Chemicals and Reagents
The chemicals/reagents were mainly procured from Thermo Scientific Pvt. Ltd., USA; Himedia Laboratories, India; Sigma-Aldrich, St. Louis, Missouri, United States; Life Technologies Carlsbad, California, United States; unless otherwise indicated. The plastic ware was chiefly purchased from Tarson, India; Genetix Biotech Asia Pvt. Ltd., India and Jet Biofil Guangzhou, China.
Experimental Animals & Sampling
The Gravid Uteri (N = 22) of pregnant ewes (Ovis aries) containing 2–3 month old fetuses were collected from the local abattoir located in Srinagar, J & K. The samples were transported to the laboratory in an insulated box containing warm 1X buffered saline (8.5 g of NaCl + 1.365 g of Na2HPO4 + 0.243 g of NaH2PO4 in 1000ml of distilled water) fortified with antibiotics (100 IU Penicillin, 100 µg Streptomycin) within 2 hours of slaughter. The study was granted Institutional Ethical Clearance Vide No. AU/FVS/PS-57/21/5402, dated: 12/08/2021.
Isolation and Culture of MSCs from Ovine Fetal Adnexa
The gravid uterus was washed a few times with luke warm buffered saline fortified with antibiotics to remove debris, if any. It was followed by dissection of the gravid horn to expose fetal adnexa. The fetal adnexa served as a source of four cell lines of MSCs viz., oWJ, oAS, oAF, oCB and were isolated while following a standard protocols for each cell type (Plate 1). The oAF from the amniotic cavity was collected in a 50 ml Falcon tube (Genetix Biotech Asia Pvt. Ltd., India) using a sterile syringe and centrifuged at 1500 rpm for 15 minutes. The cell pellet was washed twice by 1X DPBS (TS1006, Himedia Laboratories, India) and suspended in the culture medium Dulbecco's Modified Eagle Medium (AL149, Himedia Laboratories, India) containing 15% FBS (RM9955, Himedia Laboratories, India) along with 2 mM L-Glutamine (25030149, ThermoFisher Scientific, Brazil), 50µg/ml Gentamycin (15750037, ThermoFisher Scientific, Brazil, USA) and 250 µg/ml Amphotericin (15290018, ThermoFisher Scientific, Brazil, USA) and later seeded in the wells of a 12-well culture plate (980020, Tarsons, India) which was placed in a CO2 incubator (New Brunswick Scientific Co Galaxy 170S, San Diego, USA) maintained at 37°C with 5% CO2. The oWJ and oAS were separated from the fetus, excised into small 1–2 mm pieces, washed thoroughly and cultured in vitro using explant method. Similarly, mononuclear MSCs from oCB were separated by density gradient centrifugation method using LSM-1077 (LS001, HiMedia Laboratories Pvt. Ltd, India). The oCB-MSCs were cultured in a similar pattern as that of oAF.
The explants of oWJ and oAS were removed as soon as the growth around them was visible (Plate 2). The media in the culture wells was changed after every 3–4 days. The cells were harvested for sub-culturing at 70–80% confluence using 0.25% Trypsin (TCL006, HiMedia Laboratories Pvt. Ltd, India) and seeded at 2:1 ratio. The cells were sub-cultured upto P3 and P5 for all the experiments.
RNA isolation and cDNA synthesis from MSCs
The MSC (oWJ, oAS, oAF & oCB) monolayer was washed with ice cold DPBS (TS1006, Himedia Laboratories, India). The RNA was isolated from the cells by TRIZOL method (Rio et al. 2010) at P3 and P5. The purity and concentration of isolated RNA was examined in Nanodrop Spectrophotometer (Thermo Scientifc, USA). The purity (λ260/λ280) of 1.8-2.0 was considered as good for RNA. Agarose gel (1.5%) (RM201, HiMedia Laboratories Pvt. Ltd, India) electrophoresis was performed to access the integrity of RNA.
The RevertAid First Strand cDNA synthesis kit (K1622, Thermo Scientific, Lithuana) was used to reverse transcribe total RNA (500 ng) into cDNA as per the manufacturer's guidelines using a Thermal Cycler (Applied Biosystems, Thermo Fisher Scientific, Singapore). The cDNA formed was stored at -20oC for various downstream processes.
Amplification of cDNA and Agarose Gel Electrophoresis
The Ovine specific primers for GAPDH, Stem cell surface markers (CD34, CD73, CD90 & CD105) and Pluripotency markers (SOX2 & OCT4) were selected from the published literature (Tables 1 & 2). The fragment size of PCR amplified products was confirmed by Agarose gel (1.8%) electrophoresis against a Gene ruler, 50 bp DNA ladder (SM0371, Thermo Scientific, USA).
