Truncated Human IRF-1 (1-233) protein shows neutral transcriptional effect on expression of Bax, survivin, Bcl2 and cyclin D1 genes in HEK293T cell line

doi:10.21203/rs.3.rs-1749803/v1

Download PDF

Research Article

Truncated Human IRF-1 (1-233) protein shows neutral transcriptional effect on expression of Bax, survivin, Bcl₂ and cyclin D1 genes in HEK293T cell line

https://doi.org/10.21203/rs.3.rs-1749803/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

We generated the truncated IRF-1(1-233 amino acids), lacks total C-terminal domains, like the Transactivation domain, instability domain, Multifunctional domains. We used semi-nested PCR technique followed by gene cloning in E.coli and observed profound expression of mutant GST-IRF-1 protein (~ 52 kDa) in 12.5% SDS PAGE. We ectopically expressed truncated mutant version of IRF-1 and wild version of IRF-1 in Human Embryonic Kidney cell line HEK293 and HEK293T. We observed truncated version of IRF-1 was unable to show any effect on the expression of chromosomal genes, like Bcl₂, surviving and cyclin D1. In addition to that truncated mutant IRF-1 did not influence the growth and proliferation of HEK293 and HEK293T cells that were also confirmed by MTT assay. Although both wild and truncated version of IRF-1 showed similar DNA binding activity by EMSA technique yet, both shows differential transcription activation activity. Hence, these findings demonstrate that the region 234–325 amino acids in human IRF-1 is important for the expression of Bax, Survivin, Bcl2, and Cyclin D genes in the present experimental model system.

Molecular Biology

Interferon Regulatory Factors

Recombinant

GST-IRF-1

Immunoblot

and MTT assay

Truncated recombinant human IRF-1

IRF-1, an essential transcription factor that is involved in immunogenesis and oncogenesis, was discovered in 1988 and initially characterized as a type I interferon (IFN) gene activating transcription factor. During the study of IFN_β gene regulation upon viral infection, it was discovered that the promoter of the IFN_β gene was regulated by an anti-viral factor known as IRF-1 [1, 2, 3]. IRF-1 belongs to a family known as IRF family, which is further divided into four sub-families. They are namely, IRF-1 sub-family (IRF-1 and IRF-2), IRF-3 sub-family (IRF-3 and IRF-7), IRF-5 sub-family (IRF-5 and IRF-6) and IRF-4 sub-family (IRF-4, IRF-8 and IRF-9) [4]. Among these sub-families IRF-1 sub-family is very important because members of this family are implicated in antiviral pathway as well as anti-oncogenesis/oncogenesis. The N terminal of both IRF-1 and IRF-2 contains the DNA-binding domain which is characterized by five tryptophan residues each separated by 10–18 amino acids whereas, a regulatory domain is located on the C-terminal, which is comparatively less well conserved and also interact with other members of IRF family in order to show diversity in functions. The transcriptionally active C-terminal region of IRF-1 is rich in acidic amino acids and Ser-Thr residues. Apart from these, IRF-1 contains Minimal Activation domain (233–260), which is for activation of target gene expression, IRF associated domain 2 (IAD-2) (164 263 a. a.), instability domain (269–325 a.a.) and Multifunctional domain-1 (Mf-1) (301–325 a.a.) [5]. Due to instability domain IRF-1 is degraded after ubiquination and makes this protein half-life to only 30 minutes long (Pion et. al., 2009). Multifunctional domain is recently discovered domain, which makes this molecules proapoptotic in nature [6]. Besides that, C-terminal of IRF-1 is phosphorylated by casein kinase II that converts latent IRF-1 into functionally active IRF-1 molecule [7]. Thus, C-terminus of IRF-1 is vital for its functional diversity.

In this study, we examined the truncated version IRF-1’s transcriptional activity on some key genes of cell cycle and apoptosis (CDK1, Bax, Bcl₂ and survivin). The C-terminal deleted domains, like Mf-1, instability and Minimal activation domain of IRF-1(1-233) is generated by semi-nested PCR, is expressed in HEK293 and HEK 293T cell line. We demonstrated truncated version of IRF-1 is unable to transcriptionally activate bax, surviving, Bcl2 and cyclicD 1 gene. Thus, C-terminal of this protein along with N-terminal domain is absolutely required for its full function(s).

