Long noncoding RNA ASH1L-AS1 promotes glycolysis and cisplatin resistance in ovarian cancer cells via its regulation on EZH2-mediated CNRIP1 methylation

doi:10.21203/rs.3.rs-1749954/v1

PDF

Research Article

Long noncoding RNA ASH1L-AS1 promotes glycolysis and cisplatin resistance in ovarian cancer cells via its regulation on EZH2-mediated CNRIP1 methylation

https://doi.org/10.21203/rs.3.rs-1749954/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 22 Jun, 2022

You are reading this latest preprint version

Background

As one of the commonest female malignant tumors, ovarian cancer (OC) is regarded as a serious public burden in the world. In this work, we hypothesized that long noncoding RNA ASH1L-AS1 could regulate the glycolytic pathway to affect the sensitivity of OC cells to cisplatin. The present study aims at proving this hypothesis and the possible mechanism.

Methods

The differential expression of the genes in GSE38666 dataset was analyzed, and the results were verified by RT-qPCR method in the OC tumor tissues and cell lines. Then, the expressions of ASH1L-AS1 and CNRIP1 were altered in A2780 OC cell lines by plasmid transfection, followed by 10 µmol/mL of cisplatin treatment. After the cell treatment, the extracellular acidification rate (ECAR) and lactate production were quantified, while the cell functions of proliferation, colony formation, migration, and apoptosis were evaluated. Also, the expression levels of the key genes related to glycolytic pathway (GAPDH, ALDOA, and PKM2) were identified. Finally, the in vitro results were verified in vivo by subcutaneous tumor formation experiment.

Results

ASH1L-AS1 was verified to be highly-expressed in OC. LncMAP database prediction indicated that ASH1L-AS1 may be involved in the regulation of CNRIP1. Moreover, ASH1L-AS1 overexpression or EZH2 overexpression was found to promote the glycolysis and cisplatin resistance of OC cells, which also increased the cancerous cell growth in vitro and tumor growth in vivo. Also, the relationship analysis results revealed that ASH1L-AS1 could increase the methylation of CNRIP1 promoter region through the recruitment of EZH2.

Conclusions

ASH1L-AS1 may increase the promoter methylation of CNRIP1 by recruiting EZH2, which promotes the glycolysis and chemoresistance to cisplatin of OC cells, highlighting a novel therapy target for OC.

Ovarian cancer

long noncoding RNA ASH1L-AS1

CNRIP1

EZH2

glycolysis

chemoresistance

cisplatin

Ovarian cancer (OC), as the 7th commonest cancer and the 8th commonest reason of cancer-related death among females, has been statistically reported to affect 239,000 new cases and lead to 152,000 deaths worldwide annually [1, 2]. As OC often known as a silent killer, its diagnosis o is usually achieved at an advanced stage due to the vague symptoms, which make it difficult to cure [3]. The risk of different OC subtypes in women may be associated with the factors including height, body mass index (BMI), family history of OC, selected dietary factors, parity, oral ontraceptive, early age at menarche, late menopause, as well as hormone replacement therapy in menopause [4]. These complex risk factors, especially some of which are hardly modified established risk factors (such as menstrual and reproductive factors), and the lack of effective early diagnosis technology, hamper the prevention and treatment of OC [4]. In addition, several studies indicate the interaction between aerobic glycolysis and chemoresistance, which is still regarded as an important main therapy of carcinomas [5–7]. Therefore, it is indispensable to discover reliable molecular mechanisms for influencing glycolysis and chemoresistance for the disease management and survival for the patients with OC.

Long non-coding RNAs (lncRNAs), refer to functional RNA molecules without protein-coding functions, have been demonstrated to function as regulators in pathological processes in cancers, including OC, which have attracted considerable attentions in recent years [8]. The involvement of lncRNAs have been demonstrated in a variety of processes from the histone modification and chromatin remodeling to the transcriptional regulation and posttranscriptional regulation, with the specific function in the progression and metastasis in OC by regulation on the main pathways [9]. Mounting evidence has indicated the abnormally high expression of multiple lncRNAs in OC, which were functional for OC development by modulating different molecular mechanisms [10, 11]. For example, lncRNA NORAD was observed to be upregulated in epithelial ovarian cancer (EOC), the downregulation of which may exert an inhibitory effect on cancerous cell functions [12]. Interestingly, based on the GSE38666 microarray dataset retrieved from the Gene Expression Omnibus (GEO), we found that ASH1L antisense RNA 1 (ASH1L-AS1), a lncRNA, is significantly highly-expressed in OC tissue samples (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38666), which is located at chromosome 1 - NC_000001.11 (https://www.ncbi.nlm.nih.gov/gene/?term=ASH1L-AS1). However, the researches focused on the specific function of ASH1L-AS1 in the progression of OC are rare, which aroused our great interest in exploring something deeper in this topic. Moreover, enhancer of zester homolog 2 (EZH2) is well-known as a histone methyl transferase could regulate polycomb repressive complex 2 (PRC2) to mediate the tri-methylating the lysine 27 residue of histone H3 (H3K27me3), the overexpression of which has been implicated in the tumor growth and chemoresistance in OC [13, 14]. A previous study demonstrated that the methylation of cannabinoid receptor interacting protein 1 (CNRIP1) promoter is involved in the regulation of the activity for cancerous cells [15, 16], which was identified as a downstream gene of ASH1L-AS1 in our earlier investigation using bioinformatic analysis. Based on the afore-mentioned researches, we hypothesize in the present investigation that there may be an interaction between ASH1L-AS1 and EZH2-mediated CNRIP1 promoter methylation, which may participate in the regulation of glycolysis and chemoresistance of tumor cells in OC.

