The temperature in the first week was 33o C then 21o C was reached then reduced by approximately 3o C per week until 21o C was reached. Artificial lighting is provided 24 hrs. After 2 weeks one hour of darkness daily was applied. Chicks were fed starter ration at first one week then replaced by experimental ration from starting 7th day age until the end of the experiment (35day). At the beginning of the 2nd week, Turmeric Powder was added at a dose of 5 g /kg ration in the Turmeric group. New castle vaccine (killed vaccine) manufactured by the cervac company was administered on the 7th day in drinking water and the Gumboro vaccine on the 14th day in drinking water (1).
Feed additives.
Turmeric powder. Turmeric was purchased from the local market (El-Gomhorya Company) in powder form and used in this experiment.
Experimental design and animal groups.
The chicks were divided into equal 2 groups; of 75 chicks each, as follows.
Control group. Chicks received the commercial ration only.
Turmeric group. Chicks were fed on an experimental ration containing Turmeric powder at a dose of 5 g/kg ration (12).
Determination of growth performance.
Bodyweight (g). All chicks in groups had been weighed individually at the 1st week until the end of the experiment.
Bodyweight gain (BWG). The body weight gain of chicks (expressed in grams) in each group was calculated by the difference between 2 successive weights.
Weight gain = (W2- W1) (13).
(Where, W1 is the mean chick weight at beginning of the experiment and W2 is the mean chick weight at its end).
Feed intake (FI). The experimental diets were offered regularly for each group. The offered diets were calculated each day, then at the end of the week, then the weekly feed intake was calculated by the difference between the weight of offered feed and remained part (13).
Feed conversion ratio (FCR). The FCR was calculated by dividing the amount of feed consumed (g) throughout the experimental period by the total weight gain (g) (14).
FCR = FI (g) of bird / BWG (g) of bird.
|
Blood and tissue sampling.
On day 35, blood samples were taken from the wing vein of 10 birds per group with anti-coagulant (EDTA) to obtain plasma. The plasma was separated from blood cells by centrifugation at 3.000 rpm for 30 minutes to determine biochemical parameters then slaughtered with a sharp knife and removed of the liver for estimation of mRNA expression of GH, IGF-1, and removed of the spleen for estimation of mRNA expression of IFN-γ, IL - 12p35.
Determination of Biochemical parameters.
Assay of total plasma proteins (g/dl) and albumin (g/dl) was carried out using commercial kits of Diamond diagnostics following method described by (15 ,16) respectively.
Protein electrophoresis profile was carried out by automated capillary zone electrophoresis according to (17).
Genes Expression.
Analysis of mRNA expression of growth hormone (GH) and insulin like growth factor-1 (IGF-1) genesin liver, interferon gamma (INF-γ) and Interleukin12 (IL-12p35) genes in spleen:
Liver and Spleen samples were dissected from all groups and then frozen at -80°C immediately. Total RNA was extracted from the frozen liver and spleen using RNeasy® Mini kit (Qiagen) following the manufacturer's protocol. Spectrostar Nanodrop was used to determine the quality and quantity of RNA. The manufacturer's protocol for High Capacity cDNA Reverse Transcription Kits was followed to make single-stranded cDNA from 1000 ng of total RNA (Applied Bio systems) Cycling conditions were: 10 minutes at 25°C, 120 minutes at 37°C, and 5 minutes at 85°C. Then total RNA and cDNA samples were kept at a temperature of -80° C until use. To better understand the effect of date pit inclusion on growth rate, expression of hepatic Growth Hormone (GH) and Insulin Growth Factor-1 (IGF-1) genes was analyzed by real time-PCR using sense and anti-sense primers as previously described (18) using the following primers sets: GH, sense (5 -׳ AAGGGATCCAAGCTCCTGAT-3׳) and anti-sense (5 -׳ ATAACCACGTCCCTCAGTGC-3׳); IGF-1, sense (5 -׳ CACCTAAATCTGCACGCT-3׳) and antisense (5 -׳ CTTGTGGATGGCATGATCT-3׳); βactin as a housekeeping gene, sense (5ACCCCAAAGCCAACAGA-3׳) and anti-sense (5 -׳ CCAGAGTCCATCACAATACC-3 ). ׳ PCR reactions for each gene were carried out for each analyzed sample. Each PCR reaction consisted of 1.5 μl of 1μg/μl cDNA, 10 μl SYBR Green PCR Master Mix (QuantiTect SYBR Green PCR Kit, Qiagen), 1 μM of each forward and reverse primer for GH and IGF-1 genes while 1 μM of forward and 1.5 μM reverse primer for B-actin gene and nuclease free water to a final volume of 20 μl. Reactions were then analyzed on an Applied Biosystem 7500 Fast Real time PCR Detection system under the following conditions: 95°C for 10 minutes (holding stage) and Denaturation stage: 40 cycles at 95°C for 15 seconds, then 60°C for 1 minute (annealing and extension stage). Using the comparative CT approach, changes in gene expression were measured from real-time PCR instrumentation's generated cycle threshold (Ct) values to a reference (housekeeping) gene (βactin) (Gasparino et al. 2014), expression of splenic Interferron gamma (INF-γ) and Interleukin12 (IL-12p35) genes was analyzed by real time-PCR using sense and anti-sense primers as previously described (Gasparino et al. 2014) using the following primers sets: INF, sense (5 -׳ CTGAAGAACTGGACAGAGAG3׳) and anti-sense (5 -׳ CACCAGCTTCTGTAAGATGC-3׳); IL-12p35, sense (5 -׳ CTGAAGGTGCAGAAGCAGAG-3׳) and antisense (5 -׳ CCAGCTCTGCCTTGTAGGTT-3׳); and βactin as a housekeeping gene, sense (5ACCCCAAAGCCAACAGA-3׳) and anti-sense (5 -׳ CCAGAGTCCATCACAATACC-3 ). ׳ PCR reactions for each gene were carried out for each analyzed sample. Each PCR reaction consisted of 1.5 μl of 1μg/μlcDNA, 10 μl SYBR Green PCR Master Mix (QuantiTect SYBR Green PCR Kit, Qiagen), 1 μM of each forward and reverse primer for INF-γ and IL-12p35 genes while 1 μM of forward and 1.5 μM reverse primer for B-actin gene and nuclease free water to a final volume of 20 μl. Reactions were then analyzed on an Applied Biosystem 7500 Fast Real time PCR Detection system under the following conditions: 95°C for 10 minutes (holding stage) and 40 cycles of 95°C for 15 seconds (denaturation stage) then 60°C for 1 minute (annealing and extension stage). The comparative CT approach was used to calculate changes in gene expression from the obtained cycle threshold (Ct) values provided by real-time PCR apparatus to a reference (housekeeping) gene (actin) (18).
Statistical Analysis.
Results are expressed as Mean ± standard error (SE). Differences between means in different groups were tested for significance using a one-way analysis of variance (ANOVA) and Duncan’s post-hoc tests. The differences between means were analyzed at the 5% probability level (p ≤ 0.05), which was statistically significant. P value of 0.05 or less was considered significant by SPSS. 16 Versions.