The analytical grades of chemicals were purchased from Genetix, Himedia, Fermentas, Titan, SIGMA. The filtered milli-Q (0.22µm) water was used for the preparation of solutions. Different methods were used to sterilized solutions, glass and plastic wares either through autoclaving or by filtration. The appropriate temperatures were used to store all the chemicals. Luria Bertani, the bacterial media was brought form HIMEDIA and antibiotics were brought from SIGMA. Different components like Taq. DNA polymerase enzyme, Restriction enzymes, Glutathione agarose beads were purchased from G Biosciences, New England Biolabs, Genetix and SIGMA, respectively. The vectors used for this study were pTZ57R/T (Thermo Scientific), pGEX2TK (GE healthcare), pCDNA3.1 (Invitrogen) and pEGFP-N1 (Clontech Laboratories, Inc.). DMEM (Dulbecco's Modified Eagle’s Medium and MEM (Minimum Essential Medium). HEK293 and HEK293T cell lines were purchased from NCCS, Pune, INDIA.

Semi-nested PCR amplification of truncated huΔIRF-1 (1-699 bp): The wild-type huIRF-1 DNA sequence was deleted (700–975 bp; 92 amino acid) at the C- terminal end to generate the deleted huΔIRF-1 (1-699 bp, 233 amino acid). pT1.3 clone plasmid DNA (2888 + 975 bp) was used as a template to be amplified by internal primers; Forward Primers: 5’AAGGATCCATGCCCATCACTCGGAT3’ (underlined is BamHI restriction site) Reverse Primers: 5’TTGAATTCCCGGTAACGATCTAGCT3’ (Underlined is EcoRI Restriction site).

Sub-cloning of IRF-1 and ΔIRF-1 in pcDNA3.1 vector

The human IRF-l was transferred from pTZ57R/T into the pcDNA3.1 mammalian expression vector (Invitrogen) to form the pCDNA3.1-IRF-1. This was carried out by EcoRI and BamHI restriction digestion of pTZ57R/T-IRF-1 and pTZ57R/T-ΔIRF-1 recombinant vectors. The smaller fragments of size 991 and 699 bp were gel purified and ligated with double digested pCDNA3.1 vector. The ligation mixture was transformed into E. coli/DH5α cells and the positive clones were selected by colony PCR and plasmid restriction digestion.

Maintenance of HEK-293 and HEK293T cells

Cell lines HEK293 and HEK293T (Human Embryonic Kidney cells) were used in this study. These cell lines (HEK293 and HEK293T) were purchased from National Centre for Cell Science, Pune and maintained in MEM (Minimum Essential Medium) and DMEM (Dulbecco's Modified Eagles Medium with high Glucose) complete medium supplemented with 2 mM L- glutamine, 10% FBS and 1X antibiotic solution. All cells were cultured in a humid atmosphere at 37°C with 5% CO₂. When confluence exceeding 80%, sub-culturing of HEK293 and HEK293T cells were done in every 3-4 days. Cells were washed with 1xPBS for sub-culturing further treated with 0.1% trypsin-EDTA solution; the flask was thus gently shake to remove the cells from the plate and produce a single cell-suspension. The cell suspension was centrifuged at 1500 rpm for 5 minutes. The supernatant was discarded and the cells were resuspended in 2 ml of fresh MEM or DMEM and maintained at 37°C, 5% CO2 with humidity. Further cells were observed under the inverted microscope.

Cell counting

Cells were diluted with trypan blue stain at 1:1 dilution for cell counting. Then 10 µl of stained and mixed cells were counted on a haemocytometer. Cell count in a four corner square is divided by four to find out an average number of cells in one area of haemocytometer. The number of cells was counted by the following formula: No. of cells/ml = Total No. of cells in 4 square/4 X 10⁴ X Dilution factor