Ethical approval

All experiment protocols were approved by the ethics committee of Shengjing Hospital of China Medical University. The experiments involved human beings were guided by the Declaration of Helsinki, with the written informed consents obtained from the donors or their relatives by. The experiments involved animals were employed in accordance with the principles of the National Institutes of Health Guide for the Care and Use of Laboratory.

Cell treatment and transfection

The human normal ovarian epithelial cell line IOSE80 was purchased from Shanghai Huiying Biotechnology Co. Ltd (Shanghai, China) and human OC cell lines A2780, SKOV3, and OVCAR3 were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). These cell lines were all cultured in Roswell Park Memorial Institute (RPMI-1640) or Dulbecco's Modified Eagle’s Medium (DMEM) (Gibco BRL, Grand Island, NY, USA) that containing 10% fetal bovine serum (FBS; Gibco) at 37℃ with 5% CO₂. When the OC cells were in logarithmic phase, the cells were trypsinized and inoculated into 6-well plates with 1 × 10⁵ cells/well. After 24 h of conventional culture, the OC cells were transfected with plasmids according to the instructions of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) when cells reached about 75% confluence. The used plasmids included shRNA against ASH1L-AS1 (sh-ASH1L-AS1), CNRIP1 overexpression plasmid (oe-CNRIP1), or the corresponding negative control (NC) plasmids (sh-NC and oe-NC). Then, the cells were further treated with 10 μmol/mL cisplatin.

Clinical sample collection

From October 2019 to December 2020, 57 cases of tumor tissue samples were collected from OC patients underwent surgery in Shengjing Hospital of China Medical University, while 10 cases of normal ovarian tissue samples were obtained from patients with benign uterine diseases (uterine leiomyoma) underwent hysterectomy and bilateral salpingo-oophorectomy. All enrolled 67 individuals were female, with a mean age of 58 ± 7 years old (46 – 69 years old), who received no anti-tumor therapies before surgery. The tissue samples were confirmed by pathological examination after operation.

RNA isolation and quantification by reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Trizol (15596026, Invitrogen) was used for total RNA extraction from tissues and cells. RNA was then reversely transcribed into complementary DNA (cDNA) using the PrimeScript RT reagent Kit (RR047A, Takara, Tokyo, Japan). Next, the cDNA was subjected to real-time qPCR analysis using a Fast SYBR Green PCR kit (Applied biosystems, Foster City, CA, USA) on the ABI PRISM 7500 RT-PCR system (Applied biosystems). The used sequences are listed in Table 1. The relative expression levels of mRNAs were normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or Actin, followed by 2^-ΔΔCt calculation. The experiment was repeated three times.

Protein isolation and quantification by Western blot assay

The total protein was extracted from tissues and cells by radio-immunoprecipitation assay (RIPA) lysate buffer (BOSTER Biological Technology Co., Ltd., Wuhan, Hubei, China) containing protease inhibitors. A bicinchoninic acid (BCA) assay kit (BOSTER Biological Technology Co., Ltd.) was then applied for detection of protein concentration. Next, the protein samples were subjected to 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) separation and transferred onto a polyvinylidene fluoride (PVDF) membrane by electrophoretic transfer method. Following this, the protein samples were sealed with 5% bovine serum albumin (BSA) at room temperature for 2 h in order to block the non-specific binding. The PVDF membrane was subsequently incubated at 4℃ overnight with diluted primary antibodies against Ki67 (4928, 1: 1000) and PCNA (4621, 1: 1000), with β-actin (ab5441, 1: 1000, Abcam; Cambridge, UK) as internal control. Following this, the membrane was further incubated with horseradish peroxidase-labeled goat anti-rabbit secondary antibody (ab205719, 1: 2000, Abcam) at room temperature for 1 h. The enhanced chemiluminescence detection solution (Millipore, Bedford, MA, USA) was used to visualize the samples in the X-ray film, followed by Image J software quantification. The relative protein expression was expressed by the ratio between the gray value of target protein band to that of β-actin protein band. The experiment was repeated three times.

RNA immunoprecipitation (RIP) assay

The binding between ASH1L-AS1 and EZH2 proteins was identified by using a Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore). The cells washed by pre-cooled phosphate buffered saline (PBS) solution were lysed using RIPA (P0013B, Beyotime Biotechnology, Shanghai, China) on ice for 5 min, followed by 10-min centrifugation at 14000 rpm at 4℃. The supernatant was randomly separated into two parts, a part of which was used as an input and the other part was co-precipitated with antibodies. RNA was isolated from the input and samples after digestion by Protease K, which was analyzed by RT-qPCR assay for ASH1L-AS1 expression. The used antibodies were rabbit anti-EZH2 (ab16046, 1: 100, Abcam) at room temperature for 30 min or immunoglobulin G (IgG) (ab109489, 1: 100, Abcam) as NC. The experiment was repeated three times.

