Study area
The study was carried out in the Mother and Child Hospital, Akure (MCHA) from February to July 2019. The hospital (Latitude N70255’214’’ and Longitude E50182’476’’) was a busy 100-bedded (60 obstetrics and 40 pediatric beds), ultra-modern public facility which provides specialized and effective health care services to the Ondo State capital, ally communities and neighbouring states in the South-Western Nigeria. Akure has two seasons, which includes the rainy (wet) season that ranges from March to October and the dry season that ranges from November to February with an average annual rainfall of 2378mm, temperature range of 25.20C to 28.10C and relative humidity of 80% [1].
Ethical Clearance And Informed Consent
Prior to the commencement of the research, approval was sought from the Research and Ethics Committee of the Mother and Child Hospital and the State Ministry of Health. Informed consent was also obtained from the parents of the participants after the benefits of the research has been fully explained to them.
Recruitment Of Study Subjects
The study was a cross sectional survey and sampling was done in the hospital on 500 children aged five years and below, recruited from various points of entry into the hospital vis-à-vis emergency room, newborn unit, out-patient department (OPD) and the children’s ward.
Sample Collection
Five hundred blood samples were collected by venipuncture for malaria parasite test. Thin and thick smears were prepared on sterile slides, which were subsequently stained with Giemsa stain and view under the light microscope at X100 magnification. Two to three drops of the positive blood sample were spotted on a 3mm Whatmann filter paper and this was allowed to dry at room temperature (Dry Blood Sample [DBS]). Two hundred positive DBS were then randomly selected for the polymerase chain reaction and other molecular analysis. Demographic data such as age, sex, birth orders, ethnicity, religion, parents’ occupation and level of education were collected from the participants and entered into the study questionnaire.
Malaria parasite deoxyribonucleic acid (DNA) extraction from dried blood spots (DBS) using QIAGEN QIAMP DNA extraction mini-kit.
Two pieces of 3 mm disk from the Whatman filter paper dry blood spots were punched out using a sterile hole punch and placed into appropriately labeled 1.5 micro-centrifuge tube, to this, 180 µl of animal tissue lysis buffer was added to ensure the pieces of filter paper were soaked before incubation at 85oC for 10 minutes followed by addition of 20 µl of proteinase K stock solution. The mixture was vortexed and incubated at 56 oC for 1 hour after which lysis buffer (buffer AL) was added to the sample, thoroughly mixed by vortexing and incubated at 70 oC for 10 minutes. Absolute ethanol (200 µl) was added and thoroughly mixed. The mixture was then added to a QIAamp Mini kit spin column placed in a 2 ml collection tube and centrifuged at 8000 rpm for 1 minute. The spin column was removed and placed in a clean 2ml well labeled collection tube while the filtrate was discarded with the tube, 500 µL of Wash buffer (Buffer AW1) was then added and the mixture centrifuged at 8000 rpm for 1 minute. The collection tube containing the filtrate was discarded. Buffer AW2 (500 µl) was added to the spin column and then centrifuged at full speed (20,000 x g or 14,000 rpm) for 3 minutes. Again, the filtrate was discarded and the spin column was placed in a 1.5 mL microcentrifuge tube. DNA of the malaria parasite was eluted with 150 µl elution buffer AE, incubated at room temperature for 1 minute and centrifuged at 6,000 x g (8000 rpm) for 1 minute. The extracted DNA was stored in the refrigerator at -20 oC until it was needed for subsequent molecular studies [11]. The quality and quantity of extracted DNA yield was 1.87 and 160 ng/µL respectively.
Genotyping of Pf kelch protein gene on chromosome 13 (kelch13) and Pfmdr 1 mutant genes.
After the molecular screening of the samples for malaria parasites, genotyping analysis of Pf kelch protein gene on chromosome 13 (kelch13) and Pfmdr 1 mutant genes using PCR technique was carried out only on samples positive for P. falciparum using the concentrations of the mixtures as follows: Magnesium chloride; 1.5mM, DeoxyNucleotide TriphosphateS (dNTPs); 0.2mM, forward primer; 0.4mM, reverse primer; 0.4mM, Taq polymerase 0.04 mM, DNA sample 160ng/ µL, PCR water 8.8 µL and Buffer 1.5 µL all in a final volume of 15 µL. The genotyping analysis was done using the appropriate set of primers shown in Tables 1 and 2 after which the PCR products were subjected to electrophoresis analysis [12].