Transfection of HEK-293 and HEK-293T cells with plasmid DNA

For high cell density, high efficiency, high expression levels, and to minimize cytotoxicity, transfection of cells by using different DNA (μg) to Lipofectamine 2000 (μl) ratio i.e., of 1:2 to 1:3. One day before transfection 0.5-2 x 10⁵ HEK-293 and HEK293T cells in 500 μl of the growth medium was grown in DMEM supplemented with 10% FBS with 1x antibiotic mix solution so that cells will be 70-90% confluent at the time of transfection. Preparations of complexes for transfection of plasmid DNA are as follows: Different sets of plasmid DNA contained a gene of interest (pCDNA-IRF-1, pCDNA-IRF-1, pCDNA3.1) were diluted and mix gently in 50 μl of Opti-MEM Reduced Serum Medium (Solution A) in three different MCT. Lipofectamine 2000 was also diluted in the three different 1.5 ml MCT with 50 μl of Opti-MEM Medium (Solution B). These different diluted solutions were incubated for 5 minutes at RT. DNA (Solution A) was diluted with Lipofectamine 2000 solutions (Solution B). The samples were briefly mixed and kept at room temperature for 20 minutes and prepare three different sets of plasmid DNA: Lipofectamine diluted solutions. Solution A: Solution B mixture (100 μl) was then added directly to the cells with medium and mixed the plate gently by rocking back and forth. For observation of transgene, expression cells were incubated at 37°C in a CO₂ incubator for 24-48 hours.

Measurement of Cytotoxicity by MTT assay

MTT assay was used to determine qualitative and quantitative evaluations of the viability of cells. Cells were seeded in 96 well plates contain 100 μL of the complete medium at the density of approximately 1x10⁵ cells per well. After an incubation of 48 hours, culture medium was removed and replaced with aliquots of 100 μL of medium containing the appropriate concentration of extracts particles. PCDNA3.1 empty vector transfected the cells were treated as control. A total of three wells were assigned for each transfected cell. The cells were transfected with different sets of plasmid DNA (pCDNA-IRF-1, pCDNA-IRF-1, pCDNA3.1) for 24 hours. After the incubation period, these cells were observed microscopically to assess the transfection positive cells; this was the indication of qualitative evaluation of gene of interest. Added 80-100 μL of MTT reagent to each well and gently mixed at least for 60 seconds and the plates were incubated at 37°C in the incubator for approximately 4 hours; cells were lysed by adding 100 μL of Dimethyl Sulfoxide (DMSO) to each well. At 560 nm wavelength absorbance was measured to determine the cytotoxicity effect and quantitative evaluation of gene of interest using the ELISA plate reader linked to a computer using ChromaxPro software.

Preparation of Protein extracts from cell lines

Protein extracts from cultured cells that were used for immunoblot were made by using Radio immunoprecipitation assay (RIPA) buffer. 100 µl of an appropriate lysis buffer was used per 1x10⁶ cells. The cultured monolayer cells were rinsed with cold PBS 3 times. Through trypsinization or by using a cell scraper, transfer the cell suspension in 2 ml of MCT tube with a final rinse. Cells were centrifuged at 1,500 rpm for 5 minutes at 4°C and discarded the supernatant as much as possible. For preparation ice-cold lysis buffer, 5 µl Protease Inhibitor Mixes were added to 1 ml of extraction buffer. 100µl of ice-cold cell lysis buffer was added and resuspended the pellets followed by incubation on ice for 10 minutes. Vortexes tubes briefly and proceed to sonication with the following settings 40% amplitude with 30 seconds on and 30 seconds off cycles, repeated 5-8 cycles by using Ultrasonic Homogenizer Sonicator in ice. Briefly vortexed the sample and visually checked the samples after 5 cycles, the viscosity should be reduced after perfect sonication. To prevent protein damaged the shortest sonication time should be chosen. The supernatant was transferred to a new MCT tube and samples were centrifuged at 14,000 rpm for 15 minutes at 4°C to remove any remaining insoluble material. Take an aliquot for the quantification and the further analysis if needed. Stored the extracted proteins at -80°C.

Immunoblot

The unbound antibody was removed by washing with PBST washing buffer. The blot was incubated for 1 hour at RT with horseradish peroxidase-conjugated anti-mouse secondary antibody (1:10,000 in 3% BSA; Santa Cruz, USA) after three washing with PBST. The unbound antibody was removed with PBST washing buffer and the blot was developed using 0.6 mg/ml DAB substrate solution (0.1 mM NaCl pH 7.6, 50 mM Tris-HCl, 0.01% H2O2) at RT for 0.5-2 minutes of incubation. The bands of expressed protein were visualized in the ChemiDoc TM MP imaging system for their analysis.