Soft agarose colony formation assay

The experiment was carried out in a 6-well plate with a layer of agarose gel (about 2000 - 4000 cells per well). The cells were incubated in a humidified incubator with 5% CO₂ at 37℃ for 12 - 14 h, followed by renewal of medium every two days. When the colonies grown enough to count, the culturing can be stopped. After that, the colonies were fixed with 4% paraformaldehyde for 10 min, and then stained with 1% crystal violet dye. The number and size of the stained colonies were calculated by Fiji software.

Cell proliferation determination

A cell counting kit-8 (CCK-8) Kit (Dojindo Laboratories, Kumamoto, Japan) was applied to evaluate the cell proliferative ability. After 48 h of transfection, the cells were reacted with CCK-8 solution for 1 - 4 h, with the optical density (OD) measured at 450 nm wavelength by an enzyme labeling instrument. The experiment was repeated three times

Cell apoptosis determination

Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) staining assay was employed for cell apoptosis evaluation. After 48 h of transfection, the cells were subjected to three PBS washes and 30-min fixation using 4% paraformaldehyde, which were then treated with 0.5% TritonX-100 for 10 min. Following this, 50 μL of TUNEL probes (C10618, Invitrogen) was added for 4 h-co-culturing with cells at room temperature. Then, the cells were stained by 4’6-diamidino-2-phenylindole (DAPI) for 3 min, followed by microscopical observation to count the TUNEL-positive cells (green fluorescent stained cells).

Chromatin immunoprecipitation (ChIP) analysis

According to the instruction of a ChIP kit (P2078, Beyotime), the cells were fixed with 1% formaldehyde, which were then subjected to ultrasonic treatment on ice to produce 500 - 1000 bp fragments. Next, the fragments were incubated overnight with H3K27me3 antibody (ab6002, 1: 200, Abcam) and normal IgG (ab172730, 1: 100, Abcam) as isotype NC, respectively. Then, the magnetic bead was used for complex precipitation, which was analyzed by RT-qPCR.

Cell migration detection

After 48 h of cell transfection, the serum of cells was starved overnight, and then separated from the culture plate by trypsinization. Then, 1 × 10⁵ cells were seeded in a 200 mL of serum-free RPMI1640 medium in an 8 mm Transwell upper chamber. Meanwhile, 650 mL of RPMI1640 medium containing 10% FBS was put into the lower chamber. After 12 h of cell culturing, the cells migrated through the membrane were counted.

CNRIP1 promoter methylation detection

Genomic DNA was extracted and quantified by a Biospin Genomic DNA Extraction Kit (BSC05S1). Then, we used an EpiTect Bisulfite Kit (59104; QIAGEN, GmbH, Hilden, Germany) to modify DNC with bisulfite. The used PCR primers (CNRIP1-F: 5’-GAGTAGTAGTGTTTATTTTA-3’; CNRIP1-R: 5’-ACAATTTAAACTCCTCCTCTAAAAC-3’) were synthesized by Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). The PCR products were ligated into the clone T vector, and the successfully cloned PCR products were selected for sequencing by Sangon. Finally, according to the sequencing data, we calculated the sequence similarity to target sequence (%), C-T conversion efficiency (%), methylation status of each CG pair, as well as methylation rate of each CG pair (%).

Glycolysis Stress test

For Glycolysis Stress test, the cells were plated in a 96-well XF analyzer and XF Cell Glycolysis Kit (Seahorse; Agilent Technologies, Palo Alto, CA, USA). The XF sensor was incubated with the provided calibrator at 37℃ overnight without CO₂ 12 h before the experimental analysis. Next, the cells were re-placed into the 96-well XF analyzer (about 3 × 10⁴ cells/well). The plate was subsequently washed using medium and incubated at 37℃ without CO₂ again 30 min before measurement. Following this, 2 mM of oligomycin, 500 nM of FCCP, and 1 mM of mixture of antimycin A and rotenone were added to the appropriate port of the kit and calibrated. After the calibration, the cell culture plate was loaded into the instrument and measured according to the standard template.

Lactate content determination

The lactate production was determined with the use of a Lactate Assay Kit (#MAK064; Sigma). In brief, 5 × 10⁵ cells were inoculated into a 35 mm culture plate for 48 h, which were then lysed in lactate analysis buffer. After that, 5 - 10 μL lysate was taken from each sample, and added with a reaction mixture consisting of assay buffer solution, substrate, and developing agent. Finally, the OD value was measured using a microplate reader at 570 nm wavelength to calculate the lactate content.

In vivo animal experiments

Forty-eight 6-8-week-old healthy nude mice (Institute of Materia Medica, Chinese Academy of Medical Sciences, Beijing, China) were housed individually under specific pathogen-free (SPF) conditions, with free access to food and water. The experimental environment was maintained as: 60% - 65% humidity, 22 - 25℃ temperature, and 12 h of light and dark cycle. Before the experiment started, the mice were subjected to a week of adaptive feeding, and the health status was observed. The nude mice were assigned randomly into 8 groups with 6 mice per group, including sh-NC, sh-ASH1L-AS1, sh-ASH1L-AS1 + oe-CNRIP1, sh-NC + cisplatin, sh-ASH1L-AS1 + cisplatin, sh-ASH1L-AS1 + oe-CNRIP1 + cisplatin, oe-ASH1L-AS1 + oe-CNRIP1, and oe-ASH1L-AS1 + oe-CNRIP1 + cisplatin. In brief, the A2780 cells stably transfected with above mentioned plasmids (1 × 10⁹ cells/100 μL) were subcutaneously injected into the back of the nude mice, twice a week for 6 weeks. After 14 days of tumor formation, cisplatin (2 μg/mg body weight) was given into the mice intraperitoneally for one week. Finally, the mice were euthanized to measure the tumor size and weight, and the expressions of Ki67 and PCNA and drug resistance were analyzed.