Table 1
Gene transcripts, primer sequences and resulting fragment size of stem cell markers
Gene | Primer sequence | Accession number | Product size (bp) | Annealing Temperature (oC) |
CD73 | f - TGGTCCAGGCCTATGCTTTTG | BC114093 | 115 | 57 |
r - GGGATGCTGCTGTTGAGAAGAA |
CD90 | f- CAGAATACAGCTCCCGAACCAA | BC104530 | 97 | 58 |
r - CACGTGTAGATCCCCTCATCCTT |
CD105 | f - CGGACAGTGACCGTGAAGTTG | NM-001076397 | 115 | 59 |
r - TGTTGTGGTTGGCCTCGATTA |
CD34 | f- TGGGCATCGAGGACATCTCT | AB021662 | 107 | 58 |
r - GATCAAGATGGCCAGCAGGAT |
GAPDH | f - TGACCTATGGCAACCGATACAA | AJ507200 | 76 | 58 |
r - CCGCAAAAGACATCCAGGAT |
Table 2
Gene transcripts, primer sequences and resulting fragment size of pluripotency markers
Gene | Primer sequence | Accession number | Product size (bp) | Annealing Temperature (oC) |
Sox2 | f - CATGAACGGCTCGCCCACCTACAG | XM-004003838.1 | 267 | 57 |
r - TCTCCCCCGCCCCCTCCAGTTCAC |
Oct4 | f - GATCGGGCCGGGGGTTGTGC | XM-004018968.1 | 235 | 58 |
r - TCGGCTCCAGCTTCTCCTTGTCCA |
For amplification of cDNA, the 20 µl reaction mixture (1 µl template cDNA, 1 µl forward primer, 1 µl reverse primer, 7 µl nuclease free water and 10 µl Dream Taq Green PCR Master Mix) were incubated in a Thermal Cycler (Applied Biosystems, Thermo Fisher Scientific, Singapore). The program for amplification was set as initial denaturation at 95oC for 5 minutes, followed by 35 cycles at 95oC for 30 seconds, 57oC for CD73 & SOX2; 58oC for GAPDH, CD34, CD90 & OCT4; 59oC for CD105 for 30 seconds and 72oC for 30 seconds and final extension at 72oC for 5 minutes and then holding temperature was 4oC. All these samples were examined on Agarose gel (1.8%) by following the standard procedure given by Sambrook (1989). The gels were subsequently photographed by Bio Rad Gel Doc System (Bio-Rad laboratories Inc., USA).
Growth Kinetics and Population Doubling Time (PDT)
The growth kinetics at P3 and P5 for all the four types of MScs was determined by seeding 10,000 viable cells per well and incubated in the culture medium which was changed after every 4th day. The cells were harvested and counted after every 2 days until day 12. The viable cells were counted by Trypan Blue Dye Exclusion Method (Tolnai 1975) using the formula;
No. of Cells/µl = (N/4) x 10 x DF
Where, DF is the dilution factor.
The growth curve was plotted between the culture time along X-axis against the change in the number of cells along Y-axis.
PDT was calculated using the formula put forth by Pratheesh et al (2013);
PDT (in hours) = t x log(2)/log (Nt/N0)
Where, t is culture period (in hours) at which cells were harvested and subsequently counted, Nt is the number of cells harvested at a particular time and N0 is the number of cells seeded at day 0 (i.e., 10,000).
Colony Forming Unit (CFU) assay
The colony forming unit (CFU) assay was performed at P3 by seeding 100 viable MSCs in the wells of a 12 well culture plate (980020, Tarsons, India) and incubated for 3 weeks at 37oC in a humidified CO2 incubator (New Brunswick Scientific Co Galaxy 170S, San Diego, USA). The medium was replaced with fresh one after every 4th day. At the end of incubation, cells were washed with DPBS (TS1006, Himedia Laboratories, India), fixed with 4% formaldehyde followed by staining with 1% crystal violet (V5265, Sigma-Aldrich, India) solution for 20 minutes. The wells were observed under inverted Microscope (CKX53, Olympus, Japan), clusters with > 20 cells were considered as clones and were scored as per the method of Gade et al (2013).
Statistical Analysis
The data for growth kinetics and colony forming unit (CFU) assay were analyzed by three way and one way ANOVA, respectively using SPSS version 20.0 (SPSS Inc., Chicago, IL, USA) Statistical Software. The data presented as mean ± SE were considered significant at p ≤ 0.05.