Expression of recombinant huΔIRF-1 in E. coli/BL21 (DE3) cells

The SDS-PAGE profiling shows the profound expression of recombinant truncated human GST-IRF-1 in E.coli/BL21 (DE3) cells. A protein band of ~ 52 kDa was observed in IPTG (0.5 mM) induced lane and was absent from uninduced lane (Fig. 1A, lane 2 and 3). Simultaneously, we did not observe any other band induced with the full-length recombinant protein. Furthermore, we confirmed the induced band of protein was of our interest by immunoblot. Figure 1B shows the immunoblot band developed after using anti IRF-1 polyclonal antibody in order to identify the ΔhuIRF-1-GST fusion protein.

Transfection and cell cytotoxicity

After confirming protein expressed faithfully in E.coli, we constructed wild and truncated IRF-1 pCDNA3.1 clones for transient expression in HEK 293 and HEK 293T cell lines. We then transfected the single clones of IRF-1 as well as truncated IRF-1 in HEK 293 and HEK-293T cell lines. We achieved 80-90% transfection efficiency using lipofectamine as a transfecting agent (data not shown). The cell cytotoxicity was further studied by MTT assay. Figure 2 A showing results of wild and truncated IRF-1 transfected in HEK-293T cell line, there was reduction of % of cell survival from 100 to 40 by wild type IRF-1 whereas no such significant reduction of % of cell survival 100 to 80 was observed with truncated IRF-1 (See figure 2A). These effects were only observed in HEK-293 T cell line no such effects were observed on HEK-293 cell line. Thus, the clones of wild and truncated IRF-1 had no cytotoxic effect on HEK-293 and HEK-293T cell lines.

Effects of ectopic expression of wild type and truncated IRF-1 (21-233 a. a.) on the expression Bax, Survivin, Bcl₂ and Cyclin D1 genes

Realizing the relevance of IRF-1 in the regulation of Bax, Survivin, Bcl₂ and Cyclin D1 genes, we decided to study their expression by western blotting in HEK293T and HEK293 cells transfected with wild type and truncated IRF-1. The quantity of IRF-1 in total protein extract from transfected HEK293 and HEK293T cells, where untransfected cells and transfected pCDNA3.1 empty vector were taken as a control and the Actin protein was used as an internal control. The different proteins expression was studied with the protein- specific antibodies for Bax, Survivin, Bcl₂, Cyclin D1 and actin.

Figure 3 shows expression of Bax gene under different pCDNA3.1 vectors transfected in HEK 293 and HEK- 293T cell lines. We found Bax expression to be increased by huIRF-1 in transfected HEK293T cell lines (Fig. 3 (A) & (B)). Of the different genes that are differentially regulated by transformation, no changes were observed to the expression level of Bax in transformed cells by huΔIRF-1 (Fig. 3 (A)). Similar experiment was done with HEK-293 cells and now effect of truncated IRF-1 was observed whereas wild type IRF-1 showed induction of Bax gene expression (figure 3 (C)). Graphical analysis also confirming the above said statement about the expression of Bax protein (Figure 3 (B) and (D)).

Next, we checked the effect(s) of wild type and truncated IRF-1 on the expression of surviving gene in the same cell lines. We observed, IRF-1 was down regulating the expression of survivin in HEK-293T cell line (Figure 4 (A)). Moreover, the graphic analysis also confirming the same result. (Figure 4 (B) and (C)). In contrast, the wild and truncated IRF-1 showed no effect on the expression of surviving gene by immunoblot as well as by densitometric and graphical analysis of immunoblotted protein bands (Figure 4 (C) and (D).

Subsequently, we checked Bcl₂ (anti-apoptotic gene) and Cyclin D1 expression in HEK-293 and HEK-293T cell lines upon expression of wild type and truncated IRF-1. Figure 5 A shows the effect on expression of Bcl₂gene expression; wild type IRF-1 downregulating the expression of Bcl₂after 72 hours (see figure 5A, 72 hours lane). This result is further supported by densitometry analysis of immunoblot bands (Figure 5 (B). Figure 5 B and C shows that truncated IRF-1 didn’t have any effect on the expression of Bcl₂ gene. Thus, wild type IRF-1 is negatively regulating the Bcl₂ in transformed cell whereas truncated IRF-1 has neutral effect.