Statistical analyses

Data analyses were processed by SPSS 21.0 statistical software (SPSS, IBM, Chicago, IL, USA). The measurement data were expressed as mean ± standard deviation. Comparisons between the two groups were conducted using unpaired student’s t-test, while differences among multiple groups were compared by one-way analysis of variance (ANOVA) with Tukey’s post hoc test. Kaplan-Meier method was used to calculate the survival rate of enrolled patients. Log-rank test was applied for univariate analysis. Pearson correlation analysis was employed to analyze the correlation of the observed indexes. p < 0.05 indicated the difference was statistically significant.

ASH1L-AS1 is highly-expressed in OC tissues and cells

The differential analysis based on the GSE38666 OC-related gene dataset showed the upregulated expression of ASH1L-AS1 in OC tissues. In order to validate it, we further detected the expression pattern of ASH1L-AS1 by RT-qPCR in 57 cases of OC tissues and 10 cases of normal ovarian tissues. The results also showed a higher expression pattern of ASH1L-AS1 in OC tissues relative to that in normal ovarian tissues (Fig. 1A). Also, as RT-qPCR detection on the cell lines demonstrated, compared with the IOSE80 human normal ovarian epithelial cell line, the expression of ASH1L-AS1 was increased in the three human OC cell lines (A2780, SKOV3, and OVCAR3), while a highest level was identified in the A2780 cell line (Fig. 1B). Thus, we chose A2780 cell line for subsequent experiments. Subsequently, we used three different shRNAs to knock down the ASH1L-AS1 expression in the A2780 cells, and sh-ASH1L-AS1-2 showed best silencing efficiency to lead to the lowest ASH1L-AS1 expression (Fig. 1C). Therefore, sh-ASH1L-AS1-2 silencing sequence was used. These results suggested the high expression of ASH1L-AS1 in OC tissues and cell line.

ASH11-AS1 silencing inhibits glycolysis and cisplatin resistance of OC cells

In order to study the effect of ASH1L-AS1 on the glycolysis of OC cells, the extracellular acidification rate (ECAR) of A2780 cells was measured. As shown in Fig. 2A, the ECAR was reduced in the A2780 cells with sh-ASH1L-AS1 relative to those with sh-NC. Then, we detected the expression pattern of glycolytic pathway-related genes, including GAPDH, ALDOA, and PKM2, which showed a decreased tendency in the A2780 cells after ASH1L-AS1 silencing (Fig.e 2B). Also, as illustrated in Fig. 2C, lactate production was found to be reduced in the A2780 cells with knockdown of ASH1L-AS1. Furthermore, the A2780 cells with transfection of sh-NC or sh-ASH1L-AS1 were treated with cisplatin, followed by detection using CCK-8, colony formation, and Transwell experiments. The results revealed that, relative to the sh-NC treatment, the proliferative ability, colony formation ability, and migrated ability of the A2780 cells were decreased upon the ASH1L-AS1 treatment, which were further decreased after the additional treatment of cisplatin (Fig. 2D-F, and Supplementary Fig. 1A, B). Next, TUNEL staining was employed for cell apoptosis evaluation, demonstrating that the silenced ASH11-AS1 led to increased apoptotic capability of the A2780 cells, which was further promoted by cisplatin treatment (Fig. 2G, and Supplementary Fig. 1C). Overall, the above-mentioned findings highlighted that the glycolysis and cisplatin resistance of OC cells could be inhibited by ASH11-AS1 silencing.

CNRIP1 inhibits glycolysis and cisplatin resistance of OC cells

The intersection of the differentially expressed genes obtained from the GEO-GSE38666 dataset and the downstream genes of ASH1L-AS1 predicted in the lncMAP database suggested that ASH1L-AS1 may be involved in the regulation of CRTAM or CNRIP1, while CNRIP1 methylation has been implicated in the cancer progression. Then, in our experiments, a lower expression of CNRIP1 was detected in the OC tissues than the normal ovarian tissues (Fig. 3A), and the A2780, SKOV3, and OVCAR3 OC cell lines also presented with decreased expression of CNRIP1, which showed a lowest level in the A2780 cell line (Fig. 3B). Therefore, the A2780 cell line was used for the subsequent cellular experiments based on CNRIP1 overexpression. It was observed that the used oe-CNRIP1 plasmid could successfully upregulate the expression of CNRIP1 in the A2780 cells (Fig. 3C). After overexpression of CNRIP1, the ECAR of the A2780 cells was reduced (Fig. 3D), while the expression of the glycolytic pathway-related genes (GAPDH, ALDOA, and PKM2) (Fig. 3E) and lactate production were also found to be decreased (Fig. 3F).