The primary amplification reaction from the nested PCR method for the Pfmdr1 involved the use of the primer pair for the forward and the reverse reaction; S 5’-ATGGGTAAAGAGCAGAAAGA-3’ and 5’- AACGCAAGTAATACATAAAGTCA − 3’ respectively for a 250–500 base pair product. The PCR product obtained was used as the template for the secondary PCR using the following primer pairs: S 5’-TGGTAACCTCAGTATCAAAGAA-3’ and S 5’- ATAAACCTAAAAAGGAACTGG − 3’ for a 250–500 base pair product. The PCR reactions were carried out in a final volume of 15 µl, using a DNA Engine Tetrad PTC-225 thermal cycler (MJ Research, USA) with cycling parameters of an initial denaturation at 94°C for 3 minutes [12] followed by 25 cycles of 92°C for 30 seconds, annealing at 48°C for 45 seconds, extension at 65°C for 1 minutes and a final cycle of extension at 65°C for 5 minutes (Table 1). The cycling parameters for the secondary reaction was 94°C for 3mins for initial denaturation, followed by 25 cycles of 92°C for 30secs, annealing at 48°C for 45 seconds, extension at 65°C for 1 minutes and a final cycle at 65°C for 5 minutes all at 25 cycles (Table 1).
The primary amplification reaction of the PfK13 on the other hand involved the use of the primer pair for the forward and the reverse reaction; S 5’-CGGAGTGACCAAATCTGGGA-3’ and 5’-GGGAATCTGGTGGTAACAGC-3’ respectively for a 849 base pair product. The PCR reactions were also carried out in a final volume of 15 µl. The PCR product obtained from the primary reaction was used as the template for the secondary PCR using the following primer pairs for the forward and reverse reactions: S 5’- GCCAAGCTGCCATTCATTTG-3’ and S 5’- GCCTTGTTGAAAGAAGCAGA-3’ respectively. The nested PCR was done with initial denaturation at 95°C for 15 minutes (BMRL, 2010) followed by 25 cycles of 95°C for 30 seconds, annealing at 58°C for 2 minutes, extension at 72°C for 2 minutes and a final cycle of extension at 72°C for 2 minutes (Table 2). The cycling parameters for the secondary reaction was at 95°C for 15 minutes for initial denaturation, followed by 25 cycles of 95°C for 30secs, annealing at 58°C for 2 minutes, extension at 72°C for 2 minutes and a final cycle at 72°C for 10 minutes all at 25 cycles (Table 2).
Table 1 Parasite Genotyping for Pfmdr1 (N86Y) -Asparagine to Tyrosine on position 86
Primary
Genes
|
Primer
|
Sequence (5_–3_)
|
PCR Conditions
|
Size
(Base Pair, bp)
|
References
|
Pfmdr 1
|
Forward
|
ATGGGTAAAGAGCAGAAAGA
|
Initial Denaturation: 94oC for 3 minutes Denaturation: 92oC for 30 seconds
Annealing: 48oC for 45 seconds
Extension: 65oC for 1 minute
Final extension: 65 oC for 5 minutes post hold at 4 oC.
All at 25 cycles,
|
476 (mutant)
256 (wild)
250 (mixed)
|
[12]
|
Reverse
|
AACGCAAGTAATACATAAAGTCA
|
Secondary Reaction
Genes
|
Primer
|
Sequence (5_–3_)
|
PCR Conditions
|
Size
(BasePair, bp)
|
References
|
Pfmdr 1
|
Forward
|
TGGTAACCTCAGTATCAAAGAA
|
Initial Denaturation: 94oC for 3 minutes Denaturation: 92oC for 30 seconds
Annealing: 48oC for 45 seconds
Extension: 65oC for 1 minute
Final extension: 65 oC for 5 minutes post hold at 4 oC.
All at 25 cycles,
|
476 (mutant)
256 (wild)
250 (mixed)
|
[12]
|
Reverse
|
ATAAACCTAAAAAGGAACTGG
|
Table 2 PCR Amplification of Plasmodium falciparum K-13 Propeller Gene (Pfk13) Primer Sequences:
Primary
Genes
|
Primer
|
Sequence (5_–3_)
|
PCR Conditions
|
Size
(Base Pair, bp)
|
References
|
K13
|
Forward
|
CGGAGTGACCAAATCTGGGA
|
Initial Denaturation: 95oC for 15:00mins, Denaturation: 95 oC for 30s, Annealing: 58 oC for 2minutes, Extension 72 oC for 2 mins, Final extension 72 oC for 10 minutes
|
849
|
[13]
|
Reverse
|
GGGAATCTGGTGGTAACAGC
|
Secondary
Genes
|
Primer
|
Sequence (5_–3_)
|
PCR Conditions
|
Size
(Base Pair, bp)
|
References
|
K13
|
Forward
|
GCCAAGCTGCCATTCATTTG
|
Initial Denaturation: 95oC for 15:00mins, Denaturation: 95 oC for 30s, Annealing: 58 oC for 2minutes, Extension 72 oC for 2 mins, Final extension 72 oC for 10 minutes
|
849
|
[13]
|
Reverse
|
GCCTTGTTGAAAGAAGCAGA
|
Data analysis
Carl Pearson Chi-Square was used to determine the significance of resistant genes between gender. Analyses were done using the Statistical Package for the Social Sciences (SPSS) version 20.0 statistical software for Windows (IBM, Armonk, N.Y., United States).