Moreover, we have checked the transient expression effect of wild type and truncated IRF-1 on expression of CCND1 gene, which codes for Cycling D1 protein. Cyclin D1 protein plays vital role in cell cycle progression. Cyclin D1 in association with CDK (cyclin dependent kinase) phosphorylate the RB (retinoblastoma) protein during G1 phase to S phase progression. Upon transient expression of wild and truncated IRF-1 in cell lines, we observed wild type IRF-1 is downregulating the expression of Cyclin D1 in HEK-293T cell lines (see figure 6 A and B). After comparing its expression at 0 hour to 72 hours, IRF-1 is suppressing its expression whereas truncated IRF-1 is neither suppressing nor activating. (Figure 6 A and B). Thus, IRF-1 has negative effect on cyclinD1 expression in HEK 293T cell line while truncated has neutral effect. When we expressed the both clones in HEK 293 cell line, we observed not any effect on CyclinD1 expression (Figure 6 C and D).

The human IRF-1 is a 325 amino acid long protein having at N-terminal DNA binding domain, multi-functional domain 2 (Mf2) and Nuclear Localization Sequence (NLS) whereas at C-terminal Multifunctional domain 1 (Mf1), instability domain and Transactivation domain present. We have expressed the truncated recombinant human IRF-1 (1-233 amino acids) as a GST fusion protein in E.coli/Bl21 bacterial cells. We observed profound expression of truncated IRF-1 protein expression in E.coli of (~ 52 kDa) (Fig. 1A; lane 3). This is the first report that we have expressed successfully truncated IRF-1 in heterologous system that we further confirmed it by western blot (Fig. 1, lane B). We used anti IRF-1 antibody to probe the expression of truncated recombinant IRF-1 in E.coli extract. We further sub-cloned it into pCDNA3.1 mammalian expression vector for transfection study. We then expressed the truncated IRF-1 as well as wild type IRF-1 in HEK 293T and HEK 293 cell lines. As expected, wild type IRF-1 expressed in HEK 293T cell lines driven the cells to undergo cell death (Fig. 2A) whereas truncated IRF-1 was unable to do so (Fig. 2B) by MTT assay. At the same time in HEK 293 cell line not any cells undergoing under cell death by both Truncated and wild type IRF-1. Thus, wild type IRF-1 is apoptosis inducer in Transformed cells whereas truncated IRF-1 is unable to show any effect on cell survival or death in both transformed and non-transformed cells.

In various cell systems, over-expression of the oncoprotein Bcl2 can delay or prevent apoptosis by various death-promoting signals. One of the mitochondrial membrane proteins is encoded by Bcl2 gene that blocks apoptotic signal in lymphocytes. In follicular lymphoma, Bcl₂ protein overexpression is reported as Bcl2 gene found to be translocated downstream of constitutive expressed heavy Ig chain gene [8]. Bcl2 gene encodes an integral outer mitochondrial membrane protein that blocks the apoptotic death of some cells such as lymphocytes. Constitutive expression of Bcl2, such as in the case of translocation of Bcl2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma [9]. To determine how huIRF1 and huΔIRF-1 regulate Bcl2 expression in a human embryonic kidney cell line, we used both pCDNA3.1-huΔIRF-1 and pCDNA3.1-IRF-1 for transfection. In HEK293 and HEK293T cells stably overexpressing huIRF-1, huΔIRF-1, or GFP as a control, Bcl2 and expression were upregulated in huIRF-1 transfected cells (Fig. 5 (A) & (B)). We observed an approximately ~ 4-fold decrease in Bcl2 expression when huIRF-1 transfected HEK293T cells were used. These data strongly support a functional link between IRF-1 induction and antiapoptotic Bcl2 family member expression in HEK293T cell lines. HEK293 Transfected cells expressing huIRF-1 has not increased the levels of anti-apoptotic Bcl2 (Fig. 5 (C) & (D)). In contrast, Bcl2 was not expressed in both HEK293 and HEK293T cells transfected with huΔIRF-1 (Fig. 5 (A), (B), (C) & (D)). Ectopic expression of IRF-1 induced apoptosis in different cell lines which correlated with the activation of caspase-7 and with the downregulation of the Bcl2 oncoprotein, as observed for IFNβ-induced apoptosis in parental EW-7 and COH cell lines [10].