Next, with the attempt to investigate the influence of CNRIP1 on cisplatin resistance of OC cells, we used cisplatin to treat the A2780 cells with or without oe-CNRIP1 transfection. As shown in Fig. 3G-I, CCK-8, colony formation, and Transwell assays found that, when compared with the A2780 cells transfected with oe-NC plasmid, those transfected with oe-CNRIP1 plasmid exhibited obviously decreased abilities of proliferation, colony formation, and migration, which were further reduced in those transfected with oe-CNRIP1 and treated with cisplatin. Additionally, TUNEL staining showed that CNRIP1 overexpression promoted the apoptosis of A2780 cells, which was further promoted by cisplatin treatment (Fig. 3J). After that, we detected the level of CDC2 protein using Western blot, and found an elevated phosphorylated CDC2 level in the A2780 cells by CNRIP1 overexpression, which was also further increased after the additional cisplatin treatment (Fig. 3K, L). The experimental data demonstrated that the glycolysis and cisplatin resistance of OC cells could be inhibited by CNRIP1 overexpression.

ASH1L-AS1 regulates the methylation of CNRIP1 promoter through recruitment of EZH2

Based on the RPIseq database, a possible binding relationship was identified between ASH1L-AS1 and EZH2 (Fig. 4A). Then, in order to validate this interaction, RIP assay was conducted in our experiments, founding that the binding ability between ASH1L-AS1 and EZH2 was increased than the IgG control (Fig. 4B), while RNA-pull down detection revealed that ASH1L-AS1 could bind to EZH2 protein (Fig. 4C). As depicted in Fig. 4D, the expression of CNRIP1 was observed to be increased in the A2780 cells by ASH1L-AS1 silencing. After that, UCSC database (http://genome.ucsc.edu/) was applied to analyze the CNRIP1 promoter, which revealed a high enrichment of H3K27me3 in the promoter region of CNRIP1 (Fig. 4E). We subsequently detected the methylation level of CNRIP1 in the ASH1L-AS1-silenced A2780 cells. The results displayed that the methylation of CNRIP1D in the ASH1L-AS1-silenced A2780 cells was decreased when compared with the sh-NC-treated A2780 cells (Fig. 4F). ChIP assay suggested that ASH1L-AS1 silencing inhibited the H3K27me3 enrichment in the CNRIP1 promoter region (Fig. 4G). Collectively, these data indicated that ASH1L-AS1 could recruit EZH2 to regulate the methylation of CNRIP1 and affect its expression.

ASH1L-AS1 contributes to glycolysis and cisplatin resistance of OC cells via regulating the EZH2-mediated CNRIP1 methylation

As above experimental findings indicated, ASH1L-AS1 may affect the expression of CNRIP1 through EZH2-mediated methylation of CNRIP1to regulate the development of OC. For further validation, we transfected the A2780 cells with sh-NC, sh-ASH1L-AS1, or sh-ASH1L-AS1 + oe-CNRIP1. RT-qPCR (Fig. 5A) and Western blot assays (Fig. 5B, C) revealed that ASH1L-AS1 silencing treatment downregulated the expression of ASH1L-AS1 and upregulated the expressions of CNRIP1 mRNA and protein in the A2780 cells. When compared with sh-ASH1L-AS1 alone treatment, the combination treatment of sh-ASH1L-AS1 and oe-CNRIP1 didn’t significantly change the expression of ASH1L-AS1 but promoted the mRNA and peotein levels of CNRIP1 (Fig. 5A-C). Then, the ECAR of the A2780 cells were evaluated. It was observed that ASH1L-AS1 silencing resulted in a decrease of ECAR in the A2780 cells, while CNRIP1 overexpression further reduced the ECAR (Fig. 5D). RT-qPCR was also carried out to identify the expressions of glycolytic pathway-related genes (GAPDH, ALDOA, and PKM2), which were decreased in the A2780 cells following sh-ASH1L-AS1 alone treatment, and were further decreased in those following the combination treatment of sh-ASH1L-AS1 and oe-CNRIP1 (Fig. 5E). A decrease tendency was also found in the lactate production in the A2780 cells after ASH1L-AS1 knockdown, which was further reduced after CNRIP1 overexpression (Fig. 5F). After that, we further treated the transfected A2780 cells with cisplatin, and detected the change in the cellular processes including cell proliferation, colony formation, migration, and apoptosis. The corresponding data presented in Fig. 5G-J illustrated that ASH1L-AS1 silencing and CNRIP1 overexpression exhibited inhibitory effects on the proliferative and migrated abilities of the A2780 cells, while the apoptotic capability was promoted. Besides, as relative to the cells with sh-NC + cisplatin treatment, those with sh-ASH1L-AS1 + cisplatin treatment and sh-ASH1L-AS1 + oe-CNRIP1 + cisplatin treatment showed further inhibited proliferation and migration as well as promoted apoptosis. All of these suggested that ASH1L-AS1 may promote glycolysis and cisplatin resistance of OC cells by mediating EZH2-regularted CNRIP1 methylation.