Uncontrolled cell cycle progression is reported in oncogenic transformation. Nucleophoshoprotein Rb (Retinoblastoma), a tumor suppressor, phosphorylation is important for G1 to S phase transition as cyclin D1 protein activates CDK4 and CDK6, which phosphorylated Rb protein [11]. Besides that cyclin E-CDK2 also phosphorylate pRb. Phosphorylated pRb is unable to bind with E2F transcription factor, which is absolutely required for activation of E2F downstream genes, Cyclin A is also required for S-phase entry. [12]. The concentration of Cyclin D1 in the cell is the highest during the mid-G1 phase and then gradually declines. [13] We found that ectopic huIRF-1 over-expression led to down-regulation of cyclin D1 and inhibited cell cycle progression in HEK293T cells (Fig. 6 (A) & (B)), but huΔIRF-1 overexpression has not been down-regulated the expression of Cyclin D1 in HEK293 and HEK293T cells (Fig. 6 (A), (B), (C) & (D)). We showed that IRF-1 inhibits proliferation by negatively regulating the cell cycle at the level of the G1-S phase transition and thereby prevents growth. IRF-1 thus mediates its tumor-suppressive function by the down- regulating cyclin D1 and huΔIRF-1 does not show any effect on both cell lines. Overexpression of cyclin D1 has been found in many human tumors and is believed to promote cell proliferation and differentiation by shortening the G1/S transition [14].

In brief, Fig. 3, 4, 5, 6 (A & B) shows an expression of, Bax, Survivin, Bcl₂, and Cyclin D1 is upregulated by IRF-1 at the protein level in HEK-293T cells. The level of expression of the wild type IRF-1 in HEK293 and HEK293T cells increased with increasing time. However, the level remained unaffected with increasing cells transfected with truncated huΔIRF-1, where the 92 amino acid has been deleted from the human IRF-I, did not upregulate the expression of any of these genes. It is possible that with the deletion of the transactivation domain which has not activated the signaling cascade pathway. Expression of Actin, a housekeeping gene and the level of which was observed in all sets of transfections, including non-transfected cells. Thus, expression of Bax, Survivin, Bcl2, Cyclin D1 is not influenced by increasing concentration of huΔIRF-1 in HEK-293 and HEK293T cells. Furthermore, we did not observe any changes in different gene expression following by transfection with IRF-1 and huΔIRF-1 in HEK293 cells.

Lee et al. searched additional splice variants and examined their effect on wild-type IRF-1 and characterized variants from normal and malignant human cervical cancer tissue samples [15]. Five splice variants of human IRF-1 were revealed in cervical cancer tissues, which lack some combination of exons 7, 8 and 9; their expression levels were higher in the malignant samples. Exons 7, 8, and 9 contain the IRF-1 transactivation domain and instability domain. These variants had predicted deletions of the functional domain or truncated protein isoforms have different transcriptional activities and attenuated transcriptional activity of IRF-1 [15]. By the exon skipping mechanism, five splice variants of IRF-1 were generated. These variants not only lack transcriptional activity but they also found to be competed with wild type IRF-1, thereby decreasing IRF-1 functionality. [15]. The truncated IRF-1, we have generated close to splice variants of human cervical cancer. Taken together, exon 7, 8 and 9 variants of IRF-1, which lacks ubiquitin target site by which protein gets longer half-life in compared to wild IRF-1 protein half-life (~ 30 minutes). [16]. The variants retain the potential DNA binding domain and are thus likely to compete with IRF-1. Thus, this truncated IRF-1 is likely to differ in their transcriptional activities on the IRF-1 responsive promoter. It may thus be proposed that the deleted region of the complete IRF-1 is important for the expression of these genes in the present experimental model system. This provides new information regarding the functional significance of the 233–325 amino acids region of IRF-1. Thus, the transactivation domain of IRF-I is needed to be studied in greater detail. Transactivation domain deletion in IRF-1 (huΔIRF-1) analysis revealed that huΔIRF-1 is dispensable for apoptotic and antiapoptotic protein expression in both HEK293 and HEK293T cells because truncation has nullified ΔIRF- 1 effect on gene(s) expression.