ASH1L-AS1 silencing or CNRIP1 overexpression inhibits tumor development and enhances cisplatin sensitive of OC cells in vivo

Moreover, in order to further investigated the role of ASH1L-AS1/EZH2/CNRIP1 regulatory axis in the development and cisplatin resistance of OC, we performed subcutaneous tumor formation experiment. As presented in Fig. 6A, B, the mice with ASH1L-AS1 downregulation and CNRIP1 upregulation showed reduced tumor size and weight. The mice upon sh-ASH1L-AS1 + cisplatin and sh-ASH1L-AS1 + oe-CNRIP1 + cisplatin treatments also had declined tumor size and weight when compared with those upon sh-NC + cisplatin treatment. Relative to oe-ASH1L-AS1 and oe-CNRIP1 co-treatment, the co-treatment of oe-ASH1L-AS1, oe-CNRIP1, and cisplatin was observed to led to inhibited tumors in mice. Then, the levels of cell proliferation markers (Ki67 and PCNA) (Fig. 6C, D) and expressions of CNRIP1, p-CDC2, and CDC2 proteins (Fig. 6E) were quantified by protein bands using Western blot analysis. The results identified that the levels of Ki67 and PCNA proteins were decreased in the mice with ASH1L-AS1 silencing and CNRIP1 overexpression, while the protein levels of CNRIP1 and p-CDC2 were increased. As compared to the mice following only cisplatin treatment, the proteins levels of Ki67 and PCNA were declined and the protein levels of CNRIP1 and p-CDC2 were elevated in those with co-treatment of sh-ASH1L-AS1 and cisplatin and those with co-treatment of sh-ASH1L-AS1 and oe-CNRIP1 and cisplatin. Also, oe-ASH1L-AS1 + oe-CNRIP1 + cisplatin co-treatment was found to inhibit the Ki67 and PCNA proteins levels and promote the CNRIP1 and p-CDC2 protein levels in mice relative to oe-ASH1L-AS1 + oe-CNRIP1 co-treatment (Fig. 6C-E). From the above results, the involvement of ASH1L-AS1/EZH2/CNRIP1 regulatory axis in regulating tumor development and cisplatin resistance in vivo was demonstrated, that ASH1L-AS1 silencing or CNRIP1 overexpression could suppress cancerous cell growth and cisplatin resistance of OC cells in vivo.

OC is a kind of frequently female malignant tumor, which is the most vital malignant tumor in gynecology [17]. The important role of glycolysis has been recognized in tumor growth and chemoresistance in OC, while several enzymes of glycolytic pathway are regarded as potential chemotherapeutic targets [6, 18]. Considering the importance of exploring the participation of lncRNAs in regulation of methylation-related glycolytic pathway and the significance of determining this interaction in developing novel therapy target for OC, the current study investigated the role of ASH1L-AS1/EZH2/CNRIP1 regulatory axis in OC. It was found that ASH1L-AS1 affects the sensitivity of OC cells cisplatin-based chemotherapy, with the involvement of the EZH2/CNRIP1-mediated glycolytic pathway.

Evidence supporting the crucial role of lncRNAs in the initiation and progression of OC, continue to accumulate [19, 20]. In this investigation, we discovered an upregulated expression of ASH1L-AS1 in OC tissues and cells, which are currently being explored as potential oncogene contributing to the OC development. The GEO-GSE38666 dataset presented the RNA microarray profiling results of 45 tissue samples based on the Affymetrix (U133) gene expression platform, revealing that ASH1L-AS1 was significantly overexpressed in OC samples. This bioinformatic result was validated in our experimental studies based on the clinically collected tumor tissues from patients with OC and the commercially purchased human OC cell lines. ASH1L-AS1 silencing was experimentally reported to decrease the ECAR and lactate production in OC cells. It is often assumed that extracellular acidification may be solely caused by glycolytic lactate production. The detection on ECAR and lactate production is a measure of glycolysis, which could be used to quantitatively measured the glycolytic flux to lactate [21]. Therefore, this result of the present study suggests the inhibition of ASH1L-AS1 silencing in glycolysis in OC. Inhibition of glycolysis in cancerous cells is previously being explored as a potential novel strategy to improve drug resistance resulted from mitochondrial respiratory defect and hypoxia [22]. In addition, as demonstrated by the results from the in vitro assays of CCK-8, colony formation, Transwell, and TUNEL staining, and the ASH1L-AS1 knockdown and/or cisplatin suppressed the OC cell proliferation, colony formation, and migration abilities, accompanied by promoted cell apoptosis, highlighting that ASH1L-AS1 silencing could inhibit the chemoresistance of OC cells to cisplatin. Overall, these data are supportive in regard to the promoting role of ASH1L-AS1 in OC development. Also, the ASH1L-AS1 silencing could inhibit the glycolysis in OC, and enhance the sensitivity of OC cells to cisplatin. Regrettably, there are rare documents focused on the dynamic function of ASH1L-AS1 in regulating the glycolysis. In future, the expanded sample size, increased research approaches, and diverse research directions are warranted for the deeper investigation on this topic.