The C-terminal of IRF-1 is absolutely required for the generating functional diversity in IRF-1 tumor suppressor protein. We deleted minimal activation domain, instability domain and multifunctional domain-1 which convert IRF-1 into totally functionless. Lee et. al. had reported variant from cervical cancer showed oncogenic activity as well as competitor cum repressor of wild type endogenous IRF-1 functions [15]. Thus, we concluded that Mf-1 domain in absence of activation domain is absolutely required for oncogenic transformation.

Acknowledgements:

We acknowledge the University Biotechnology department for Research equipment/infrastructure and support for carrying out research work. UGC scholarship to SKM is gratefully acknowledged.

DECLARATIONS: The authors declare they don’t have any conflict of interest.

Ethical approval: Not applicable

Consent to participate: Not applicable

Consent to Publish: we, the undersigned, give our consent for the publication of research details, which can include data photograph(s) or details within the text (“Material”) to be published in the above Journal.

Authors Contributions: Krishna Prakash supervised and guided Mr. Santosh Kumar Mishra to carry out the present research work. Santosh Kumar Mishra was the PhD student; he carried out all wet work of this MS. Rizwanul Haque was the head of the Department; he also guided SKM for Cell line work and provided him valuable suggestion(s).

Funding: Not applicable

Competing Interest: Not applicable

Availability of data and materials: The data that support the findings of this study are made available on the demand.

Miyamoto, M., Fujita, T., Kimura, Y., Maruyama, M., Harada, H., Sudo, Y.,.. . Taniguchi, T. (1988). Cell, 54(6), 903–913.
Tamura, T., Yanai, H., Savitsky, D., & Taniguchi, T. (2008). Annual Review of Immunology, 26, 535–584.
Takaoka, A., Tamura, T., & Taniguchi, T. (2008). Cancer science, 99(3), 467–478.
Aleksandra Antonczyk 1, Bart Krist 1, Malgorzata SajAntonczyk A, Krist B, Sajek M, Michalska A, Piaszyk-Borychowska A, Plens-Galaska M, Wesoly J, Bluyssen HAR.(2019). Frontier in Immunology 2019 May 24;10:1176. doi: 10.3389/fimmu.2019.01176. PMID: 31178872
Harada, H., Fujita, T., Miyamoto, M., Kimura, Y., Maruyama, M., Furia, A.,. .. Taniguchi, T. (1989). Cell, 58(4), 729–739.
Alsamman K & El-Masry S. O. (2018) Bioscience Reports, Jun 29; 38(3): BSR20171672.
Lin, R., & Hiscott, J. (1999). Developments in Molecular and Cellular Biochemistry (DMCB, volume 27) 3074 (169–180): Springer.
Salvesen, G. S., & Dixit, V. M. (1997). Cell, 91(4), 443–446.
Hill, M. E., MacLennan, K. A., Cunningham, D. C., Vaughan Hudson, B., Burke, M., Clarke, P.,. .. Mason, D. (1996). Blood, 1;88(3):1046-51.
Sancéau, J., Hiscott, J., Delattre, O., & Wietzerbin, J. (2000). Oncogene, 19(30), 3372–3383.
Malumbres, M., Sotillo, R. o., Santamaría, D., Galán, J., Cerezo, A., Ortega, S.,. .. Barbacid, M. (2004). Cell, 118(4), 493–504.
Kröger, A., Stirnweiss, A., Pulverer, J. E., Klages, K., Grashoff, M., Reimann, J., & Hauser, H. (2007). Cancer research, 67(7), 2972–2981.
Kröger, A., Ortmann, D., Krohne, T. U., Mohr, L., Blum, H. E., Hauser, H., & Geissler, M. (2001). Cancer research, 61(6), 2609–2617.
Resnitzky, D., & Reed, S. I. (1995). Molecular and cellular biology, 15(7), 3463–3469.
Lee, E.-J., Jo, M., Park, J., Zhang, W., & Lee, J.-H. (2006). Biochemical and biophysical research communications, 347(4), 882–888.
Nakagawa K, Yokosawa H (2000) European J. Biochemistry 267(6):1680–1686

Download PDF

Version 1

posted

You are reading this latest preprint version

Truncated Human IRF-1 (1-233) protein shows neutral transcriptional effect on expression of Bax, survivin, Bcl₂ and cyclin D1 genes in HEK293T cell line

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusions

Declarations

References

Status:

Version 1