As an important finding of the underlying mechanism of ASH1L-AS1 in OC obtained in our experiment was that ASH1L-AS1 binds to EZH2 to promote the CNRIP1 methylation, thereby negatively regulating the expression level of CNRIP1 in OC cells. Through the correlation analysis of the GSE38666 dataset by employing RPIseq database (http://pridb.gdcb.iastate.edu/RPISeq/), ASH11-AS1 was identified to be negatively correlated with CNRIP1. CNRIP1 is an intracellular protein that interacts with the C-terminal tail of CB1R and regulates its intrinsic activity [23]. A growing number of studies have documented the methylation of CNRIP1 promoter in cancers, such as colorectal cancer, non-Hodgkin lymphoma, and gastric cancer [24-26]. Additionally, it was revealed that EZH2 could induce H3K27me3 in OC cells, which also showed a negative correlation with CNRIP1 in our experiment. In the line with this finding, H3K27me3 and DNA methyltransferases at the gene promoter were promoted by EZH2 overexpression, which further facilitated the invasive and migrated abilities of OC cells [27]. In our study, we also found that ASH11-AS1 overexpression or CNRIP1 silencing led to the decrease in the phosphorylation level of CDC2. In the current study, our result provide evidence for the involvement of the ASH11-AS1-regulated EZH2/CNRIP1/CDC2 axis in the glycolysis and chemoresistance of OC cells.

From the experimental data obtained in the present study, it comes to a conclusion that ASH1L-AS1 recruits EZH2 to promote the methylation of CNRIP1, which further inhibits the expression of CNRIP1, thus promoting glycolysis and reducing the cisplatin sensitivity of the OC cells (Fig. 7).

Ovarian cancer (OC), body mass index (BMI), Long non-coding RNAs (lncRNAs), Gene Expression Omnibus (GEO), enhancer of zester homolog 2 (EZH2), polycomb repressive complex 2 (PRC2), cannabinoid receptor interacting protein 1 (CNRIP1), negative control (NC), reverse transcription-quantitative polymerase chain reaction (RT-qPCR), complementary DNA (cDNA), radio-immunoprecipitation assay (RIPA), bicinchoninic acid (BCA), sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), polyvinylidene fluoride (PVDF), bovine serum albumin (BSA), RNA immunoprecipitation (RIP), phosphate buffered saline (PBS), immunoglobulin G (IgG), optical density (OD), 4’6-diamidino-2-phenylindole (DAPI), Chromatin immunoprecipitation (ChIP), specific pathogen-free (SPF), analysis of variance (ANOVA)

Ethics approval and consent to participate

Consent for publication

Not applicable.

Availability of data and materials

The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

This study was supported by the National Natural Science Foundation of China (No. 81872125) and Outstanding Scientific Fund of Shengjing Hospital (No. 201704).

Author contributions

XFS and YW conceived and designed research. LLY and GYS performed experiments. QY analyzed data. LLY and YW interpreted results of experiments. GYS prepared figures. XFS and YW drafted manuscript. edited and revised manuscript. All authors approved final version of manuscript.

Acknowledgments

We thank our colleagues for technical help and stimulating discussions.

Webb PM, Jordan SJ. Epidemiology of epithelial ovarian cancer. Best Pract Res Clin Obstet Gynaecol. 2017;41:3–14.
Reid BM, Permuth JB, Sellers TA. Epidemiology of ovarian cancer: a review. Cancer Biol Med. 2017;14:9–32.
Stewart C, Ralyea C, Lockwood S. Ovarian Cancer: An Integrated Review. Semin Oncol Nurs. 2019;35:151–6.
La Vecchia C. Ovarian cancer: epidemiology and risk factors. Eur J Cancer Prev. 2017;26:55–62.
Dar S, Chhina J, Mert I, Chitale D, Buekers T, Kaur H, et al. Bioenergetic Adaptations in Chemoresistant Ovarian Cancer Cells. Sci Rep. 2017;7:8760.
Chakraborty PK, Mustafi SB, Xiong X, Dwivedi SKD, Nesin V, Saha S, et al. MICU1 drives glycolysis and chemoresistance in ovarian cancer. Nat Commun. 2017;8:14634.
Suh DH, Kim HS, Kim B, Song YS. Metabolic orchestration between cancer cells and tumor microenvironment as a co-evolutionary source of chemoresistance in ovarian cancer: a therapeutic implication. Biochem Pharmacol. 2014;92:43–54.
Zhan L, Li J, Wei B. Long non-coding RNAs in ovarian cancer. J Exp Clin Cancer Res. 2018;37:120.
Braga EA, Fridman MV, Moscovtsev AA, Filippova EA, Dmitriev AA, Kushlinskii NE. LncRNAs in Ovarian Cancer Progression, Metastasis, and Main Pathways: ceRNA and Alternative Mechanisms. Int J Mol Sci. 2020;21.
Oncul S, Amero P, Rodriguez-Aguayo C, Calin GA, Sood AK, Lopez-Berestein G. Long non-coding RNAs in ovarian cancer: expression profile and functional spectrum. RNA Biol. 2020;17:1523–34.
Worku T, Bhattarai D, Ayers D, Wang K, Wang C, Rehman ZU, et al. Long Non-Coding RNAs: the New Horizon of Gene Regulation in Ovarian Cancer. Cell Physiol Biochem. 2017;44:948–66.
Tong L, Ao Y, Zhang H, Wang K, Wang Y, Ma Q. Long noncoding RNA NORAD is upregulated in epithelial ovarian cancer and its downregulation suppressed cancer cell functions by competing with miR-155-5p. Cancer Med. 2019;8:4782–91.
Liu T, Cai J, Cai J, Wang Z, Cai L. EZH2-miRNA Positive Feedback Promotes Tumor Growth in Ovarian Cancer. Front Oncol. 2020;10:608393.
Dai ZY, Jin SM, Luo HQ, Leng HL, Fang JD. LncRNA HOTAIR regulates anoikis-resistance capacity and spheroid formation of ovarian cancer cells by recruiting EZH2 and influencing H3K27 methylation. Neoplasma. 2021.
Zhang T, Cui G, Yao YL, Wang QC, Gu HG, Li XN, et al. Value of CNRIP1 promoter methylation in colorectal cancer screening and prognosis assessment and its influence on the activity of cancer cells. Arch Med Sci. 2017;13:1281–94.
Chen D, Wu H, Feng X, Chen Y, Lv Z, Kota VG, et al. DNA Methylation of Cannabinoid Receptor Interacting Protein 1 Promotes Pathogenesis of Intrahepatic Cholangiocarcinoma Through Suppressing Parkin-Dependent Pyruvate Kinase M2 Ubiquitination. Hepatology. 2020.
Kujawa KA, Lisowska KM. [Ovarian cancer–from biology to clinic]. Postepy Hig Med Dosw (Online). 2015;69:1275–90.
Jia L, Zhou J, Zhao H, Jin H, Lv M, Zhao N, et al. Corilagin sensitizes epithelial ovarian cancer to chemotherapy by inhibiting Snailglycolysis pathways. Oncol Rep. 2017;38:2464–70.
Wang JY, Lu AQ, Chen LJ. LncRNAs in ovarian cancer. Clin Chim Acta. 2019;490:17–27.
Ren C, Li X, Wang T, Wang G, Zhao C, Liang T, et al. Functions and Mechanisms of Long Noncoding RNAs in Ovarian Cancer. Int J Gynecol Cancer. 2015;25:566–9.
Mookerjee SA, Goncalves RLS, Gerencser AA, Nicholls DG, Brand MD. The contributions of respiration and glycolysis to extracellular acid production. Biochim Biophys Acta. 2015;1847:171–81.
Akram M. Mini-review on glycolysis and cancer. J Cancer Educ. 2013;28:454–7.
Perez SM, Donegan JJ, Boley AM, Aguilar DD, Giuffrida A, Lodge DJ. Ventral hippocampal overexpression of Cannabinoid Receptor Interacting Protein 1 (CNRIP1) produces a schizophrenia-like phenotype in the rat. Schizophr Res. 2019;206:263–70.
Huang Q, Yang Q, Mo M, Ye X, Zhang J, Zhang L, et al. Screening of exon methylation biomarkers for colorectal cancer via LC-MS/MS strategy. J Mass Spectrom. 2017;52:860–6.
Bethge N, Lothe RA, Honne H, Andresen K, Troen G, Eknaes M, et al. Colorectal cancer DNA methylation marker panel validated with high performance in Non-Hodgkin lymphoma. Epigenetics. 2014;9:428–36.
Chong Y, Mia-Jan K, Ryu H, Abdul-Ghafar J, Munkhdelger J, Lkhagvadorj S, et al. DNA methylation status of a distinctively different subset of genes is associated with each histologic Lauren classification subtype in early gastric carcinogenesis. Oncol Rep. 2014;31:2535–44.
Yi X, Guo J, Guo J, Sun S, Yang P, Wang J, et al. EZH2-mediated epigenetic silencing of TIMP2 promotes ovarian cancer migration and invasion. Sci Rep. 2017;7:3568.

Table 1. Primer sequences used for RT-qPCR assay

Primer name	Sequence (5’-3’)
CNRIP1	GCATCCAGCCTAATGACGG	TCAGTTCCAGTGGGACAAGC
EZH2	GGCAGCACTTCCTGTCCAAT	TTCTTTCCATAACTGCTGAATCTCA
ASH1L-AS1	CCAGGAAGGGCTGTGTTGAT	CTGGTTACAGCATTGCTCGC
GAPDH	CACCATCTTCCAGGAGCGAG	CCTTCTCCATGGTGGTGAAGAC
ALDOA	GCAGAATTTGGGAGCTGTTT	GTCAATTCCCCGATCCTCTT
PKM2	GAGGCAGCTCAAGAAGCACT	CAAACACCACATCACACACG
ACTIN	TCACCCACACTGTGCCCATCTACGA	CAGCGGAACCGCTCATTGCCAATGG

No competing interests reported.

FigureS1.tif
Representative experimental images of Figure 2; A, Representative images of colony formation ability of the ASH1L-AS1-silenced A2780 cells after cisplatin treatment in Figure 2E; B, Representative images of migrated ability of the ASH1L-AS1-silenced A2780 cells after cisplatin treatment by Transwell assay in Figure 2F; C, Representative images of apoptotic ability of the ASH1L-AS1-silenced A2780 cells after cisplatin treatment by TUNEL staining in Figure 2G.

PDF

Version 1

posted 22 Jun, 2022

You are reading this latest preprint version

Long noncoding RNA ASH1L-AS1 promotes glycolysis and cisplatin resistance in ovarian cancer cells via its regulation on EZH2-mediated CNRIP1 methylation

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Materials And Methods

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Tables

Competing Interests

Supplementary Files

Status:

Version 1